A method for inducing apomixis using a lec2 gene and its use in plant breeding

CN122790971APending Publication Date: 2026-09-22CHINA NAT RICE RES INST
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510326829.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-19
Publication Date
2026-09-22

AI Technical Summary

Technical Problem

一方面,虽然无融合生殖植株能够保持正常的结实率,其克隆种子的生成效率却相当低

Benefits of technology

[0017] In rice-related research, there have been reports showing that BBM1 and BBM4 It can induce apomixis, and the LEC2 gene discovered in this invention has been verified to also be applied to apomixis to produce clonal seeds, thus possessing high application value. Although based on ToPAR The apomixis achieved normal seed setting rate and a clonal seed efficiency of up to 67.7%, but due to... ToPAR The gene originates from dandelion, rather than being an endogenous gene of rice, which may limit its practical application in rice apomixis. Therefore, this invention is based on... OsLEC2 The apomixis system exhibited significant advantages. Furthermore, because... OsLEC2As an endogenous gene in rice, it is more suitable for the application and promotion of rice apomixis technology.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention belongs to the field of plant breeding and biotechnology, specifically involving LEC2 Methods for inducing apomixis using genes and their application in plant breeding. The inventors discovered in their research that genes in rice... LEC2 Genes can be used to construct apomixis lines, specifically by combining... MiMe The system uses a promoter specifically expressed in an egg cell to control the gene transformation in plants, obtaining apomixis from positive transgenic plants, thus producing cloned seeds. Therefore, this invention has significant application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant breeding and biotechnology, specifically relating to a method for inducing apomixis in plants. LEC2 Application of genes in induced apomixis. Background Technology

[0002] Rice (scientific name: *Oryza sativa* L.) is a plant belonging to the genus *Oryza* in the family Poaceae, and is one of the world's most important food crops. Scientists have been researching and improving rice varieties to increase yield, improve quality, and enhance resistance to diseases and pests. For example, hybrid rice and genetically modified rice are applications of modern technology in agriculture. Currently, hybrid varieties cover about 50% of the rice planting area in my country, making a significant contribution to my country's food security. However, because heterosis is difficult to pass on to offspring, and due to genetic recombination and segregation, a large amount of manpower and resources must be invested annually in hybrid seed production. This cumbersome process not only increases risks and costs but also limits the further promotion and application of hybrid varieties. Therefore, achieving self-sufficiency in hybrid seeds is considered the ultimate goal of hybrid breeding. Apomixis is an asexual reproduction method that uses seeds for cloning, producing offspring with a genotype completely identical to the maternal parent. Introducing apomixis into hybrid varieties can maintain a stable heterozygous genotype in the hybrid offspring, preventing phenotypic segregation and thus stabilizing the inheritance of heterosis. This will greatly simplify the breeding process, reduce risks and costs, and expand the utilization of heterosis. In recent decades, with the elucidation of the molecular mechanisms of reproductive development and the development of gene editing technology, significant breakthroughs have been achieved in the artificial creation of apomixis. Multiple research teams have successfully created clonal seeds in model plants such as Arabidopsis and rice using the MiMe strategy (producing clonal gametes with genotypes completely identical to the maternal parent) and haploid induction strategies. Raphaël Mercier's team pioneered the hybridization of MiMe (Atspo11-1-Atrec8-Atosd1) with the cenh3 chromosome-eliminating line in Arabidopsis, obtaining approximately 40% clonal seeds (MarimuthuMP, Jolivet S, Ravi M, Pereira L, Davda JN, Cromer L, Wang L, Nogué F, ChanSW, Siddiqi I, Mercier R. Synthetic clonal reproduction through seeds. Science. 2011 Feb 18;331(6019):876. doi: 10.1126 / science.1199682.). It is noteworthy that although CENH3 function shows high conservation across multiple species, no CENH3-based apomixis systems have been reported outside of Arabidopsis thaliana. In 2019, Venkatesan Sundaresan's team combined MiMe (pair1-rec8-osd1) with the BBM1 expression element driven by the oocyte-specific promoter pDD45, and for the first time established an apomixis system in the conventional rice variety Kitaake, obtaining cloned seeds of Kitaake.Despite a low seed setting rate, the cloning efficiency reached a maximum of 29% (Khanday I, Skinner D, Yang B, Mercier R, Sundaresan V. Amale-expressed rice embryogenic trigger redirected for asexual propagation through seeds. Nature. 2019 Jan;565(7737):91-95. doi: 10.1038 / s41586-018-0785-8.). In the same year, Wang Kejian's team obtained a Fix line with simultaneous mutations of MiMe (pair1-rec8-osd1) and mtl genes in the indica-japonica hybrid rice CY84 using CRISPR / Cas9 technology. This was the first time that cloned seeds of hybrid rice were successfully produced, with a seed setting rate of 3.7% to 5.2%, and cloned seeds accounting for 4.7% to 9.5% of all fertile seeds (Wang C, Liu Q, Shen Y, Hua Y, Wang J, Lin J, Wu M, Sun T, Cheng Z, Mercier R, Wang K. Clonalseeds from hybrid rice by simultaneous genome engineering of meiosis and fertilization genes. Nat Biotechnol. 2019 Mar;37(3):283-286. doi: 10.1038 / s41587-018-0003-0.). Unlike the CENH3 strategy, these two methods do not require a hybridization process. They can obtain cloned seeds with apomixis through self-pollination, opening up new research directions for the fixed utilization of heterosis in crops.In 2022, Emmanuel Guiderdoni and Raphael Mercier's team integrated BBM1 and MiMe into the same vector in the hybrid rice variety BRS-CIRAD 302, creating an apomixis system with a clone seed ratio of over 90%, although the seed setting rate of this system was only about 30% under greenhouse conditions (Vernet A, Meynard D, Lian Q, Mieulet D, Gibert O, Bissah M, Rivallan R, Autran D, Leblanc O, Meunier AC, Frouin J, Taillebois J, Shankle K, Khanday I, Mercier R, Sundaresan V, Guiderdoni E. High-frequency synthetic apomixis in hybrid rice. Nat Commun. 2022 Dec 27;13(1):7963. doi: 10.1038 / s41467-022-35679-3.). In 2023, Wang Kejian's team further explored the application potential of BBM4, a homolog of BBM1, in apomixis. They successfully obtained Fix2 lines capable of apomixis in the indica-japonica hybrid rice CY84. These cloned plants are very similar in appearance to wild-type hybrid rice and maintain a high seed setting rate of 80.9% to 82.0%, although the proportion of cloned seeds in this study was only 2.3% at most (WeiX, Liu C, Chen X, Lu H, Wang J, Yang S, Wang K. Synthetic apomixis with normal hybrid rice seed production. Mol Plant. 2023 Mar 6;16(3):489-492. doi:10.1016 / j.molp.2023.01.005.).Recent research indicates that by combining dandelion PAR gene-induced parthenogenesis with the MiMe (pair1-rec8-osd1) strategy, apomixis can be achieved in hybrid rice, maintaining normal seed setting rate while achieving a cloning seed efficiency of up to 67.7% (Song M, Wang W, Ji C, Li S, Liu W, Hu X, Feng A, Ruan S, Du S, Wang H, Dai K, Guo L, Qian Q, Si H, Hu X. Simultaneous production of high-frequency synthetic apomixis with high fertility and improved agronomic traits in hybrid rice. Mol Plant. 2024 Jan 1;17(1):4-7.doi: 10.1016 / j.molp.2023.11.007.). These findings not only provide new research pathways for the fixation of heterosis in crops but also have profound scientific significance and application value for ensuring global food security.

[0003] Significant progress has been made in apomixis technology for rice, but key challenges remain. On the one hand, while apomixis can maintain a normal seed setting rate, the efficiency of cloning seed production is quite low. On the other hand, when the cloning efficiency approaches 100%, the seed setting rate of apomixis plants decreases significantly. This indicates that a system capable of guaranteeing 100% cloning efficiency while maintaining a normal seed setting rate for cloning plants has not yet been developed, limiting the practical application of apomixis technology in hybrid rice. Therefore, there is an urgent need to explore and identify more genes related to apomixis in order to further optimize and improve existing technologies. Summary of the Invention

[0004] The purpose of this invention is to prepare apomixis plant lines. Through research, it was found that the LEC2 gene in plants such as rice can be used to construct apomixis plant lines, thus completing this invention.

[0005] This invention first provides a binary expression vector for inducing apomixis plant lines, which is driven by a promoter specifically expressed on an egg cell and linked to the LEC2 gene; the plant is a monocotyledonous plant or a dicotyledonous plant; preferably, the plant is a grass, legume, or cruciferous plant; preferably, the plant is rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed.

[0006] The LEC2 gene is a full-length genome sequence gene or a full-length coding region sequence gene; Preferably, the LEC2 gene has a nucleotide sequence similar to that of the LEC2 gene in rice, or is a homologous gene derived from other species (rice, maize, millet, wheat, barley, sorghum, soybean, rapeseed). More specifically, the LEC2 gene is a homologous gene with 90% or more, 95% or more, 98% or more, or 99% or more identity with the OsLEC2 gene in rice, the SiLEC2 gene in millet, or the ZmLEC2 gene in maize; more preferably, it is a homologous gene derived from the same species.

[0007] Preferably, it also carries elements capable of generating MiMe. More preferably, MiMe includes simultaneous mutations of PAIR1, REC8, and OSD1. The elements generating MiMe include: a DNA sequence encoding PARI1 sgRNA driven by the U3 promoter, a DNA sequence encoding REC8 sgRNA driven by the U3 promoter, and a DNA sequence encoding OSD1 sgRNA driven by the U3 promoter.

[0008] Specifically, the starting vector is pCAMBIA 1300; other vectors besides pCAMBIA1300 include the pCAMBIA series, pGreen series, pBIN series, pBI series, and pHELLSGATE series; the promoter is an oocyte-specific promoter; preferably, it is selected from OsECA (At2g21740), AtEC1.1 (At1g76750), AtEC1.3 (At2g21750), AtEC1.4 (At4g39340), AtEC1.5 (At5g64720), OsECA1 (LOC_Os03g18530), OsECA2 (LOC_Os11g06730), and OsECA3 (LOC_Os12g06970).

[0009] Preferably, the rice OsLEC2 gene is a full-length OsLEC2 genome sequence or a full-length OsLEC2 coding region sequence.

[0010] This invention provides the application of the LEC2 gene or the binary expression vector described above in the preparation of apomixis plant lines; Preferably, the plant is a monocotyledonous plant or a dicotyledonous plant; preferably, the plant is a grass, legume, or cruciferous plant; preferably, the plant is rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed; the LEC2 gene is derived from grass, legume, or cruciferous plants; preferably, the plant is rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed. More specifically, the plant is rice, and the LEC2 gene is located at LOC_Os04g58000 in the rice genome.

[0011] The present invention also provides a method for inducing apomixis in plants, comprising the following steps: transferring a binary expression vector containing an element capable of producing MiMe and an LEC2 ectopic expression element driven by an egg cell-specific promoter into a corresponding plant; screening for MiMe homozygous mutants and LEC2 ectopic expression lines in transgenic plants to obtain apomixis lines.

[0012] Specifically, the plant is a monocotyledonous or dicotyledonous plant; preferably, the plant is a grass, legume, or cruciferous plant; preferably, the plant is rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed.

[0013] Preferably, the LEC2 gene is derived from plants of the Poaceae, Leguminosae, and Brassicaceae families; more preferably, the LEC2 gene is derived from rice, corn, millet, wheat, barley, sorghum, soybean, and rapeseed. The LEC2 gene is either a full-length genomic sequence gene or a full-length coding region sequence gene.

[0014] More specifically, it is achieved using the Agrobacterium-mediated method.

[0015] More preferably, the method further includes the step of screening apomixis plants with normal seed setting rate and high seed cloning efficiency.

[0016] For example, rice is diploid. The introduction of the MiMe element can produce tetraploid offspring, while the LEC2 expression element can induce haploid offspring. The combination of the MiMe and LEC2 expression elements can reduce the tetraploid to diploid, thus producing cloned seeds. Therefore, the MiMe and LEC2 expression elements on a single vector can induce apomixis lines.

[0017] In rice-related research, there have been reports showing that BBM1 and BBM4 It can induce apomixis, and the LEC2 gene discovered in this invention has been verified to also be applied to apomixis to produce clonal seeds, thus possessing high application value. Although based on ToPAR The apomixis achieved normal seed setting rate and a clonal seed efficiency of up to 67.7%, but due to... ToPAR The gene originates from dandelion, rather than being an endogenous gene of rice, which may limit its practical application in rice apomixis. Therefore, this invention is based on... OsLEC2 The apomixis system exhibited significant advantages. Furthermore, because... OsLEC2As an endogenous gene in rice, it is more suitable for the application and promotion of rice apomixis technology. Attached Figure Description

[0018] Figure 1 Combination MiMe and OsLEC2 A schematic diagram of a binary vector for ectopic expression.

[0019] Figure 2 , PAIR1 , REC8 , OSD1 Genotypes with homozygous mutations in three genes.

[0020] Figure 3 Phenotypic analysis of wild-type Chunyou 84 (CY84) and 4TG254 strains.

[0021] Figure 4 Phenotype of ZmLEC2 diploid plants.

[0022] Figure 5 Phenotypic characteristics of diploid plants of CY84 and SiLEC2 clones. Detailed Implementation

[0023] The present invention will be further described below through specific embodiments to better understand the present invention, but this does not constitute a limitation thereof.

[0024] Example 1: Creation of apomixis rice lines 1. In rice OsLEC2 Gene cloning and sequence analysis By comparing gene expression differences among different samples, genes with significantly different expression levels were screened. During the analysis, the OsLEC2 gene was found to have high expression levels in the pistil, suggesting it may play an important role in reproductive development. Based on the expression pattern and tissue specificity of the OsLEC2 gene, it is speculated that it may be involved in regulating apomixis.

[0025] Leaf DNA was extracted from Chunyou 84 using the CTAB method. Primers were designed to amplify the OsLEC2 gene genome sequence, which includes 9 exons and 8 introns, and was labeled as follows. gOsLEC2 .

[0026] The following is the sequence of gOsLEC2 as shown in SEQ ID NO: 1, which contains 8 intron sequences. The CDS sequence after excluding the introns is shown in SEQ ID NO: 2.

[0027] 2. sgMiMe Carrier construction The main steps are as follows (the specific operation can also refer to the method described in the paper Wang C, Shen L, Fu Y, Yan C, Wang KA Simple CRISPR / Cas9 System for Multiplex Genome Editing in Rice. J GenetGenomics. 2015 Dec 20;42(12):703-6. doi: 10.1016 / j.jgg.2015.09.011, with slight modifications): 1) sgMiMe Construction of intermediate carrier PAIR1 , REC8 , OSD1 The target sequences of the three genes are based on the target sites (underlined PAM sequences) reported in the paper (Wang C, Liu Q, Shen Y, Hua Y, Wang J, Lin J, Wu M, Sun T, Cheng Z, Mercier R, Wang K. Clonal seeds from hybrid rice by simultaneous genome engineering of meiosis and fertilization genes. Nat Biotechnol. 2019 Mar;37(3):283-286. doi: 10.1038 / s41587-018-0003-0.), specifically: Target site of PAIR1 (SEQ ID NO: 3): AAGCAACCCAGTGCACCGCTGG; REC8 target site (SEQ ID NO: 4): CGGAGAGCCTTAGTGCCATGGG; The target site of OSD1 (SEQ ID NO: 5): CTGCCGCCGACGAGCAACAGG.

[0028] Designed separately PAIR1 , REC8 , OSD1 Two complementary DNA sequences are used. Adding GGCA before the forward target sequence creates the forward primer for the target site, and adding AAAC before the reverse complementary target sequence creates the reverse primer for the target site.

[0029] There are two on the SK-gRNA intermediate vector Aar I restriction site, used AarAfter enzyme digestion (I), a vector with sticky ends is formed; the forward and reverse primers for the target site are mixed and denatured and annealed to form a fragment with sticky ends; the vector and fragment are ligated using T4 ligase to form... sgMiMe Intermediate vectors for a single target gene, labeled SK- gPAIR1 SK- gREC8 SK- gOSD1 .

[0030] 2) sgMiMe Carrier construction pCAMBIA1300 binary carrier CPN I and Bam HI was digested and recovered. CPN I- Bam HI linearized pCAMBIA1300 vector; SK- gPAIR1 SK- gREC8 SK- gOSD1 Use respectively CPN I+ Room I, Xho I+ Hey I, Xba I+ Bgl II was subjected to enzyme digestion and recovery to obtain SK- gPAIR1 / CPN I+ Room I, SK- gREC8 / Xho I+ Hey I, SK- gOSD1 / Xba I+ Bgl II. Exogenous fragment; using T4 ligase to ligate... CPN I- Bam HI linearized pCAMBIA1300 vector and SK- gPAIR1 / CPN I+ Room I, SK- gREC8 / Xho I+ Hey I, SK- gOSD1 / Xba I+ Bgl II. The exogenous fragments were connected to obtain sgMiMe Carrier.

[0031] 3. sgMiMe _ pOsECA: OsLEC2 Carrier construction The CDS sequences of the rice oocyte-specific expression promoters pOsECA and OsLEC2 were amplified using primer combinations of pOsECA-F+OsLEC2-pOsECA-R, OsECA-OsLEC2-F+NOS-OsLEC2-R, and OsLEC2-NOS-F+NOS-R, respectively. OsLEC2 NOS terminator sub-fragment. sgMiMe Carrier utilization Pm I was subjected to enzyme digestion, and the product was recovered. Pm I linearization sgMiMe Vector, using homologous recombination strategy to integrate pOsECA, OsLEC2 NOS termination sub-fragment and Pm I linearization sgMiMe The vectors are linked to complete the construction of the vector sgMiMe_pOsECA: OsLEC2. Figure 1 The specific primer information is as follows: pOsECA-F (SEQ ID NO: 6): ctgtcaaacactgatagtttTATACATGGGAGTCTAGTGCAATATTACTCATGTTTTG; ECA1-LEC2-F-516 (SEQ ID NO: 7): TCGGCCATGGTTTTTCTTTCTAGCTTT; pOsECA-LEC2-F (SEQ ID NO: 8):GAAAAACCATGGCCGACACGAGAG; Nos-LEC2-R (SEQ ID NO: 9): GAACGATCTCAGGTTTTCTTAGTCAG; LEC2-Nos-F (SEQ ID NO: 10): AAACCTGAGATCGTTCAAACATTT; Nos-R (SEQ ID NO: 11): tcccgccttcagtttGATCTAGTAACATAGA.

[0032] 4. Creation of apomixis lines in rice 1) Obtaining transgenic plants Transgenic materials were obtained by transforming the sequenced expression vector plasmid into the indica-japonica hybrid rice variety Chunyou 84 (CY84) using Agrobacterium tumefaciens strain EHA105-mediated genetic transformation. Specifically, the embryos of Chunyou 84 hybrid rice seeds were sterilized and inoculated into an induction medium. After one week of culture, vigorous, light-yellow, and relatively loose embryogenic callus tissue was selected as the recipient for transformation. The embryogenic callus was immersed in activated Agrobacterium tumefaciens EHA105 bacterial solution (containing acetylsuccinone) for 30 min and cultured in a dark incubator at 25°C for 3 days. Resistant callus tissue was then selected on a selection medium containing 50 mg / L hygromycin and transferred to a differentiation medium, cultured under light at 26°C. Transgenic plants that grew normally on the differentiation medium were selected and rooted for two weeks, resulting in 32 transgenic plants.

[0033] 2) Identification of genotypes of transgenic plants Genomic DNA was extracted from these 32 strains using the CTAB method. Primer combinations were designed to identify the transgenic positivity of the 32 transgenic lines, and 29 lines were found to contain [the desired DNA]. pOsECA: OsLEC2 Expression elements ( Figure 2 ).

[0034] Next, the editing status of the PAIR1, REC8, and OSD1 genes was examined, and primer combinations were designed for amplification. PAIR1 , REC8 , OSD1 DNA fragments from three gene target sites were used to perform genotyping on the amplified DNA fragments using Hi-TOM technology (Liu Q, Wang C, Jiao X, Zhang H, Song L, Li Y, Gao C, Wang K. Hi-TOM: a platform for high-throughput tracking of mutations induced by CRISPR / Cas systems. Sci ChinaLife Sci. 2019 Jan;62(1):1-7. doi: 10.1007 / s11427-018-9402-9).

[0035] Five strains (254 #1, 254 #5, 254 #11, 254 #15, and 254 #20) were identified that simultaneously possessed mutations in the PAIR1, REC8, and OSD1 genes. Figure 3 Based on the results of transgenic positive identification, it was further confirmed that all five strains contained the pOsECA:OsLEC2 expression element, thus confirming that they were based on transgenic... OsLEC2Apomixis lineage.

[0036] 3) Phenotypic identification of 254 apomixis lines During the vegetative growth stage, these five apomixis lines exhibited normal morphology. Unexpectedly, at maturity, all five apomixis lines showed a high seed setting rate of 69.3%–80.6%, comparable to the seed setting rate of the wild-type Chunyou 84 (81.3±2.4%). Figure 3 To verify whether these five apomixis plants with high seed setting rates could produce clonal seeds, flow cytometry was used to identify the ploidy level of their T1 generation. It was found that four lines, 254#1, 254#5, 254#11, and 254#15, produced 1.6%–2.0% diploid offspring, while the remaining line, 254#20, produced only tetraploids (Table 1).

[0037] Table 1 OsLEC2 Statistical analysis of seed setting rate and cloning efficiency of apomixis lines

[0038] Example 2: ZmLEC2 Creation of apomixis-induced lines 1. Cloning and sequencing of the maize LEC2 gene Homologous genes in maize were found based on homologous genes in rice. ZmLEC2 Gene (NCBI taxonomy ID:4577), and its relationship OsLEC2 The similarity was 36%. Primers were designed to amplify CY84 according to the method in Example 1, and the results were obtained. ZmLEC2 The genome sequence of a gene, labeled as ZmLEC2 Its nucleotide sequence is shown in SEQ ID NO: 12.

[0039] 2. ZmLEC2 Construction of ectopic expression vectors The genomic sequences of the rice oocyte-specific expression promoters pOsECA and ZmLEC2 were amplified using different primer combinations. gZmLEC2 and NOS. pCAMBIA1300 vector utilization CPN I + Bam HI was double-digested and the product was recovered. CPN I- Bam HI linearized vectors, using homologous recombination strategy to incorporate pOsECA, gZmLEC2 Fragments and CPN I- Bam HI linearized carriers are connected to complete ZmLEC2 Construction of the ectopic expression vector (pOsECA: gZmLEC2).

[0040] 3. Creation of ZmLEC2 apomixis-induced lines Referring to the method in Example 1, ZmLEC2 The ectotopic expression vector (sgMiMe_pOsECA: gZmLEC2) was transformed into rice CY84. A total of 4 plants were obtained. ZmLEC2 Ectopic expression plants. To verify... ZmLEC2 Whether ectopic expression plants can produce clonal diploids was determined by flow cytometry of their T1 generation, and the results showed... ZmLEC2 Ectopic expression lines produced 0.2%–1.3% clonal diploids. ZmLEC2 The phenotype of diploid plants is as follows: Figure 4 As shown.

[0041] Example 3: SiLEC2 Creation of apomixis-induced lines 1. Cloning and sequencing of the LEC2 gene in millet The SiLEC2 gene (NCBI taxonomy ID: 4555), a homologous gene in millet identified based on rice homologous genes, shares 39% similarity with LEC2. Primers were designed to amplify CY84 according to the method described in Example 1, resulting in... SiLEC2 The genome sequence of a gene, labeled as gSiLEC2 Its nucleotide sequence is shown in SEQ ID NO: 13.

[0042] 2. SiLEC2 Construction of ectopic expression vectors The genomic sequences of the rice oocyte-specific expression promoters pOsECA and SiLEC2 were amplified using different primer combinations. gSiLEC2 and NOS. pCAMBIA1300 vector utilization CPN I + Bam HI was double-digested and the product was recovered. CPN I- Bam HI-linearized vectors, using homologous recombination strategy, express the rice oocyte-specific promoter pOsECA, gSiLEC2 Fragments and CPN I- Bam HI linearized carriers are connected to complete SiLEC2 Construction of the ectopic expression vector (sgMiMe_pOsECA: gSiLEC2).

[0043] 3. Creation of SiLEC2 apomixis-induced lines Referring to the method in Example 1, SiLEC2The ectopic expression vector (sgMiMe_pOsECA: gSiLEC2) was transformed into rice CY84. A total of 8 plants were obtained. SiLEC2 Ectopic expression plants. To verify... SiLEC2 Whether ectopic expression plants can produce clonal diploids was determined by flow cytometry of their T1 generation, and the results showed... SiLEC2 Ectopic expression lines produced 0.4%–0.7% haploids, CY84 and SiLEC2 The phenotype of clonal diploid plants is as follows: Figure 5 As shown.

Claims

1. A binary expression vector for inducing apomixis plant lines, characterized in that, The LEC2 gene is driven by a promoter specifically expressed by an egg cell; the plant is a monocotyledonous plant or a dicotyledonous plant; preferably, the plant is a grass, legume, or cruciferous plant; preferably, the plant is rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed. The LEC2 gene is a full-length genome sequence gene or a full-length coding region sequence gene; Preferably, the LEC2 gene has a nucleotide sequence like the OsLEC2 gene in rice, or is a homologous gene derived from other species (e.g., rice, maize, millet, wheat, barley, sorghum, soybean, rapeseed); more specifically, the LEC2 gene is a homologous gene with 50% or more, 90% or more, 95% or more, 98% or more, or 99% or more identity with the OsLEC2 gene in rice, the SiLEC2 gene in millet, or the ZmLEC2 gene in maize, and more preferably, is a homologous gene derived from the same species.

2. The binary expression vector as described in claim 1, characterized in that, It also carries elements that can generate MiMe. Preferably, the MiMe includes simultaneous mutations of PAIR1, REC8 and OSD1. The elements that generate MiMe include: a DNA sequence encoding PARI1 sgRNA driven by the U3 promoter, a DNA sequence encoding REC8 sgRNA driven by the U3 promoter, and a DNA sequence encoding OSD1 sgRNA driven by the U3 promoter.

3. The binary expression vector as described in claim 2, characterized in that, The starting vector is pCAMBIA 1300; other vectors besides pCAMBIA1300 include the pCAMBIA series, pGreen series, pBIN series, pBI series, and pHELLSGATE series; the promoter is an oocyte-specific promoter, preferably selected from OsECA (At2g21740), AtEC1.1 (At1g76750), AtEC1.3 (At2g21750), AtEC1.4 (At4g39340), AtEC1.5 (At5g64720), OsECA1 (LOC_Os03g18530), OsECA2 (LOC_Os11g06730), and OsECA3 (LOC_Os12g06970).

4. The binary expression vector as described in claim 3, characterized in that, The rice OsLEC2 gene is either the full-length OsLEC2 genome sequence or the full-length OsLEC2 coding region sequence.

5. The application of a LEC2 gene or a binary expression vector as described in any one of claims 1 to 4 in the preparation of apomixis plant lines; Preferably, the plant is a monocotyledonous plant or a dicotyledonous plant; preferably, the plant is a grass, legume, or cruciferous plant; preferably, the plant is rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed; the LEC2 gene is derived from grass, legume, or cruciferous plants; preferably, the plant is rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed. More specifically, the plant is rice, and the LEC2 gene is located at LOC_Os04g58000 in the rice genome.

6. A method for inducing apomixis in plants, characterized in that, The process includes the following steps: a binary expression vector containing elements capable of producing MiMe and an ectopic expression element of LEC2 driven by an egg cell-specific promoter is transferred into the corresponding plant. Lines with homozygous MiMe mutations and ectopic expression of LEC2 are screened in the transgenic plants to obtain apomixis lines.

7. The method as described in claim 6, characterized in that, The plant is a monocotyledonous or dicotyledonous plant; preferably, the plant is a grass, legume, or cruciferous plant; preferably, the plant is rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed.

8. The method as described in claim 7, characterized in that, The LEC2 gene is derived from plants of the Poaceae, Leguminosae, and Brassicaceae families; preferably, the LEC2 gene is derived from rice, corn, millet, wheat, barley, sorghum, soybean, and rapeseed. The LEC2 gene is either a full-length genomic sequence gene or a full-length coding region sequence gene.

9. The method as described in claim 7, characterized in that, It was achieved using the Agrobacterium-mediated method.

10. The method according to any one of claims 6 to 9, characterized in that, It also includes the step of screening out apomixis plants with normal seed setting rate and high seed cloning efficiency.