Application of ZmCPK gene to improve photosynthetic yield of maize and regulate seedling response to light stress

CN122790983APending Publication Date: 2026-09-22CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202611187901.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-08-06
Publication Date
2026-09-22

AI Technical Summary

Benefits of technology

本发明首次明确了玉米ZmCPK39基因在调控低光胁迫耐受性、籽粒发育与粒重建成中的正向调控作用,针对当前玉米低光胁迫分子靶点匮乏、弱光减产防控手段不足的技术问题,提供了可用于玉米耐逆高产改良的新型功能基因。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122790983A_ABST
    Figure CN122790983A_ABST
Patent Text Reader

Abstract

This invention discloses ZmCPK This invention relates to the application of genes in enhancing maize photosynthetic yield and regulating seedling response to light stress, and is the first to clearly define the use of genes in maize. ZmCPK39 This study explores the positive regulatory role of genes in controlling low light stress tolerance, grain development, and grain formation. Addressing the current technical challenges of a lack of molecular targets for low light stress in maize and insufficient control measures for yield reduction under weak light, this study provides novel functional genes that can be used to improve maize's stress tolerance and high yield. These genes are upregulated through genetic engineering. ZmCPK39 The expression level can simultaneously increase the level of expression in maize plants. ZmCPK39 The kinase activity of the drug can stably maintain net photosynthetic efficiency under low light stress without changing the growth phenotype of maize under normal light conditions, alleviate the inhibition of photosynthetic system and carbon assimilation process by weak light, ensure the basis for plant dry matter accumulation, and significantly improve maize's tolerance to various low light scenarios such as continuous cloudy and rainy weather, dense planting canopy shading, and shading in compound planting patterns.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to ZmCPK Applications of genes to enhance maize photosynthetic yield and regulate seedling response to light stress. Background Technology

[0002] Maize is a typical high-photometric C4 crop, with a light saturation point significantly higher than most grain crops. Its photosynthetic carbon assimilation, nutrient allocation, and grain formation are highly dependent on sufficient photosynthetically active radiation. Low light (weak light) stress caused by insufficient light supply has become one of the core abiotic stresses restricting stable and increased maize yields and threatening regional food security. Against the backdrop of global climate change, the "global darkening" effect is intensifying. In major summer maize producing areas in China, such as the Huang-Huai-Hai Plain and North my country, persistent cloudy and rainy weather with little sunshine frequently occurs every year from July to August during the critical period from jointing to grain filling. This significantly reduces the number of sunshine hours during the growing season, naturally creating large-scale low-light environments in the fields. Meanwhile, modern high-yield maize cultivation generally promotes dense planting to increase yield. The overlapping and interlacing of leaves in the canopy intensifies light competition among plants, causing a sharp decline in light transmittance in the middle and lower parts of the canopy and an imbalance in the red / far-red light ratio, inducing typical shade avoidance syndrome and further aggravating the continuous low light stress within the canopy. New composite planting models such as agro-photovoltaic integration and fruit-grain intercropping also have long suffered from weak light problems caused by canopy shading. Under multiple scenarios, the frequency and scope of low light stress in maize are expanding year by year.

[0003] Low light stress persists throughout the entire growth period of maize, with varying sensitivities at different stages: during the seedling stage, weak light inhibits root development, induces excessive internode elongation, and results in thinner and narrower leaves, reducing the basal photosynthetic area of ​​the population; from jointing to ear differentiation, insufficient light directly interferes with ear primordia development, reducing the potential number of grains per ear; the tasseling, silking, and grain-filling stages are the most sensitive periods for maize to low light, as continuous low light significantly damages chloroplast thylakoid structure, reduces photosynthetic system activity and the activity of key carbon assimilation enzymes, resulting in a significant decrease in net photosynthetic rate, a sharp reduction in total plant dry matter accumulation, and obstruction of photosynthetic product translocation to the ear, leading to asynchronous development of male and female ears, reduced pollen viability, delayed silk elongation, missed flowering, and a decrease in fertilization and seed setting rate; during the grain-filling stage, weak light inhibits endosperm cell proliferation and starch synthesis, significantly reducing the thousand-grain weight, and under severe shading conditions, maize yield reduction can reach more than 50%, while simultaneously deteriorating grain quality and starch composition.

[0004] Currently, there is significant differentiation in the low-light tolerance of different maize genotypes in production, and existing cultivation regulation methods have limited effectiveness in mitigating stress losses. Current research largely focuses on phenotypic aspects such as maize morphology, photosynthetic physiology, and changes in endogenous hormones under low light conditions. However, the molecular pathways, key functional genes, and protein-protein interaction networks regulating photosynthetic transport, ear development, and nutrient allocation under low light stress remain incomplete, and the molecular response mechanisms of C4 maize to low-light environments still lack systematic analysis. Against this backdrop, in-depth analysis of the physiological and molecular regulatory mechanisms of maize's response to low light stress, and the identification of key genes and regulatory targets for low-light tolerance, can provide theoretical support for the creation of shade-tolerant maize germplasm, the breeding of high-density suitable varieties, and the development of green field light stress regulation technologies. This has significant theoretical and practical value for stabilizing maize population light energy utilization efficiency, reducing yield losses in years with low light, and ensuring stable maize production capacity in my country. Summary of the Invention

[0005] To address the aforementioned shortcomings of the prior art, the present invention provides corn ZmCPK39 Application of genes in improving maize photosynthetic yield and regulating seedling response to light stress.

[0006] To achieve the above-mentioned objectives, the technical solution adopted by this invention is as follows: supply ZmCPK The application of genes in regulating maize's resistance to light stress, the gene is ZmCPK39 Its nucleotide sequence is shown in SEQ ID NO.1. By genetic engineering, its expression level can be increased, thereby enhancing the ability of maize seedlings to resist light stress and thus increasing maize photosynthetic yield.

[0007] This invention also provides corn ZmCPK39 The application of proteins or their encoding genes, or biological materials containing their encoding genes, in regulating maize's resistance to light stress, and the specific methods for regulating maize photosynthetic yield and resistance to light stress are as follows: [The text abruptly shifts to a seemingly unrelated topic about maize processing.] ZmCPK39 Increased protein expression levels enhance photosynthetic yield and resistance to light stress in maize. ZmCPK39 The protein-coding gene is shown in SEQ ID NO.2; ZmCPK39 The amino acid sequence of the protein is shown in SEQ ID NO.3.

[0008] This invention also provides a method for improving maize photosynthetic yield and resistance to light stress, thereby increasing... ZmCPK39 Gene expression levels in maize, including but not limited to: (1) Using genetic engineering techniques to overexpress ZmCPK39 The gene vector was transferred into maize; or, (2) Selecting and modifying regulation through genetic engineering techniques ZmCPK39The promoter for gene expression is a strong promoter; or, (3) Increasing the coding in maize chromosomes through genetic engineering. ZmCPK39 The copy number of the gene; or, (4) Introducing enhancers through genetic engineering; ZmCPK39 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0009] Furthermore, it will contain ZmCPK39 The gene plasmid was transformed into maize and then self-pollinated for breeding.

[0010] The present invention also provides ZmCPK39 The application of the gene, or the protein it encodes, or biological material containing the gene, or the aforementioned methods for improving maize's resistance to light stress in the cultivation of maize tolerant to low light environments; ZmCPK39 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.3.

[0011] The present invention also provides ZmCPK39 Genes, or the proteins they encode, or biological materials containing such genes, or the aforementioned methods for improving maize's resistance to light stress in improving maize seedling growth. ZmCPK39 Applications in kinase activity; ZmCPK39 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.3.

[0012] The present invention also provides the application of the ZmPYL11 gene, or the protein encoded thereon, or biological material containing the gene, or the above-mentioned method for improving maize resistance to light stress in increasing maize grain weight; ZmCPK39 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.3.

[0013] The present invention also provides ZmCPK39 The application of genes, or the proteins they encode, or biological materials containing such genes, or the aforementioned methods for improving maize's resistance to light stress in the improvement of maize germplasm resources; ZmCPK39 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.3; Maize germplasm resource improvement refers to improvements in maize photosynthetic yield, resistance to light stress, and / or grain weight.

[0014] The beneficial effects of this invention are as follows: This invention is the first to clearly define corn ZmCPK39The gene plays a positive regulatory role in regulating tolerance to low light stress, grain development and grain formation. It provides a novel functional gene that can be used to improve maize stress tolerance and high yield, addressing the current technical problems of a lack of molecular targets for low light stress and insufficient means of controlling yield reduction due to weak light.

[0015] Upregulation through genetic engineering ZmCPK39 The expression level of [something] can simultaneously increase the [something] in corn plants. ZmCPK39 The kinase activity of the drug can stably maintain net photosynthetic efficiency under low light stress without changing the growth phenotype of maize under normal light conditions, alleviate the inhibition of photosynthetic system and carbon assimilation process by weak light, ensure the basis for plant dry matter accumulation, and significantly improve maize's tolerance to various low light scenarios such as continuous cloudy and rainy weather, dense planting canopy shading, and shading in compound planting patterns.

[0016] This invention is verified through positive and negative genetic functional testing. ZmCPK39 Loss of function significantly reduces the net photosynthetic rate of maize leaves, and the damage to photosynthetic capacity is further aggravated under low light stress, directly weakening maize's ability to adapt to low light environment. This proves that this gene is a key positive regulator for maintaining normal photosynthetic function and responding to low light stress in maize, and improves the molecular regulatory network of maize's response to low light stress.

[0017] Overexpression of this gene significantly increases grain width and length, expands grain sink capacity, and thus improves 100-grain weight and single-plant ear weight, without adversely affecting core agronomic traits such as ear length. This regulatory effect can improve grain weight and yield under normal cultivation conditions, and alleviate the problems of insufficient grain filling and sharp drop in grain weight caused by low light stress, achieving the dual value of increased yield in normal environments and stable yield under stress environments.

[0018] The present invention provides ZmCPK39 Genes can serve as core targets for maize germplasm resource improvement. Target traits can be improved through various methods such as overexpression vector transformation, promoter optimization, gene copy number increase, and enhancer introduction. This approach is applicable to multiple scenarios, including the breeding of shade-tolerant maize varieties in areas with high incidence of low light, the creation of high-yield maize germplasm through dense planting, and the cultivation of maize varieties specifically for agricultural-photovoltaic complementary and intercropping models. It provides a novel gene resource and technological pathway for reducing maize yield loss due to low light stress and ensuring stable regional maize production capacity. Attached Figure Description

[0019] Figure 1 This is a sequence comparison diagram of the missing sequence in Example 1; Figure 2 Macroscopic characterization of mutant plants under different light conditions in Example 2; Figure 3 This is a comparison diagram of the aboveground plant height of mutant plants under different light conditions in Example 2; Figure 4 This is a comparison chart of the net photosynthetic rates of mutant plants under different light conditions in Example 3; Figure 5 For wild-type strains after different low-light treatments in Example 4 ZmCPK39 Graph showing changes in transcription levels; Figure 6 In the low-light treatment overexpression line of Example 5 ZmCPK39 Graph showing changes in kinase activity; Figure 7 This is a macroscopic characterization of the overexpression lines in field planting in Example 6; Figure 8 The results are statistical findings of grain traits from field-grown overexpression lines in Example 6. Figure 9 This is a macroscopic characterization of the missing strains in field planting in Example 6; Figure 10 The results are statistical results of grain traits from field planting of the missing lines in Example 6. Detailed Implementation

[0020] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0021] Example 1: Preparation and Identification of Mutant Maize Plants Using conventional CRISPR-Cas9 technology, wild-type maize B73-329 (purchased from the Crop Functional Genomics and Molecular Breeding Research Center of China Agricultural University) was analyzed. ZmCPK39 Gene knockout; set up separately ZmCPK39-1 Compared to the wild type, ZmCPK39 A 2bp transversion and a 28bp deletion occurred in the gene sequence; ZmCPK39-2 Compared to the wild type, ZmCPK39 A 62bp deletion in the gene sequence; The specific sequence differences between the two gene deletion lines are as follows: Figure 1 As shown.

[0022] ZmCPK39 The following method was used to prepare maize plants with gene overexpression: Fresh leaves of wild-type maize B73-329 were collected, total RNA was extracted, and cDNA was obtained by reverse transcription.

[0023] Using the obtained cDNA as a template, the procedure is as shown in SEQ ID No. 4. ZmCPK39 OE F and as shown in SEQ ID No. 5 ZmCPK39 OE PCR amplification was performed using primers consisting of R, and the PCR amplification products were obtained.

[0024] ZmCPK39 OE F: 5' ATGGGCGCTTGCTTCTCCTC 3'; ZmCPK39 OE R: 5' TCACAGAGCCTGAGGGTTTGG 3'.

[0025] The pBCXUN vector was digested with the restriction endonuclease XcmI, and the vector backbone was recovered.

[0026] The obtained PCR amplification product was ligated to the obtained vector backbone, and the resulting recombinant plasmid with the correct sequence was denoted as pBCXUN. ZmCPK39 Based on the sequencing results of the recombinant plasmid, the recombinant plasmid pBCXUN was... ZmCPK39 The structure is described as follows: A DNA molecule, represented by nucleotides 56-1624 of SEQ ID No. 3, was inserted into the XcmI restriction site of the pBCXUN vector. pBCXUN ZmCPK39 It can express the protein shown in SEQ ID No. 2 of the sequence listing. ZmCPK39 The expression is by Ubiquitin 1. Promoter-driven. In practical applications, exogenous fragments can also be synthesized directly and then inserted into the XcmI restriction site of the pBCXUN vector to obtain recombinant plasmids.

[0027] Recombinant plasmid pBCXUN ZmCPK39 Agrobacterium EHA105 was introduced to obtain recombinant Agrobacterium.

[0028] The obtained recombinant Agrobacterium was used to genetically transform the immature embryos of maize inbred line B73 using Agrobacterium-mediated transformation to obtain T0 generation plants. The T0 generation plants were then identified by PCR.

[0029] PCR identification method: Genomic DNA was extracted from plant leaves and analyzed using a barium enzymatic assay. F and bar If a primer pair consisting of R is used for PCR amplification, and an amplification product of approximately 262 bp is obtained, the PCR test is positive, indicating that the plant is a transgenic plant. If no amplification product is obtained, the PCR test is negative, indicating that the plant is a non-transgenic plant.

[0030] bar F (as shown in SEQ ID No. 6): GAAGGCACGCAACGCCTACGA; bar R (as shown in SEQ ID No. 7): CCAGAAACCCACGTCATGCCA.

[0031] Three randomly selected transgenic plants were named as follows: ZmCPK39 OE#1 plant ZmCPK39 OE#2 plants, ZmCPK39 OE#3 plant.

[0032] Self-pollinate T0 generation plants, harvest seeds, and cultivate seeds into plants, which are the T1 generation plants; screen transgenic plants from the T1 generation plants, and identify them using PCR as in step 2, section 3; self-pollinate T1 generation transgenic plants, harvest seeds, and cultivate seeds into plants, which are the T2 generation plants; screen transgenic plants from the T2 generation plants. ZmCPK39 OE1 and ZmCPK39 If OE2 is not isolated by PCR, it indicates that the strain is homozygous.

[0033] Example 2: Macroscopic phenotypic identification of overexpression and deletion lines under different light conditions Wild-type maize B73-329 and overexpression lines were used. ZmCPK39 OE1 and ZmCPK39 OE2 and deletion strains ZmCPK39-1 and ZmCPK39-2 Select seeds of the same age, size, and plumpness, sterilize them with 75% ethanol aqueous solution for 15 minutes, and wash them 5 times with distilled water. Place the seeds evenly into sterilized glass petri dishes lined with filter paper, spray with distilled water in a measured amount, and incubate in an incubator until germination. After the seeds show white sprouts, select seeds with basically the same germination status and transfer them to soil pots that have been pre-watered.

[0034] Preparation of soil-grown pots: Crush and sift the potting soil, then fill equal portions into 17cm x 21cm round pots, compacting the soil to leave about 3cm space from the rim. Place these pots on trays containing water, each measuring 90cm x 60cm x 25cm. After each pot has fully absorbed the water, discard any remaining solution.

[0035] Wild-type strain B73-329 and overexpression strain ZmCPK39 OE1 and ZmCPK39 OE2, Deletion line ZmCPK39- 1 and ZmCPK39-2 Sow one corn seed in each prepared flowerpot, keeping the endosperm side facing upwards. Then cover the seeds with a 2cm thick layer of a mixture of potting soil, vermiculite, and substrate in a 1:1:1 volume ratio.

[0036] At a temperature of 28℃, a normal illumination group (CK) was set up: with a light intensity of 300 µmol / (m²). 2 • Under light for 16 hours and darkness for 8 hours; cultivate in a greenhouse until emergence; Simultaneously, a low-light group (LL) was set up: wild-type, overexpression, and deletion lines were placed under a light intensity of 20 µmol / (m²). 2 Cultivated in a greenhouse under 16 hours of light and 8 hours of darkness until emergence; Four days later, the phenotypes of each plant under the two light conditions were photographed and recorded. The results are as follows: Figure 2 As shown; the height of the above-ground parts of the plants was also measured and statistically analyzed, and the results are as follows. Figure 3 As shown, by Figure 2 and Figure 3 It can be seen that, under normal light conditions, wild-type and overexpression lines... ZmCPK39 OE1, ZmCPK39 There were no significant differences in phenotype and aboveground plant height between OE2 strains, but under low light treatment, wild-type and overexpression lines showed differences. ZmCPK39 OE1, ZmCPK39 The phenotype and aboveground plant height of OE2 were significantly better than those of the deletion lines. ZmCPK39-1 , ZmCPK39-2 .

[0037] Example 3: Determination of net photosynthetic rate of overexpression and deletion lines under different light conditions The net photosynthetic rate of each plant was also measured. Specifically, leaves at the second maturity stage of each plant were taken and measured using the LI-COR 6800 fully automated photosynthesis-fluorescence measurement system. The results are as follows: Figure 4 As shown, by Figure 4 It can be seen that under normal light conditions, the net photosynthetic rate of the overexpression lines was not significantly different from that of the wild type, while the photosynthetic rate of the deletion lines was significantly lower than that of the wild type. Under low light conditions, the net photosynthetic rate of all lines generally decreased significantly, consistent with the pattern under normal light conditions, with the mutants showing a more pronounced decrease.

[0038] Example 4 Wild-type strains after different low-light treatments ZmCPK39 Changes in transcription level Seeds of the wild-type line B73-329 were sown in prepared flowerpots, one corn seed per pot, with the endosperm side facing upwards. The seeds were then covered with a 2cm layer of a mixture of potting soil, vermiculite, and substrate in a 1:1:1 volume ratio. The plants were cultured in a greenhouse at 28℃ with 16 hours of light followed by 8 hours of darkness until the two-leaf stage. They were then transferred to low-light treatment for 0 min, 10 min, 30 min, 60 min, 1 day, 2 days, 3 days, 4 days, and 5 days. Leaves after low-light treatment were collected and analyzed using RT-qPCR. ZmCPK39 The transcriptional level, the results are as follows Figure 5 As shown, by Figure 5 It can be seen that, ZmCPK39 The transcriptional level increased with prolonged low light treatment time.

[0039] Example 5: Overexpression lines after low light treatment ZmCPK39 Changes in kinase activity overexpression strains ZmCPK39 OE1 seeds were sown in prepared flowerpots, one corn seed per pot, with the endosperm side facing upwards. The seeds were then covered with a 2cm layer of a mixture of potting soil, vermiculite, and substrate in a 1:1:1 volume ratio. The seeds were cultured in a greenhouse at 28℃ with 16 hours of light followed by 8 hours of darkness until emergence. Subsequently, the plants were transferred to a low-light treatment, and the above-ground parts were collected on days 3 and 4 of the low-light treatment for kinase activity experiments. The results are as follows... Figure 6 As shown, by Figure 6 It can be seen that low-light processing makes ZmCPK39 Increased kinase activity.

[0040] Example 6: Expression of grain traits in field planting of overexpression and deletion lines Wild-type strain B73-329 and overexpression strain ZmCPK39 OE1 and ZmCPK39 OE2 was planted in the field, and after self-pollination, fruit ears were harvested. Macroscopic characteristics were as follows: Figure 7 As shown, the grain traits were statistically analyzed, and the statistical results are as follows: Figure 8 As shown, where, Figure 8 In the figure, A represents the comparison of ear length. Figure 8 B in the figure represents the comparison of ear weight per plant. Figure 8 C in the figure represents the weight of 100 grains. Figure 8 D in the figure represents the comparison of grain length. Figure 8 E in the figure represents the comparison of kernel width; from Figure 8 It can be seen that among them ZmCPK39 The 100-grain weight of the OE1 strain was higher than that of the wild type, and the 100-grain weight of the OE2 strain also showed an upward trend, demonstrating that overexpression... ZmCPK39This gene has the function of increasing maize kernel weight, and the intensity of the effect is related to the gene expression level of the lines. Regarding kernel width, both overexpressing lines showed higher widths than the wild type, indicating that regulating kernel lateral development and increasing kernel width is the core stable pathway for this gene to increase kernel weight. Regarding kernel length, the OE1 line also showed an increase, further amplifying the kernel weight gain effect by increasing kernel volume. The ear weight per plant in the OE1 line also increased synchronously, and there was no difference in ear length among all lines, ruling out interference from changes in ear morphology. This clearly indicates that the core source of the yield gain per plant is enhanced kernel development and increased kernel weight.

[0041] Wild-type strain B73-329 and mutant materials were used. ZmCPK39-1 and ZmCPK39-2 Planted in the field, the fruit ears are harvested after self-pollination. The macroscopic characteristics are as follows: Figure 9 As shown, the grain traits were statistically analyzed, and the statistical results are as follows: Figure 10 As shown, where, Figure 10 In the figure, A represents the comparison of ear length. Figure 10 B in the figure represents the comparison of ear weight per plant. Figure 10 C in the figure represents the weight of 100 grains. Figure 10 D in the figure represents the comparison of grain length. Figure 10 E in the figure represents the comparison of kernel width; from Figure 10 It can be seen that, compared with the wild type B73-329, ZmCPK39 -1、 ZmCPK39 -2 The grain weight per 100 grains of both mutants was significantly reduced, and the higher the degree of loss of function in the mutant, the more significant the reduction in grain weight, proving that ZmCPK39 It is an essential gene for maintaining normal kernel weight in maize. Loss of function of cpk39 simultaneously inhibits both longitudinal elongation and lateral expansion of the kernels. The kernel length and width of both mutants are significantly lower than the wild type. The reduced sink capacity directly limits the accumulation space of kernel dry matter, which is the core developmental reason for the reduced kernel weight. The mutants show significantly shortened ear length and a substantial decrease in ear weight per plant. This yield disadvantage is driven by both reduced ear kernel number potential and decreased single-kernel weight, indicating... ZmCPK39 It can directly affect the yield of maize by regulating grain development.

[0042] In summary, the combined evidence from both genetic studies indicates that... ZmCPK39 It is a positive regulator of maize kernel weight, and its normal expression is key to ensuring kernel enlargement and weight levels. It can be used as a candidate target for high-yield genetic improvement of maize.

Claims

1. ZmCPK The application of genes to enhance maize photosynthetic yield and regulate seedling response to light stress is characterized by, The gene is ZmCPK39 Its nucleotide sequence is shown in SEQ ID NO.

1. By genetic engineering, its expression level can be increased, thereby enhancing the ability of maize seedlings to resist light stress and thus increasing maize photosynthetic yield.

2. Corn ZmCPK39 The application of a protein or its encoding gene, or biological material containing its encoding gene, in regulating maize's resistance to light stress, is characterized by: The specific methods for increasing maize photosynthetic yield and regulating resistance to light stress are as follows: [The text abruptly shifts to a seemingly unrelated topic about corn.] ZmCPK39 Increased protein expression levels enhance photosynthetic yield and resistance to light stress in maize. ZmCPK39 The protein-coding gene is shown in SEQ ID NO.2; ZmCPK39 The amino acid sequence of the protein is shown in SEQ ID NO.

3.

3. A method for improving maize photosynthetic yield and resistance to light stress, characterized in that, Increase ZmCPK39 Gene expression levels in maize, including but not limited to: (1) Using genetic engineering techniques to overexpress ZmCPK39 The gene vector was transferred into maize; or, (2) Selecting and modifying regulation through genetic engineering techniques ZmCPK39 The promoter for gene expression is a strong promoter; or, (3) Increasing the coding in maize chromosomes through genetic engineering. ZmCPK39 The copy number of a gene; or, (4) Introducing enhancers through genetic engineering; The ZmCPK39 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

4. The method according to claim 3, characterized in that, Will contain ZmCPK39 The gene plasmid was transformed into maize and then self-pollinated for breeding.

5. A kind ZmCPK39 The application of a gene, or the protein it encodes, or biological material containing the gene, or the method of claim 3 in the cultivation of maize tolerant to low light conditions; The ZmCPK39 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

3.

6. A kind ZmCPK39 A gene, or the protein it encodes, or biological material containing the gene, or the method of claim 3, in improving maize seedling quality. ZmCPK39 Applications in kinase activity; The ZmCPK39 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

3.

7. The application of a ZmPYL11 gene, or the protein encoded thereon, or biological material containing the gene, or the method of claim 3, in increasing maize kernel weight; The ZmCPK39 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

3.

8. A kind ZmCPK39 The application of a gene, or the protein it encodes, or biological material containing the gene, or the method described in claim 3, in the improvement of maize germplasm resources; The ZmCPK39 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.3; The improvement of maize germplasm resources refers to improvements in maize photosynthetic yield, resistance to light stress, and / or grain weight.