Method for inducing apomixis using a serk gene and its use in plant breeding

Abstract

This invention belongs to the field of plant breeding and biotechnology, specifically involving SERK Methods for inducing apomixis using genes and their application in plant breeding. The inventors discovered in their research that genes in rice... SERK Genes can be used to construct apomixis lines, specifically by combining... MiMe The system uses a promoter specifically expressed in an egg cell to control the gene transformation in plants, obtaining apomixis from positive transgenic plants, thus producing cloned seeds. Therefore, this invention has significant application value.

Description

Technical Field

[0001] This invention belongs to the field of plant breeding and biotechnology, specifically relating to a method for inducing apomixis in plants. SERC Application of genes in induced apomixis. Background Technology

[0002] Rice (scientific name: *Oryza sativa* L.) is a plant belonging to the genus *Oryza* in the family Poaceae, and is one of the world's most important food crops. Scientists have been researching and improving rice varieties to increase yield, improve quality, and enhance resistance to diseases and pests. For example, hybrid rice and genetically modified rice are applications of modern technology in agriculture. Currently, hybrid varieties cover about 50% of the rice planting area in my country, making a significant contribution to my country's food security. However, because heterosis is difficult to pass on to offspring, and due to genetic recombination and segregation, a large amount of manpower and resources must be invested annually in hybrid seed production. This cumbersome process not only increases risks and costs but also limits the further promotion and application of hybrid varieties. Therefore, achieving self-sufficiency in hybrid seeds is considered the ultimate goal of hybrid breeding. Apomixis is an asexual reproduction method that uses seeds for cloning, producing offspring with a genotype completely identical to the maternal parent. Introducing apomixis into hybrid varieties can maintain a stable heterozygous genotype in the hybrid offspring, preventing phenotypic segregation and thus stabilizing the inheritance of heterosis. This will greatly simplify the breeding process, reduce risks and costs, and expand the utilization of heterosis. In recent decades, with the elucidation of the molecular mechanisms of reproductive development and the development of gene editing technology, significant breakthroughs have been achieved in the artificial creation of apomixis. Multiple research teams have successfully created clonal seeds in model plants such as Arabidopsis and rice using the MiMe strategy (producing clonal gametes with genotypes completely identical to the maternal parent) and haploid induction strategies. Raphaël Mercier's team pioneered the hybridization of MiMe (Atspo11-1-Atrec8-Atosd1) with the cenh3 chromosome-eliminating line in Arabidopsis, obtaining approximately 40% clonal seeds (MarimuthuMP, Jolivet S, Ravi M, Pereira L, Davda JN, Cromer L, Wang L, Nogué F, ChanSW, Siddiqi I, Mercier R. Synthetic clonal reproduction through seeds. Science. 2011 Feb 18;331(6019):876. doi: 10.1126 / science.1199682.). It is noteworthy that although CENH3 function shows high conservation across multiple species, no CENH3-based apomixis systems have been reported outside of Arabidopsis thaliana. In 2019, Venkatesan Sundaresan's team combined MiMe (pair1-rec8-osd1) with the BBM1 expression element driven by the oocyte-specific promoter pDD45, and for the first time established an apomixis system in the conventional rice variety Kitaake, obtaining cloned seeds of Kitaake.Despite a low seed setting rate, the cloning efficiency reached a maximum of 29% (Khanday I, Skinner D, Yang B, Mercier R, Sundaresan V. Amale-expressed rice embryogenic trigger redirected for asexual propagation through seeds. Nature. 2019 Jan;565(7737):91-95. doi: 10.1038 / s41586-018-0785-8.). In the same year, Wang Kejian's team obtained a Fix line with simultaneous mutations of MiMe (pair1-rec8-osd1) and mtl genes in the indica-japonica hybrid rice CY84 using CRISPR / Cas9 technology. This was the first time that cloned seeds of hybrid rice were successfully produced, with a seed setting rate of 3.7% to 5.2%, and cloned seeds accounting for 4.7% to 9.5% of all fertile seeds (Wang C, Liu Q, Shen Y, Hua Y, Wang J, Lin J, Wu M, Sun T, Cheng Z, Mercier R, Wang K. Clonalseeds from hybrid rice by simultaneous genome engineering of meiosis and fertilization genes. Nat Biotechnol. 2019 Mar;37(3):283-286. doi: 10.1038 / s41587-018-0003-0.). Unlike the CENH3 strategy, these two methods do not require a hybridization process. They can obtain cloned seeds with apomixis through self-pollination, opening up new research directions for the fixed utilization of heterosis in crops.In 2022, Emmanuel Guiderdoni and Raphael Mercier's team integrated BBM1 and MiMe into the same vector in the hybrid rice variety BRS-CIRAD 302, creating an apomixis system with a clone seed ratio of over 90%, although the seed setting rate of this system was only about 30% under greenhouse conditions (Vernet A, Meynard D, Lian Q, Mieulet D, Gibert O, Bissah M, Rivallan R, Autran D, Leblanc O, Meunier AC, Frouin J, Taillebois J, Shankle K, Khanday I, Mercier R, Sundaresan V, Guiderdoni E. High-frequency synthetic apomixis in hybrid rice. Nat Commun. 2022 Dec 27;13(1):7963. doi: 10.1038 / s41467-022-35679-3.). In 2023, Wang Kejian's team further explored the application potential of BBM4, a homolog of BBM1, in apomixis. They successfully obtained Fix2 lines capable of apomixis in the indica-japonica hybrid rice CY84. These cloned plants are very similar in appearance to wild-type hybrid rice and maintain a high seed setting rate of 80.9% to 82.0%, although the proportion of cloned seeds in this study was only 2.3% at most (WeiX, Liu C, Chen X, Lu H, Wang J, Yang S, Wang K. Synthetic apomixis with normal hybrid rice seed production. Mol Plant. 2023 Mar 6;16(3):489-492. doi:10.1016 / j.molp.2023.01.005.).Recent research indicates that by combining dandelion PAR gene-induced parthenogenesis with the MiMe (pair1-rec8-osd1) strategy, apomixis can be achieved in hybrid rice, maintaining normal seed setting rate while achieving a cloning seed efficiency of up to 67.7% (Song M, Wang W, Ji C, Li S, Liu W, Hu X, Feng A, Ruan S, Du S, Wang H, Dai K, Guo L, Qian Q, Si H, Hu X. Simultaneous production of high-frequency synthetic apomixis with high fertility and improved agronomic traits in hybrid rice. Mol Plant. 2024 Jan 1;17(1):4-7.doi: 10.1016 / j.molp.2023.11.007.). These findings not only provide new research pathways for the fixation of heterosis in crops but also have profound scientific significance and application value for ensuring global food security.

[0003] Significant progress has been made in apomixis technology for rice, but key challenges remain. On the one hand, while apomixis can maintain a normal seed setting rate, the efficiency of cloning seed production is quite low. On the other hand, when the cloning efficiency approaches 100%, the seed setting rate of apomixis plants decreases significantly. This indicates that a system capable of guaranteeing 100% cloning efficiency while maintaining a normal seed setting rate for cloning plants has not yet been developed, limiting the practical application of apomixis technology in hybrid rice. Therefore, there is an urgent need to explore and identify more genes related to apomixis in order to further optimize and improve existing technologies. Summary of the Invention

[0004] The purpose of this invention is to prepare apomixis plant lines. Through research, it was discovered that the SERK gene in plants such as rice can be used to construct apomixis plant lines, thus completing this invention.

[0005] This invention first provides a binary expression vector for inducing apomixis plant lines, which is driven by a promoter specifically expressed on an egg cell and linked to a SERK gene; the plant is a monocotyledonous plant or a dicotyledonous plant; preferably, the plant is a grass, legume, or cruciferous plant; preferably, the plant is rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed.

[0006] The SERK gene is a full-length genome sequence gene or a full-length coding region sequence gene; Preferably, the SERK gene has a nucleotide sequence like the SERK gene in rice, or is a homologous gene derived from other species (rice, maize, millet, wheat, barley, sorghum, soybean, rapeseed). More specifically, the SERK gene is a homologous gene with 50% or more, 90% or more, 95% or more, 98% or more, or 99% or more identity with the OsSERK gene in rice, the SiSERK gene in millet, or the ZmSERK gene in maize; more preferably, it is a homologous gene derived from the same species.

[0007] Preferably, it also carries elements capable of generating MiMe. More preferably, MiMe includes simultaneous mutations of PAIR1, REC8, and OSD1. The elements generating MiMe include: a DNA sequence encoding PARI1 sgRNA driven by the U3 promoter, a DNA sequence encoding REC8 sgRNA driven by the U3 promoter, and a DNA sequence encoding OSD1 sgRNA driven by the U3 promoter.

[0008] Specifically, the starting vector is pCAMBIA 1300; other vectors besides pCAMBIA1300 include the pCAMBIA series, pGreen series, pBIN series, pBI series, and pHELLSGATE series; the promoter is an oocyte-specific promoter, preferably selected from OsECA (At2g21740), AtEC1.1 (At1g76750), AtEC1.3 (At2g21750), AtEC1.4 (At4g39340), AtEC1.5 (At5g64720), OsECA1 (LOC_Os03g18530), OsECA2 (LOC_Os11g06730), and OsECA3 (LOC_Os12g06970).

[0009] Preferably, the rice OsSERK gene is a full-length OsSERK genome sequence gene or a full-length OsSERK coding region sequence gene.

[0010] This invention provides the application of the SERK gene or the binary expression vector described above in the preparation of apomixis plant lines; Preferably, the plant is a monocotyledonous plant or a dicotyledonous plant; preferably, the plant is a grass, legume, or cruciferous plant; preferably, the plant is rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed; the SERK gene is derived from grass, legume, or cruciferous plants; preferably, the plant is rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed. More specifically, the plant is rice, and the SERK gene is located at LOC_Os04g38480 in the rice genome.

[0011] The present invention also provides a method for inducing apomixis in plants, comprising the following steps: transferring a binary expression vector containing an element capable of producing MiMe and an ectopic expression element of SERK driven by an egg cell-specific promoter into a corresponding plant; screening for MiMe homozygous mutants and SERK ectopic expression lines in transgenic plants to obtain apomixis lines.

[0012] Specifically, the plant is a monocotyledonous or dicotyledonous plant; preferably, the plant is a grass, legume, or cruciferous plant; preferably, the plant is rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed.

[0013] Preferably, the SERK gene is derived from plants of the Poaceae, Leguminosae, and Brassicaceae families; more preferably, the SERK gene is derived from rice, corn, millet, wheat, barley, sorghum, soybean, and rapeseed. The SERK gene is either a full-length genome sequence gene or a full-length coding region sequence gene.

[0014] More specifically, it is achieved using the Agrobacterium-mediated method.

[0015] More preferably, the method further includes the step of screening apomixis plants with normal seed setting rate and high seed cloning efficiency.

[0016] For example, rice is diploid. The introduction of a MiMe element can produce tetraploid offspring, while a SERK expression element can induce haploid offspring. The combination of MiMe and SERK elements can reduce the tetraploid population to diploid, thus producing cloned seeds. Therefore, MiMe and SERK expression elements on a single vector can induce apomixis lines.

[0017] In rice-related research, there have been reports showing that BBM1 and BBM4 It can induce apomixis, and the SERK gene discovered in this invention has been verified to also be applied to apomixis to produce clonal seeds, thus possessing high application value. Although based on Group The apomixis achieved normal seed setting rate and a clonal seed efficiency of up to 67.7%, but due to... Group The gene originates from dandelion, rather than being an endogenous gene of rice, which may limit its practical application in rice apomixis. Therefore, this invention is based on... OSSERK The apomixis system exhibited significant advantages. Furthermore, because... OSSERKAs an endogenous gene in rice, it is more suitable for the application and promotion of rice apomixis technology. Attached Figure Description

[0018] Figure 1 Combination MiMe and OSSERK A schematic diagram of a binary vector for ectopic expression.

[0019] Figure 2 , PAIR1 , REC8 , OSD1 Genotypes with homozygous mutations in three genes.

[0020] Figure 3 Phenotypic analysis of wild-type Chunyou 84 (CY84) and 4TG261, 4TG263 lines.

[0021] Figure 4 Phenotype of ZmSERK diploid plants.

[0022] Figure 5 Phenotypic characteristics of diploid plants cloned from CY84 and SiSERK. Detailed Implementation

[0023] The present invention will be further described below through specific embodiments to better understand the present invention, but this does not constitute a limitation thereof.

[0024] Example 1: Creation of apomixis rice lines 1. In rice OSSERK Gene cloning and sequence analysis By comparing gene expression differences among different samples, genes with significantly different expression levels were screened. During the analysis, the OsSERK gene was found to have high expression levels in the pistil, suggesting it may play an important role in reproductive development. Based on the expression pattern and tissue specificity of the OsSERK gene, it is speculated that it may be involved in regulating apomixis.

[0025] Leaf DNA was extracted from Chunyou 84 using the CTAB method, and amplified using primers to obtain the genomic sequence of the OsSERK gene, which includes its 11 exons and 10 introns, and is labeled as... OBSERVER .

[0026] The genomic nucleotide sequence of gOsSERK is shown in SEQ ID NO: 1, which contains 10 intron sequences. The CDS sequence excluding the introns is shown in SEQ ID NO: 2.

[0027] 2. sgMiMe Carrier construction The main steps are as follows (the specific operation can also refer to the method described in the paper Wang C, Shen L, Fu Y, Yan C, Wang KA Simple CRISPR / Cas9 System for Multiplex Genome Editing in Rice. J GenetGenomics. 2015 Dec 20;42(12):703-6. doi: 10.1016 / j.jgg.2015.09.011, with slight modifications): 1) sgMiMe Construction of intermediate carrier PAIR1 , REC8 , OSD1 The target sequences of the three genes are based on the target sites (underlined PAM sequences) reported in the paper (Wang C, Liu Q, Shen Y, Hua Y, Wang J, Lin J, Wu M, Sun T, Cheng Z, Mercier R, Wang K. Clonal seeds from hybrid rice by simultaneous genome engineering of meiosis and fertilization genes. Nat Biotechnol. 2019 Mar;37(3):283-286. doi: 10.1038 / s41587-018-0003-0.), specifically: Target site of PAIR1 (SEQ ID NO: 4): AAGCAACCCAGTGCACCGCTGG; REC8 target site (SEQ ID NO: 5): CGGAGAGCCTTAGTGCCATGGG; The target site of OSD1 (SEQ ID NO: 6): CTGCCGCCGACGAGCAACAGG.

[0028] Designed separately PAIR1 , REC8 , OSD1 Two complementary DNA sequences are used. Adding GGCA before the forward target sequence creates the forward primer for the target site, and adding AAAC before the reverse complementary target sequence creates the reverse primer for the target site.

[0029] There are two on the SK-gRNA intermediate vector Aar I restriction site, used AarAfter enzyme digestion (I), a vector with sticky ends is formed; the forward and reverse primers for the target site are mixed and denatured and annealed to form a fragment with sticky ends; the vector and fragment are ligated using T4 ligase to form... sgMiMe Intermediate vectors for a single target gene, labeled SK- gPAIR1 SK- gREC8 SK- gOSD1 .

[0030] 2) sgMiMe Carrier construction pCAMBIA1300 binary carrier Kpn I and Bam HI was digested and recovered. Kpn I- Bam HI linearized pCAMBIA1300 vector; SK- gPAIR1 SK- gREC8 SK- gOSD1 Use respectively Kpn I+ Raft I, Xho I+ No I, Xba I+ Bgl II was subjected to enzyme digestion and recovery to obtain SK- gPAIR1 / Kpn I+ Raft I, SK- gREC8 / Xho I+ No I, SK- gOSD1 / Xba I+ Bgl II. Exogenous fragment; using T4 ligase to ligate... Kpn I- Bam HI linearized pCAMBIA1300 vector and SK- gPAIR1 / Kpn I+ Raft I, SK- gREC8 / Xho I+ No I, SK- gOSD1 / Xba I+ Bgl II. The exogenous fragments were connected to obtain sgMiMe Carrier.

[0031] 3. sgMiMe _ pOsECA: OsSERK Carrier construction Primers were designed to amplify the CDS sequences of the rice oocyte-specific expression promoters pOsECA and OsSERK. OSSERK NOS terminator sub-fragment. sgMiMe Carrier utilization PmI was subjected to enzyme digestion, and the product was recovered. Pm I linearization sgMiMe Vector, using homologous recombination strategy to integrate pOsECA, OSSERK NOS termination sub-fragment and Pm I linearization sgMiMe The carriers are linked to complete the construction of the carrier sgMiMe_pOsECA: OsSERK. Figure 1 ).

[0032] 4. Creation of apomixis lines in rice 1) Obtaining transgenic plants Transgenic materials were obtained by transforming the correctly sequenced expression vector plasmid into the indica-japonica hybrid rice variety Chunyou 84 (CY84) using Agrobacterium tumefaciens strain EHA105-mediated genetic transformation. Specifically, the embryos of Chunyou 84 hybrid rice seeds were sterilized and inoculated into an induction medium. After one week of culture, vigorous, light-yellow, and relatively loose embryogenic callus tissue was selected as the recipient for transformation. The embryogenic callus was immersed in activated Agrobacterium tumefaciens EHA105 bacterial solution (containing acetylsyleugenol) containing the target plasmid for 30 min, and cultured in a dark incubator at 25°C for 3 days. Resistant callus tissue was then selected on a selection medium containing 50 mg / L hygromycin and transferred to a differentiation medium, cultured under light at 26°C. Transgenic plants that grew normally on the differentiation medium were selected and rooted for 2 weeks, resulting in 22 transgenic plants.

[0033] 2) Identification of the genotype of T221 transgenic plants Genomic DNA was extracted from these 22 strains using the CTAB method. Primer pairs were used to identify the transgenic positivity of the 22 transgenic lines, revealing that 27 lines contained [the necessary DNA]. pOsECA: OsSERK Expression elements ( Figure 2 ).

[0034] Next, the editing status of the PAIR1, REC8, and OSD1 genes was detected, and amplification was performed using primer combinations. PAIR1 , REC8 , OSD1DNA fragments from three gene target sites were used to perform genotyping on the amplified DNA fragments using Hi-TOM technology (Liu Q, Wang C, Jiao X, Zhang H, Song L, Li Y, Gao C, Wang K. Hi-TOM: a platform for high-throughput tracking of mutations induced by CRISPR / Cas systems. Sci ChinaLife Sci. 2019 Jan;62(1):1-7. doi: 10.1007 / s11427-018-9402-9).

[0035] Four strains (4TG261 #1, 4TG261 #3, 4TG261 #10, and 4TG261 #22) were identified as having mutations in the PAIR1, REC8, and OSD1 genes. Figure 3 Based on the results of transgenic positive identification, it was further confirmed that all four strains contained the pOsECA:OsSERK expression element, thus confirming that they were based on... OSSERK Apomixis lineage.

[0036] 3) Phenotypic identification of apomixis lines During the vegetative growth stage, these four apomixis lines exhibited normal morphology. Unexpectedly, at maturity, all five apomixis lines showed a high seed setting rate of 69.3%–81.6%, comparable to the seed setting rate of the wild-type Chunyou 84 (81.3±2.4%). Figure 3 To verify whether these four apomixis with high seed setting rates could produce clonal seeds, flow cytometry was used to identify the ploidy level of their T1 generation. It was found that all four lines produced 1.1%–2.6% diploid offspring (Table 1).

[0037] Table 1 OSSERK Statistical analysis of seed setting rate and cloning efficiency of apomixis lines

[0038] Example 2: ZmSERK Creation of apomixis-induced lines 1. Cloning and sequencing of the maize SERK gene Homologous genes in maize were found based on homologous genes in rice. ZmSERK Gene (NCBI taxonomy ID:4577), and its relationship OSSERKThe similarity was 90%. Following the method in Example 1, CY84 was amplified using primers to obtain... ZmSERK The genome sequence of a gene, labeled as gZmSERK Its nucleotide sequence is shown in SEQ ID NO: 6.

[0039] 2. ZmSERK Construction of ectopic expression vectors The genomic sequences of the rice oocyte-specific expression promoters pOsECA and ZmSERK were amplified using different primer combinations. gZmSERK and NOS. pCAMBIA1300 vector utilization Kpn I + Bam HI was double-digested and the product was recovered. Kpn I- Bam HI linearized vectors, using homologous recombination strategy to incorporate pOsECA, gZmSERK Fragments and Kpn I- Bam HI linearized carriers are connected to complete ZmSERK Construction of the ectopic expression vector (pOsECA: gZmSERK).

[0040] 3. Creation of ZmSERK apomixis-induced lines Referring to the method in Example 1, ZmSERK The ectopic expression vector (sgMiMe_pOsECA: gZmSERK) was transformed into rice CY84. A total of 4 plants were obtained. ZmSERK Ectopic expression plants. To verify... ZmSERK Whether ectopic expression plants can produce clonal diploids was determined by flow cytometry of their T1 generation, and the results showed... ZmSERK Ectopic expression lines produced 0.3%–1.4% clonal diploids. ZmSERK The phenotype of diploid plants is as follows: Figure 4 As shown.

[0041] Example 3: SiSERK Creation of apomixis-induced lines 1. Cloning and sequencing of the millet SERK gene The SiSERK gene (NCBI taxonomy ID: 4555), a homologous gene in millet identified based on rice homologous genes, shares 92% similarity with SERK. Following the method described in Example 1, CY84 was amplified using primers to obtain... SiSERK The genome sequence of a gene, labeled as gSiSERK Its nucleotide sequence is shown in SEQ ID NO: 7.

[0042] 2. SiSERKConstruction of ectopic expression vectors The genomic sequences of the rice oocyte-specific expression promoters pOsECA and SiSERK were amplified using different primer combinations. gSiSERK and NOS. pCAMBIA1300 vector utilization Kpn I + Bam HI was double-digested and the product was recovered. Kpn I- Bam HI-linearized vectors, using homologous recombination strategy, express the rice oocyte-specific promoter pOsECA, gSiSERK Fragments and Kpn I- Bam HI linearized carriers are connected to complete SiSERK Construction of the ectopic expression vector (sgMiMe_pOsECA: gSiSERK).

[0043] 3. Creation of SiSERK apomixis-induced lines Referring to the method in Example 1, SiSERK The ectopic expression vector (sgMiMe_pOsECA: gSiSERK) was transformed into rice CY84. A total of 6 plants were obtained. SiSERK Ectopic expression plants. To verify... SiSERK Whether ectopic expression plants can produce clonal diploids was determined by flow cytometry of their T1 generation, and the results showed... SiSERK Ectopic expression lines produced 0.2%–0.9% haploids, CY84 and SiSERK The phenotype of clonal diploid plants is as follows: Figure 5 As shown.

Claims

1. A binary expression vector for inducing apomixis plant lines, characterized in that, The SERK gene is driven by a promoter specifically expressed in an egg cell; the plant is a monocotyledonous plant or a dicotyledonous plant; preferably, the plant is a grass, legume, or cruciferous plant; preferably, the plant is rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed. The SERK gene is a full-length genome sequence gene or a full-length coding region sequence gene; Preferably, the SERK gene has a nucleotide sequence like the OsSERK gene in rice, or is a homologous gene derived from other species (e.g., rice, maize, millet, wheat, barley, sorghum, soybean, rapeseed); more specifically, the SERK gene is a homologous gene with 50% or more, 90% or more, 95% or more, 98% or more, or 99% or more identity with the OsSERK gene in rice, the SiSERK gene in millet, or the ZmSERK gene in maize, and more preferably, is a homologous gene derived from the same species.

2. The binary expression vector as described in claim 1, characterized in that, It also carries elements that can generate MiMe. Preferably, the MiMe includes simultaneous mutations of PAIR1, REC8 and OSD1. The elements that generate MiMe include: a DNA sequence encoding PARI1 sgRNA driven by the U3 promoter, a DNA sequence encoding REC8 sgRNA driven by the U3 promoter, and a DNA sequence encoding OSD1 sgRNA driven by the U3 promoter.

3. The binary expression vector as described in claim 2, characterized in that, The starting vector is pCAMBIA 1300; other vectors besides pCAMBIA1300 include the pCAMBIA series, pGreen series, pBIN series, pBI series, and pHELLSGATE series; the promoter is an oocyte-specific promoter, preferably selected from OsECA (At2g21740), AtEC1.1 (At1g76750), AtEC1.3 (At2g21750), AtEC1.4 (At4g39340), AtEC1.5 (At5g64720), OsECA1 (LOC_Os03g18530), OsECA2 (LOC_Os11g06730), and OsECA3 (LOC_Os12g06970).

4. The binary expression vector as described in claim 3, characterized in that, The rice OsSERK gene is either the full-length OsSERK genome sequence or the full-length OsSERK coding region sequence.

5. The use of a SERK gene or the binary expression vector as described in any one of claims 1 to 4 in the preparation of apomixis plant lines; Preferably, the plant is a monocotyledonous plant or a dicotyledonous plant; preferably, the plant is a grass, legume, or cruciferous plant; preferably, the plant is rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed; the SERK gene is derived from grass, legume, or cruciferous plants; preferably, the plant is rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed. More specifically, the plant is rice, and the SERK gene is located at LOC_Os04g38480 in the rice genome.

6. A method for inducing apomixis in plants, characterized in that, The process includes the following steps: a binary expression vector containing elements capable of producing MiMe and an oocyte-specific promoter-driven SERK ectopic expression element is transferred into the corresponding plant. Lines with homozygous MiMe mutations and ectopic SERK expression are screened from the transgenic plants to obtain apomixis lines.

7. The method as described in claim 6, characterized in that, The plant is a monocotyledonous or dicotyledonous plant; preferably, the plant is a grass, legume, or cruciferous plant; preferably, the plant is rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed.

8. The method as described in claim 7, characterized in that, The SERK gene is derived from plants of the Poaceae, Leguminosae, and Brassicaceae families; preferably, the SERK gene is derived from rice, corn, millet, wheat, barley, sorghum, soybean, and rapeseed. The SERK gene is either a full-length genome sequence gene or a full-length coding region sequence gene.

9. The method as described in claim 7, characterized in that, It was achieved using the Agrobacterium-mediated method.

10. The method according to any one of claims 6 to 9, characterized in that, It also includes the step of screening out apomixis plants with normal seed setting rate and high seed cloning efficiency.

Images