Application of muscle exosome miR-1a-3p in regulating fat deposition of chicken

Abstract

The present application relates to the field of molecular biology and genetic breeding technology, and particularly relates to application of muscle exosome miR-1a-3p in regulating chicken fat deposition, and provides application of miR-1a-3p in chest muscle exosome in fat deposition regulation, wherein, by improving chest muscle miR-1a-3p gene expression, the exosome is delivered to abdominal fat tissue in the form of exosome, fat acid utilization can be improved, and fat deposition can be inhibited. In addition, the present application also provides application of muscle exosome miR-1a-3p in regulating chicken beige adipocyte generation.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and genetic breeding technology, and in particular to the application of a muscle exosome miR-1a-3p in regulating fat deposition in chickens. Background Technology

[0002] Yellow-feathered broiler chickens are a distinctive high-quality breed in my country, highly favored by consumers for their delicious meat and unique flavor. However, their production costs are significantly higher than those of white-feathered broilers, resulting in a severe lack of market competitiveness. Fat deposition is one of the key factors affecting the production cost of yellow-feathered broilers. Excessive fat deposition not only reduces feed conversion ratio and increases breeding costs, but also leads to the large-scale disposal of waste fat during slaughtering and processing, reducing slaughter rate, and negatively impacting meat quality. Therefore, controlling fat deposition in yellow-feathered broilers through technical means and reducing unnecessary fat accumulation is an important direction for improving the production efficiency and enhancing the market competitiveness of yellow-feathered broilers.

[0003] Muscles are secretory organs that release secretory factors, including exosomes and cytokines, which mediate muscle-fat interactions and regulate adipose tissue function through paracrine and endocrine pathways.

[0004] Mammalian exosomes are extracellular vesicles with a diameter of 40-160 nm, serving as key mediators of intercellular communication. They carry proteins, lipids, and nucleic acids (such as miRNAs) and are widely involved in the regulation of cellular functions. Studies have shown that mammalian muscles can regulate the development and function of adipose tissue by delivering miRNAs via exosomes. However, whether chicken muscle exosomes possess the function of regulating adipose tissue and their potential targeting mechanisms remain unclear. Furthermore, in birds, although morphological data indicate the absence of brown adipose tissue, a novel uncoupling protein—avian UCP (avUCP)—has been found in chicken skeletal muscle and adipose tissue. Thyroxine and cold exposure significantly promote avUCP expression. However, its true uncoupling activity and contribution to thermogenic production remain to be determined, and the existence of thermogenic brown or beige adipocytes is still unknown.

[0005] Existing research on the regulation of fat deposition in chickens largely focuses on gene regulation within single tissues. The specific mechanisms by which chicken muscle tissue targets and regulates fat deposition via exosome-mediated miRNA delivery remain unclear, and there are no stable molecular targets that can be directly applied to improve abdominal fat percentage in yellow-feathered broilers. This fails to meet the current need for precise regulation of fat deposition in yellow-feathered broiler breeding and production. Therefore, elucidating the exosome-mediated fat deposition regulatory targets in poultry, particularly yellow-feathered broilers, is of significant value for regulating fat deposition in yellow-feathered broilers and reducing production costs. Summary of the Invention

[0006] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide an application of muscle exosome miR-1a-3p in regulating fat deposition in chickens.

[0007] Another object of the present invention is to provide the application of the above-mentioned muscle exosome miR-1a-3p in increasing chicken yield.

[0008] Another object of the present invention is to provide the application of the above-mentioned muscle exosome miR-1a-3p in regulating the generation of chicken beige adipocytes.

[0009] The objective of this invention is achieved through the following technical solution: The application of a muscle exosome miR-1a-3p in regulating fat deposition in chickens, wherein the nucleotide sequence of miR-1a-3p is shown in SEQ ID NO: 1.

[0010] The regulation of chicken fat deposition includes inhibiting or promoting chicken fat deposition.

[0011] The inhibition of chicken fat deposition was achieved by overexpressing miR-1a-3p.

[0012] The aforementioned promotion of chicken fat deposition is achieved by inhibiting miR-1a-3p expression or activity.

[0013] The application of a muscle exosome miR-1a-3p in increasing chicken yield, wherein the nucleotide sequence of miR-1a-3p is shown in SEQ ID NO: 1.

[0014] The aforementioned method of increasing chicken yield specifically involves promoting muscle growth by overexpressing muscle miR-1a-3p; specifically, it can increase muscle weight by increasing the expression of the miR-1a-3p gene in the pectoral muscle.

[0015] The application of a muscle exosome miR-1a-3p in regulating the generation of beige chicken adipocytes, wherein the nucleotide sequence of miR-1a-3p is shown in SEQ ID NO: 1.

[0016] A method for reducing abdominal fat percentage and improving feed conversion efficiency in Wenchang chickens includes the following steps: (1) Design and synthesize an overexpression sequence containing miR-1a-3p pre-miRNA, insert it into an adeno-associated virus vector, and obtain a recombinant adeno-associated virus vector; (2) The recombinant adeno-associated virus vector constructed in step (1) is packaged with adeno-associated virus to obtain recombinant adeno-associated virus AAV-miR-1a-3p; (3) Inject the recombinant adeno-associated virus AAV-miR-1a-3p obtained in step (2) into the breast muscle of Wenchang chicken.

[0017] The overexpression sequence described in step (1) is shown in SEQ ID NO: 2.

[0018] The nucleotide sequence of the adeno-associated virus vector described in step (1) is shown in SEQ ID NO: 3.

[0019] The adeno-associated virus serotype can be MyoAAV1A.

[0020] The adeno-associated virus packaging described in step (2) specifically refers to: The recombinant adeno-associated virus vector constructed in step (1), the helper plasmid pHelper, and the packaging plasmid pRepCap were co-transfected into 293T cells. The virus was collected, purified, and adeno-associated virus AAV-miR-1a-3p was obtained.

[0021] The preferred mass ratio of the recombinant adeno-associated virus vector, the helper plasmid pHelper, and the packaging plasmid pRepCap is 1:1:1.

[0022] The preferred injection dose in step (3) is 4 × 10⁻⁶. 12 vg / only.

[0023] A method for promoting the generation of beige adipocytes in chickens includes the following steps: (1) Design and synthesize an overexpression sequence containing miR-1a-3p pre-miRNA, insert it into a lentiviral vector, and obtain a recombinant lentiviral vector; (2) The recombinant lentiviral vector constructed in step (1) is packaged to obtain recombinant lentivirus; (3) Using chicken SVF cells as the target, add induction culture medium containing the recombinant lentivirus obtained in step (2) to induce differentiation and obtain chicken beige fat cells.

[0024] The overexpression sequence described in step (1) is shown in SEQ ID NO: 4.

[0025] The nucleotide sequence of the lentiviral vector described in step (1) is shown in SEQ ID NO: 5.

[0026] The virus packaging described in step (2) specifically refers to: The recombinant lentiviral vector constructed in step (1), helper plasmids psPAX2 and pMD2.G were co-transfected into 293T cells, the virus was collected, purified, and recombinant lentiviral particles were obtained.

[0027] The preferred mass ratio of the recombinant lentiviral vector, helper plasmid psPAX2, and pMD2.G is 4:3:1.

[0028] A type of chicken beige fat cell was prepared by the above method.

[0029] Technical approach of the present invention: (1) miR-1a-3p was highly expressed in the pectoral muscle, pectoral exosomes and abdominal adipose tissue of chickens with low abdominal fat percentage. This invention involved sampling 200 115-day-old Wenchang chickens after slaughter, calculating individual abdominal fat percentages, and ranking them. The top 12.5% ​​were defined as the high abdominal fat percentage group (HAFR, >7%, n = 25), and the bottom 12.5% ​​as the low abdominal fat percentage group (LAFR, <3%, n = 25). miRNA sequencing of pectoral muscle exosomes and adipose tissue revealed high expression of miR-1a-3p in low abdominal fat percentage pectoral muscle exosomes (LB-exo) and abdominal adipose tissue. qRT-PCR analysis showed that the miR-1a-3p content in low abdominal fat percentage pectoral muscle (LAFR-B), abdominal fat (LAFR-A), and LB-exo was significantly higher than that in high abdominal fat percentage pectoral muscle (HAFR-B), abdominal fat (HAFR-A), and high abdominal fat percentage pectoral muscle exosomes (HB-exo).

[0030] (2) Pectoral muscles deliver miR-1a-3p to adipose tissue via exosomes, affecting fat deposition. The PHK67 labeling experiment further demonstrated that pectoral muscle exosomes can be effectively taken up and utilized by abdominal adipose tissue.

[0031] A muscle-specific adeno-associated virus (AAV) expressing miR-1a-3p (MyoAAV1A-miR-1a-3p) was constructed and injected intramuscularly into 77-day-old Wenchang chickens. Results showed that after AAV virus injection, the expression levels of miR-1a-3p in the pectoral muscle, pectoral muscle exosomes, and abdominal fat were significantly increased in the AAV-miR-1a-3p group, while there was no significant difference in miR-1a-3p expression in the leg muscle and liver. There were no significant differences in live weight, carcass weight, average daily feed intake, and average daily weight gain between the two groups of Wenchang chickens. The feed conversion efficiency, pectoral muscle weight, and abdominal fat weight and percentage were significantly higher in the AAV-miR-1a-3p group than in the control group. These findings suggest that miR-1a-3p, as a functional miRNA in exosomes, plays an important regulatory role in muscle-fat communication.

[0032] (3) Chickens have beige fat cells in their abdominal adipose tissue. To further investigate the differences in adipose tissue composition between HAFR and LAFR, this invention performed single-cell nuclear transcriptomics sequencing on abdominal adipose tissue. Sequencing results showed that, based on marker genes of various cell types, chicken abdominal adipose tissue contained nine cell types, including beige adipocytes. More importantly, the content of beige adipocytes was extremely low in the HAFR group, while it was significantly increased in the LAFR group. KEEG analysis of differentially expressed genes in the two groups revealed that they mainly focused on energy metabolism-related signaling pathways such as PPAR. Comparative analysis of beige adipocyte marker gene expression in the two adipose tissue groups showed that PPARGC1A (PGC-1A), PPARA, CTP1A, and IGF1 were all highly expressed in LAFR.

[0033] (4) MiR-1a-3p promotes the formation of beige adipocytes Treatment of predifferentiated chicken vascular stromal cells (SVF cells) with lentiviruses overexpressing miR-1a-3p and those inhibiting miR-1a-3p expression induced differentiation into mature adipocytes. Intervention at the endogenous miR-1a-3p level revealed that miR-1a-3p significantly inhibited polyester differentiation in primary chicken adipocytes, promoted oxygen consumption, enhanced mitochondrial function, and facilitated the formation of beige adipocytes. Inhibition of miR-1a-3p exhibited the opposite effect. This suggests that miR-1a-3p plays a crucial role in regulating beige adipocyte formation.

[0034] The present invention has the following advantages and effects compared with the prior art: (1) This invention focuses on the role of miRNA carried by exosomes derived from pectoral muscle tissue in the regulation of fat deposition, and provides the application of miR-1a-3p in pectoral muscle exosomes in the regulation of fat deposition. In this invention, from the perspective of inter-tissue information transmission, the characteristics of pectoral muscle exosomes with high / low abdominal fat ratio are systematically analyzed, the regulatory role of miR-1a-3p on beigeization and fat deposition in chicken primary adipocytes is clarified, and the molecular mechanism of miR-1a-3p as a key factor mediating this process is revealed for the first time, providing new theoretical support and regulatory targets for the regulation of fat deposition in poultry.

[0035] (2) This invention is the first to confirm that miR-1a-3p in pectoral muscle exosomes can be taken up by adipose tissue, thereby negatively regulating lipid deposition in adipose tissue, and clarifying the role of miR-1a-3p as a key factor in muscle-fat communication.

[0036] (3) This invention verifies the molecular mechanism by which miR-1a-3p participates in the deposition process by promoting beigeization of adipocytes, providing a new strategy for reducing feed conversion ratio (FCR) by targeting miRNA to regulate abdominal fat percentage.

[0037] (4) This invention provides a method for reducing fat deposition in Wenchang chickens, specifically: introducing adeno-associated virus expressing miR-1a-3p into the chicken's pectoral muscle tissue, causing miR-1a-3p to be secreted by the pectoral muscle tissue and encapsulated in exosomes. After the exosomes are taken up by the abdominal adipose tissue, they promote the growth of beige adipocytes (PPARA) in the abdominal adipose tissue. + / PPARGC1A + The differentiation and activation of ) can reduce abdominal fat percentage, improve feed conversion efficiency, and increase chicken yield. Attached Figure Description

[0038] Figure 1 This is an analysis of the results of grouping 200 Wenchang chicken hens into high / low abdominal fat percentage groups and the distribution of abdominal fat percentage, as well as the live weight, carcass weight, abdominal fat weight, abdominal fat percentage, and liver weight of 5 Wenchang chicken hens. Among them, A: Schematic diagram of Wenchang chickens divided into high and low abdominal fat percentage groups according to abdominal fat percentage; B: Distribution of abdominal fat percentage of 200 Wenchang chicken hens (blue boxes represent the abdominal fat percentage range selected for low abdominal fat percentage chickens, and red boxes represent the abdominal fat percentage range selected for high abdominal fat percentage chickens); C: Live weight of 5 selected Wenchang chicken hens; D: Carcass weight of 5 selected Wenchang chicken hens; E: Abdominal fat weight of 5 selected Wenchang chicken hens; F: Abdominal fat percentage of 5 selected Wenchang chicken hens; G: Liver weight of 5 selected Wenchang chicken hens.

[0039] Figure 2 This image shows the results of pectoral muscle exosome identification in Wenchang chickens with high / low abdominal fat percentage. A: Electron microscopic examination of pectoral muscle exosomes in the HAFR and LAFR groups; B: Particle size distribution analysis of pectoral muscle exosomes in the HAFR and LAFR groups; C: Pectoral muscle exosome concentration in the HAFR and LAFR groups; D: Statistical analysis of pectoral muscle exosome particle size in the HAFR and LAFR groups.

[0040] Figure 3 This image shows the sequencing results of exosomes from the pectoral muscles of Wenchang chickens in the high / low abdominal fat groups. A: OPLS-DA analysis of HAFR and LAFR pectoral muscle exosome miRNA sequencing; B: Read count of differentially expressed miRNAs from HAFR and LAFR pectoral muscle exosomes; C: Quantitative real-time PCR detection of partial miRNAs from HAFR and LAFR pectoral muscle exosomes; D: Quantitative real-time PCR detection of partial miRNAs from HAFR and LAFR pectoral muscles; E: Quantitative real-time PCR detection of partial miRNAs from HAFR and LAFR abdominal fat.

[0041] Figure 4 These are fluorescence images of various tissues detected at 12 h, 24 h, and 48 h after slaughter following intravenous injection of PHK67-labeled pectoral muscle exosomes.

[0042] Figure 5This is a graph showing the growth performance of chickens that specifically overexpress miR-1a-3p in their pectoral muscles. In this graph, A represents the growth curves of Wenchang chicken hens injected with AAV-miR-1a-3p and its control virus, while BE represents the carcass weight, average daily weight gain, average daily feed intake, and feed conversion ratio of the AAV-miR-1a-3p group and the control group.

[0043] Figure 6 This image shows the miR-1a-3p expression results in various tissues of chickens that specifically overexpress miR-1a-3p in the pectoral muscle. A: Quantitative fluorescence detection results of miR-1a-3p in pectoral muscle; B: Quantitative fluorescence detection results of miR-1a-3p in pectoral muscle exosomes; C: Quantitative fluorescence detection results of miR-1a-3p in abdominal fat; D: Quantitative fluorescence detection results of miR-1a-3p in leg muscle; E: Quantitative fluorescence detection results of miR-1a-3p in liver.

[0044] Figure 7 This image shows the tissue weights and H&E staining results of chickens with pectoral muscle-specific overexpression of miR-1a-3p. A: pectoral muscle weight; B: leg muscle weight; C: liver weight; D: abdominal fat weight; E: abdominal fat percentage; F: abdominal fat photograph and H&E section; G: adipocyte area; H: adipocyte diameter.

[0045] Figure 8 This is a graph showing the detection of serum biochemical indicators in chickens with pectoral muscle-specific overexpression of miR-1a-3p. In the graph, A: triglyceride content, B: non-acylated fatty acid content, C: total cholesterol concentration, D: glucose concentration, and E: high / low density lipoprotein cholesterol concentration.

[0046] Figure 9 This is a single-cell sequencing result of abdominal adipose tissue from chickens. Among them, A: UMAP classification results of single-cell nuclear transcriptomics sequencing (HAFR and LAFR groups were analyzed together), B: marker gene expression results of each cell type (HAFR and LAFR groups were analyzed together), C: Proportion of each cell type, D: Comparison of HAFR and LAFR groups, E: Number of each cell type (HAFR and LAFR groups were analyzed together).

[0047] Figure 10This is a graph showing the expression of marker genes in beige adipocytes. A: PPARGC1A expression results in various cell types (HAFR and LAFR groups analyzed together); B: PPARA expression results in various cell types (HAFR and LAFR groups analyzed together); C: Comparison of PPARGC1A expression in HAFR and LAFR; D: Comparison of PPARA expression in HAFR and LAFR; E: Comparison of CPT1A expression in HAFR and LAFR; F: Comparison of IGF1 expression in HAFR and LAFR.

[0048] Figure 11 This is a diagram showing the differential gene and pathway analysis of white and beige adipocytes in adipose tissue with high / low abdominal fat percentage. A: Volcano plot of white adipocytes; B: KEGG signal analysis results of white adipocytes; C: Volcano plot of beige adipocytes; D: KEGG signal analysis results of beige adipocytes.

[0049] Figure 12 This is a diagram showing the regulatory effect of miR-1a-3p on beige adipocyte differentiation. In the diagram, A: Oil Red O staining results of adipocytes after treatment with miR-1a-3p overexpression / inhibition lentivirus and its control lentivirus; B: Quantitative detection results of miR-1a-3p in adipocytes; C: Quantitative detection results of Oil Red O staining; D: Triglyceride content determination results; E: Non-acylated fatty acid content determination results.

[0050] Figure 13 This is a graph showing the results of miR-1a-3p promoting the production of beige adipocytes. A: Oxygen consumption of adipocytes with miR-1a-3p overexpression detected by Seahorse; B: Basal oxygen consumption statistics; C: Maximum oxygen consumption statistics; D: ATP production statistics; E: Non-mitochondrial oxygen consumption statistics; F: Oxygen consumption of adipocytes with miR-1a-3p inhibition detected by Seahorse; G: Basal oxygen consumption statistics; H: Maximum oxygen consumption statistics; I: ATP production statistics; J: Non-mitochondrial oxygen consumption statistics.

[0051] Figure 14 This is a graph showing the results of quantitative real-time PCR (qRT-PCR) detection of related gene expression in the control group and miR-1a-3p overexpression group in Example 4. Detailed Implementation

[0052] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0053] In the examples, abdominal fat percentage is defined as the percentage of abdominal fat weight to the sum of eviscerated weight and abdominal fat weight. For details, please refer to the National Agricultural Industry Standard—Standard for Terminology and Measurement Calculation Methods of Poultry Production Performance NYT823-2020.

[0054] The Wenchang chicken involved in the embodiment is the Tan Niu No. 3 Wenchang chicken breeding system.

[0055] Example 1: Identification of chicken pectoral muscle exosomes and detection of miR-1a-3p expression levels I. Experimental Methods 1. Slaughter 200 115-day-old Tan Niu No. 3 Wenchang chicken breeding line hens, calculate the abdominal fat percentage of each individual, and rank them by abdominal fat percentage. Define the top 12.5% ​​of individuals by abdominal fat percentage as the high abdominal fat percentage group (abbreviation: HAFR, abdominal fat percentage >7%, n = 25), and the bottom 12.5% ​​as the low abdominal fat percentage group (abbreviation: LAFR, abdominal fat percentage <3%, n = 25).

[0056] 2. Five Wenchang chickens from each of the high / low abdominal fat percentage groups were selected, with no significant differences in live weight, carcass weight, and liver weight. Three chickens from each group were randomly selected, and pectoral muscle and abdominal fat tissue were extracted after slaughter. A portion of the pectoral muscle tissue was used for pectoral muscle exosome isolation from the high and low abdominal fat percentage groups of Wenchang chickens. Morphology, particle size, and miRNA content were analyzed, as detailed below: (1) Isolation of exosomes The pectoral muscle tissue was washed in PBS solution and cut into tissue blocks with a diameter of less than 1-2 mm using scissors. The tissue blocks were then mixed with digestion solution (PBS with a final concentration of 2 mg / mL type IV collagenase) at a volume ratio of 1:5 and digested at 37°C for 2 h. The digested liquid was collected. The mixture was centrifuged at 4°C and 300×g for 5 min to remove the precipitate. The centrifugation was repeated to remove cellular impurities, and the supernatant was obtained. The supernatant was filtered through a 0.22 μm PVDF filter membrane, and the exosomes were filtered into a 38.5 mL ultrafiltration tube (Beckman Coulter). The tube was centrifuged at 120,000×g for 2 h, and the supernatant was aspirated to collect the precipitate. The precipitate was resuspended in 100-150 μL of PBS solution and stored at -80°C. The exosomes from different pectoral muscles were named HB-exo (corresponding to high abdominal fat percentage) and LB-exo (corresponding to low abdominal fat percentage), respectively.

[0057] (2) Identification of pectoral muscle exosomes The pectoral muscle exosomes obtained in step (1) were subjected to transmission electron microscopy imaging analysis. Specifically, 10 μL of exosomes were placed on a copper grid coated with 400-mesh polymethyl methacrylate and incubated for 5 min. Then, the excess liquid was discarded, and uranyl acetate was added to the grid for negative staining for 1 min. The excess liquid was then discarded, and the sample was observed under 100 kV using a transmission electron microscope. The size distribution and concentration of adipose exosomes were determined using a Particle Metrix nanoparticle tracking analyzer.

[0058] 3. Sequencing of pectoral muscle exosome miRNAs The pectoral muscle exosomes obtained in step 2 underwent miRNA sequencing, which was commissioned to Guangzhou Zhongxin Runkang Biotechnology Co., Ltd., as detailed below: (1) Total RNA was extracted from pectoral muscle exosomes using TRIzol reagent (Invitrogen, catalog number 15596026), and DNA was digested using DNase I. RNA quality was determined by checking the A260 / A280 ratio using a Nanodrop spectrophotometer (Thermo Fisher Scientific Inc.), and RNA integrity was confirmed by 1.5% agarose gel electrophoresis. Qualified RNA was finally processed using Qubit 3.0. TM RNA wide-range detection kit (Life Technologies, Q10210) for quantification.

[0059] (2) Using KC-Digital TM Illumina ®Small RNA Library Preparation Kit (Wuhan Saike Health Co., Ltd., Catalog No. DR08602) uses 3 μL of total RNA for miRNA library preparation. This kit eliminates repetitive bias in PCR and sequencing steps by labeling pre-amplified small RNA molecules with a unique molecular identifier (UMI) of 8 random bases. The eluted cDNA library is separated and eluted using a 6% PAGE gel. Bands of approximately 160 bp are separated, purified, and quantified using Qubit 3.0, and finally sequenced using a PE150 model on a HiSeq X-10 sequencer (Illumina). For details, please refer to the literature (Sun Y, Li B, Song B, Xia Y, Zhou 10.1186 / s12951-025-03246-9. PMID: 40069788; PMCID: PMC11900527).

[0060] (3) Sequencing data processing The sequencing data were processed using the reference (Link JC, Hasin-Brumshtein Y, Cantor RM, Chen X, Arnold AP, Lusis AJ, Reue K. Diet, gonadal sex, and sex chromosome complement influence white adipose tissue miRNA expression. BMC Genomics. 2017 Jan 17;18(1):89. doi: 10.1186 / s12864-017-3484-1. PMID: 28095800; PMCID: PMC5240420), as follows: ① The raw sequencing data was first filtered by fastx_toolkit (version: 0.0.13.2) to distinguish low-quality reads, and the adapter sequences were trimmed by cutadapt (version: 1.15).

[0061] ②Clean Reads are further processed using internal scripts to eliminate duplication bias introduced during library preparation and sequencing. Specifically: First, clean reads are clustered based on their UMI sequences, with reads having the same UMI sequence grouped into the same cluster. Reads within the same cluster are compared against each other through pairwise alignment, and then reads with 100% sequence identity are extracted into a new sub-cluster. After all sub-clusters are generated, multiple sequence alignment is performed to obtain a consensus sequence for each sub-cluster. Following these steps, any errors and biases introduced by PCR amplification or sequencing are eliminated.

[0062] ③ Using bowtie (version 1.1.2) with default parameters, the deduplicated consensus sequences in each sample were mapped to the chicken reference genome (GCF_000002315.5_GRCg6a). The mirdeep2 package (version 2.0.0.8) was used to map the readings to known primary miRNAs in the miRBase database and to predict new miRNAs. The edgeR package (version 3.12.1) was used to identify differences in miRNA expression between groups. P The critical values ​​of <0.05 and |Log2Fold change|>1 were used to determine the statistical significance of differences in miRNA expression.

[0063] 4. Quantitative real-time PCR detection of pectoral muscle tissue, abdominal adipose tissue, and pectoral muscle exosomes. RNA was extracted from the pectoral muscle tissue, abdominal adipose tissue, and pectoral muscle exosomes obtained in step 2 using the Trizol method, following step 3. RNA reverse transcription was performed using the Mir-X miRNA First-Strand Synthesis Kit (Clontech, catalog number: 638313) (internal control U6 quantitative primers are included in the reverse transcription kit). Then, the RNA was qRT-PCR was performed using Mir-X miRNA TB Green. ® The kit (Takara, catalog number: 638314) was used to detect the reverse transcription products by quantitative real-time PCR (qRT-PCR). Primers are shown in Table 1.

[0064] Table 1 Primer Sequences gga-miR-1a-3p-qRT-PCR-primer-F GCCGAGTGGAATGTAAAGAAGT SEQ ID NO: 8 gga-miR-1a-3p-qRT-PCR-primer-R CAGTGCAGGGTCCGAGGTAT SEQ ID NO: 9

[0065] II. Test Results Figure 1This includes charts showing the high / low abdominal fat percentage groups and distribution of 200 Wenchang chicken hens, as well as the live weight, carcass weight, abdominal fat weight, abdominal fat percentage, and liver weight of 5 Wenchang chicken hens. Figure 1 C Figure 1 D and Figure 1 G represents the live weight, carcass weight, and liver weight of five Wenchang chickens in the high abdominal fat group and the low abdominal fat group. As can be seen from the figure, there was no significant difference in live weight, carcass weight, and liver weight between the high abdominal fat group and the low abdominal fat group. P >0.05).

[0066] In both the high and low abdominal fat groups, three chickens with varying abdominal fat percentages were randomly selected for the isolation, morphology, particle size, and miRNA content identification of exosomes from the pectoral muscle. Transmission electron microscopy (TEM) showed that the exosomes in both groups exhibited a typical cup-shaped structure, and nanoparticle tracking analysis (NTA) revealed that the particle size was concentrated between 150-250 nm. Figure 2 ).

[0067] miRNA sequencing of pectoral muscle exosomes revealed significant differences between the LB-exo and HB-exo groups. Figure 3 A). The expression of miR-1a-3p in the LB-exo group was significantly higher than that in the HB-exo group. (See results below.) Figure 3 B.

[0068] Further qRT-PCR analysis was performed on pectoral muscle tissue, abdominal adipose tissue, and pectoral muscle exosomes; the results are shown below. Figure 3 C Figure 3 D and Figure 3 E, among which, the miR-1a-3p content in the pectoral muscle (LAFR-B), abdominal fat (LAFR-A), and pectoral exosomes (LB-exo) of the low abdominal fat group was significantly higher than that in the pectoral muscle (HAFR-B), abdominal fat (HAFR-A), and pectoral exosomes (HB-exo) of the high abdominal fat group.

[0069] In summary, the above data systematically verified that chickens with different abdominal fat percentages can secrete typical high-purity exosomes, possessing typical morphological characteristics, particle size characteristics, and biomarker expression characteristics. As a muscle-specific miRNA, miR-1a-3p was found to be significantly elevated in the pectoral muscle, pectoral muscle exosomes, and abdominal fat of Wenchang chickens with low abdominal fat percentages compared to those with high abdominal fat percentages. Therefore, it is preliminarily speculated that miR-1a-3p in abdominal adipose tissue originates from muscle tissue, and that muscles can deliver miR-1a-3p to abdominal adipose tissue via exosomes to negatively regulate abdominal fat percentage.

[0070] Example 2: Pectoral muscle exosomes miR-1a-3p regulate fat deposition in Wenchang chickens I. Experimental Methods 1. Pectoral muscle exosome injection test (1) Extract pectoral muscle exosomes from Wenchang chickens that have been raised normally for 45 days, mix them with PKH67 dye (concentration of 100 μM) at a mass-volume ratio of 4:1, vortex for 1 min, and incubate for 10 min; then add 10 mL PBS and mix well, centrifuge at 15000 g for 1.5 h to remove excess dye; finally resuspend the precipitate with PBS to obtain PKH67-labeled pectoral muscle exosomes, and measure the protein concentration using the BCA method.

[0071] (2) Then, the PKH67-labeled pectoral muscle exosomes obtained in step (1) were injected into 40-day-old Wenchang chicken hens via the wing vein (n = 9, 200 μg exosomes / hen). Three hens were slaughtered 12 h, 24 h and 48 h after injection, and the heart, liver, spleen, lung, kidney, pectoral muscle (BM), leg muscle (TM) and abdominal fat (AF) tissues were collected and fluorescently photographed using the IVIS Lumina II system (PerkinElmer, Waltham, MA).

[0072] 2. Pectoral muscle-specific overexpression of miR-1a-3p (1) Construction of adeno-associated virus vector ① Based on the nucleotide sequence of miR-1a-3p (using gga-miR-1a-2 as a template), an overexpression sequence as shown in SEQ ID NO: 2 was designed and artificially synthesized. Both gga-miR-1a-1 and gga-miR-1a-2 can generate functionally identical mature gga-miR-1a-3p (https: / / www.mirbase.org / results / ?query=gga-miR-1a). The overexpression sequence shown in SEQ ID NO: 2 is based on the pre-miRNA sequence, with flanking sequences added to both ends to simulate the natural state and ensure that the miRNA is precisely processed by the cell (Li Jiaxi, Song Liumei, Wang Meichen, et al. Bioinformatics method for obtaining pre-miRNA and its flanking DNA sequences for constructing miRNA high expression vectors [J]. Chinese Medical Education Technology, 2013, 000(005): 546-549. DOI: 10.3969 / j.issn.1004-5287.2013.05.015.).

[0073] The nucleotide sequence of mature miR-1a-3p (with gga-miR-1a-2 as a template) (SEQ ID NO: 1): 5'-UGGAAUGUAAAGAAGUAUGUA-3'.

[0074] miR-1a-3p overexpression sequence with restriction enzyme sites (SEQ ID NO: 2): 5'- GCTAGC TAACAAAGAAATCTCAGCCCTGAATTTTACTTAATGAAAGAAACGGTAAGCAGCAAAGTGCTTTTCAGGTTCATCTGACAGGTAGCTGAGCAACTCTACATGTACCTGCTCAGAGCACATACTTCTTTATGTACCCATATGAAC ATACAATGCTATGGAATGTAAAGAAGTATGTATTTTTGGCAGGCACAGAACGACCAGTAAGAGGAAACTAACAGCTGTTGGGAAGAGTGTGCTTCCCCACATTTGAATGACATTCAAGTGACAAGTTAACTGGCTAAGGGTCAG AAGCTT -3' Note: The underlined parts are enzyme cleavage sites.

[0075] ② Following conventional methods, the above sequence was inserted into the vector GV413 (element sequence: CMV bGlobin-mCherry-MCS-WPRE-hGH polyA, its nucleotide sequence is shown in SEQ ID NO: 3, purchased from Shanghai Jikai Gene Medical Technology Co., Ltd.) via Nhe I and Hind III restriction sites to construct a muscle-specific adeno-associated virus (MyoAAV1A-miR-1a-3p) vector that overexpresses miR-1a-3p. An empty vector without the inserted sequence was used as a control.

[0076] (2) Acquisition of AAV virus The adeno-associated virus (AAV) vector constructed in step (1) was transfected into 293T cells at a mass ratio of 1:1:1 using Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific) and plasmids pHelper and pRepCap. AAV-miR-1a-3p was obtained by concentration and purification using standard methods 72 h after transfection, with empty vector without inserted sequences serving as a control. The titer of the purified AAV virus was determined using quantitative PCR.

[0077] (3) Twenty-two 77-day-old Wenchang chicken hens were randomly selected and divided into two groups, and kept in individual cages. The pectoral muscles of the Wenchang chickens were injected with AAV-miR-1a-3p (4×10⁻⁶ pv² / kg²). 12 vg / animal) virus or control virus (4×10) 12(vg / animal). Daily feed intake was recorded after injection, and live body weight was recorded weekly. Slaughter was performed 4 weeks later, and the following indicators or parameters were recorded or tested: ① Calculate the average daily weight gain, average daily feed intake, FCR, and abdominal fat percentage from the following data: live weight, carcass weight, abdominal fat weight, pectoral muscle weight, leg muscle weight, and liver weight.

[0078] ② Collect pectoral muscle, leg muscle, abdominal adipose tissue, liver tissue and pectoral muscle exosomes, and use qRT-PCR to detect the relative miR-1a-3p expression level, referring to Example 1.

[0079] ③ H&E staining was used to detect the area and diameter of adipocytes in abdominal adipose tissue.

[0080] ④ Collect blood using disposable vacuum coagulation tubes (Hebei Kangweishi Medical Technology Co., Ltd.), mix gently, let stand for 30 min, centrifuge at 3000g for 10 min, and collect serum; detect the concentrations of triglycerides (TG), NEFA (non-acylated fatty acids), glucose (Glu), total cholesterol, and high / low density lipoprotein cholesterol in serum.

[0081] II. Test Results Results of pectoral muscle exosome injection experiments showed that pectoral muscle exosomes could be absorbed by abdominal fat, and the absorption efficiency was higher than that of other tissues. Figure 4 ).

[0082] Results of pectoral muscle-specific overexpression of miR-1a-3p showed that there were no significant differences in live weight, carcass weight, average daily weight gain, and average daily feed intake between the AAV-miR-1a-3p group and the control group, but the FCR was significantly reduced in the AAV-miR-1a-3p group. Figure 5 ).

[0083] Further examination of miR-1a-3p expression in tissues revealed that miR-1a-3p expression was significantly increased in the AAV-miR-1a-3p group in pectoral muscle, pectoral exosomes, and abdominal fat, but there was no significant difference in miR-1a-3p expression in leg muscle and liver. Figure 6 ).

[0084] Furthermore, compared with the control group, the AAV-miR-1a-3p group showed a significant increase in pectoral muscle weight, a significant decrease in abdominal fat weight and abdominal fat percentage, and no significant difference in leg muscle weight and liver weight. Figure 7 A, Figure 7 B Figure 7 C Figure 7 D、 Figure 7 E).

[0085] Paraffin embedding and H&E staining of abdominal adipose tissue revealed that, compared with the control group, the AAV-miR-1a-3p group had significantly reduced adipocyte area and diameter. Figure 7 F, Figure 7 G, Figure 7 H).

[0086] Compared with the control group, serum TG levels were significantly decreased, NEFA levels were significantly increased, and there were no significant differences in glucose, total cholesterol, and high / low density lipoprotein cholesterol. Figure 8 ).

[0087] In conclusion, high expression of miR-1a-3p in the pectoral muscle can significantly reduce abdominal fat percentage and improve feed conversion efficiency without affecting the overall growth and development of chickens, verifying that miR-1a-3p delivered by pectoral muscle exosomes does indeed play a negative regulatory role in fat deposition in vivo.

[0088] Example 3: Abdominal adipose tissue of chickens with low abdominal fat percentage shows abundant expression of beige adipocytes. I. Experimental Methods In this embodiment, single-cell nuclear transcriptomics sequencing was performed on abdominal adipocytes from the HAFR and LAFR groups (commissioned by Guangzhou Zhongxin Runkang Biotechnology Co., Ltd.). The specific single-cell nuclear transcriptomics sequencing method is as follows. 1. The frozen abdominal tissue samples from the HAFR and LAFR groups in Example 1 were minced in 1 mL of nuclear lysis buffer (NST) and lysed for 7 min. The NST consisted of 0.1 wt.% NP40, 10 mM Tris-HCl, 146 mM NaCl, 1 mM CaCl2, 21 mM MgCl2 and 1 U / μL RNase inhibitor.

[0089] 2. After confirming complete nuclear lysis using trypan blue staining and microscopic examination, 1 mL of ST Wash buffer (10 mM Tris-HCl, 146 mM NaCl, 1 mM CaCl2, 21 mM MgCl2, 0.01 wt.% BSA (NEB B9000S), and 40 U / mL RNase inhibitor) was added. The mixture was filtered through a 40 µm BD sieve, and the filtrate was transferred to a 15 mL centrifuge tube. The sieve was washed with an appropriate amount of ST Wash buffer, and the washing solution was combined with the nuclear filtrate. The cells were centrifuged at 500 g for 5 min at 4 °C. The nuclei were resuspended in 5 mL PBS + 1 wt.% BSA, washed, centrifuged, and then resuspended in 100 µL PBS + 1 wt.% BSA. The cells were stained with trypan blue and counted under a microscope. All the above nuclear suspension preparation experiments were performed on ice.

[0090] 3. Dilute cell nuclei to a concentration of 700-1200 nuclei / µL with PBS + 1wt.% BSA, and perform cDNA library amplification according to the instructions of 10×GenomicsChromium Next GEM Single Cell 3' Reagent Kits v3.1 (1000268); DNA library construction was performed using Chromium TM Single-cell 3' / 5' library construction kit (1000020).

[0091] 4. The constructed library was sequenced using the PE150 sequencing mode on an Illumina Nova 6000 platform.

[0092] II. Test Results The results suggest that, based on marker genes in various cell types, chicken abdominal adipose tissue is divided into nine cell types, including beige adipocytes ( Figure 9 More importantly, the HAFR group had extremely low levels of beige adipocytes, while the LAFR group had significantly higher levels of beige adipocytes. Figure 9 C and Figure 9 D).

[0093] Then, analysis of beige adipocyte marker gene expression revealed that PPARGC1A (PGC-1A), PPARA, CTP1A, and IGF1 were all highly expressed in LAFR. Figure 10 C Figure 10 D、 Figure 10 E and Figure 10 F).

[0094] Further analysis of the differentially expressed genes in the two groups revealed that 256 differentially expressed genes were upregulated and 224 differentially expressed genes were downregulated in white adipocytes. Figure 11 A), KEEG enrichment analysis showed that differentially expressed genes were mainly concentrated in the PPAR and focal adhesion signaling pathways (A). Figure 11 B). In beige adipocytes, 119 differentially regulated genes were upregulated, and 344 differentially regulated genes were downregulated. Figure 11 C), KEEG enrichment analysis showed that differentially expressed genes were mainly concentrated in the PPAR signaling pathway (C). Figure 11 D).

[0095] In summary, this embodiment found that beige adipocytes exist in the abdominal adipose tissue of chickens, and their content is related to the abdominal fat percentage. Furthermore, chickens with low abdominal fat percentage express a large number of beige adipocytes in their abdominal adipose tissue.

[0096] Example 4: MiR-1a-3p promotes the generation of beige adipocytes I. Experimental Methods 1. Construction of lentiviral vectors for overexpression and inhibition of MiR-1a-3p (1) Construction of a lentiviral vector overexpressing MiR-1a-3p ① Based on the nucleotide sequence of miR-1a-3p (using gga-miR-1a-1 as a template), design the miR-1a-3p overexpression sequence as shown in SEQ ID NO:4.

[0097] Overexpression sequence of miR-1a-3p with restriction enzyme sites (using gga-miR-1a-1 as a template) (SEQ ID NO: 4): GGATCC TGCCTCAAACTGTGCTGTAACTCACTCCTGGGAAGTAAATGGCACGCCAGCCCTATTTCCTCCCGTGTACATATAAATGCGCATATTGAACCTACCTGCTTGAGAGACATACTTCTTTATATGCCCATATGAACC TGGCAATCTATGGAATGTAAAGAAGTATGTATTTCAGGTGGGAACTCTTCCGGAGGAGCAATGTATGACCCCGTGTGAAGGGGGGGGGGGAGGAAGACAGACAGATTTTTGTCTTTTTTTTTTGAGATGCCTG GCTAGC Note: The underlined parts are enzyme cleavage sites.

[0098] ② Following standard methods, the above sequence was inserted into the lentiviral vector CV621 (element sequence: Ubc-MCS-SV40-Cherry-IRES-puromycin, nucleotide sequence as shown in SEQ ID NO: 5, purchased from Shanghai Jikai Gene Medical Technology Co., Ltd.) via BamHI and Nhe I restriction sites to construct a lentiviral vector overexpressing miR-1a-3p. An empty vector without the inserted sequence was used as a control. The accuracy of the recombinant vector was detected by DNA sequencing.

[0099] (2) Construction of MiR-1a-3p inhibitory lentiviral vector ① Design a miR-1a-3p inhibitory sequence (the inverse complementary sequence of miR-1a-3p), as shown in SEQ ID NO: 6, and artificially synthesize this sequence.

[0100] miR-1a-3p inhibitory sequence (SEQ ID NO: 6): 5'- ACCGGTTACATACTTCTTTACATTCCATTTTT GGATCC -3'.

[0101] Note: The underlined parts are enzyme cleavage sites.

[0102] ② Following standard methods, the above sequence was inserted into the lentiviral vector plasmid GV377 (element sequence: U6-MCS-Ubc-Cherry-IRES-puromycin, nucleotide sequence as shown in SEQ ID NO: 7, purchased from Shanghai Jikai Gene Medical Technology Co., Ltd.) via Age I and BamHI restriction sites to construct a lentiviral vector that inhibits miR-1a-3p expression. An empty vector without the inserted sequence was used as a control. The accuracy of the recombinant vector was detected by DNA sequencing.

[0103] 2. Virus Packaging Using Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific Inc.) transfection reagent, the lentiviral vector constructed in step 1 and two helper plasmids psPAX2 and pMD2.G were transfected into 293T cells at a mass ratio of 4:3:1, according to the manufacturer's instructions. The supernatant was harvested 42 h and 72 h after transfection, centrifuged at 600 g for 5 min to remove cell debris, filtered through a 0.45 µm PVDF filter, transferred to a Millipore 100 kDa ultrafiltration tube, and concentrated by centrifugation at 3000 g for 30 min. The concentrated viral solution was then aliquoted and stored at -80°C for future use.

[0104] 3. Isolation and Adipogenic Differentiation of Chicken SVF Cells ① Using Wenchang chickens at 15 days of embryonic age as subjects, subcutaneous adipose tissue was collected, minced into tissue pieces with a diameter of less than 1-2 mm, and placed in 5 mL of digestion solution (PBS + 0.1 g / mL type I collagenase + 3M CaCl2) in a 37℃ water bath shaker (120 rpm) for 10 min. The digested liquid was collected, mixed by pipetting, and passed through a 100 μm cell sieve. Then, 15 mL of F12 / DMEM culture medium was added for resuspending, centrifuged at 600 g for 5 min at 4 ℃, the supernatant was discarded, and the tissue was resuspended in 5 mL of F12 / DMEM culture medium. The tissue was then passed through a 40 μm cell sieve, mixed with 15 mL of F12 / DMEM culture medium, centrifuged at 600 g for 5 min at 4 ℃, the supernatant was discarded, and the tissue was resuspended in 5 mL of complete culture medium (F12 / DMEM culture medium + 10% FBS + 1% penicillin antibiotics) and inoculated into a 25 cm cell line. 2 In cell culture flasks, the culture medium should be completely replaced every other day.

[0105] ②Wait until 25 cm 2 After the cell culture flasks have reached full growth, transfer them to a 75cm³ medium. 2 After cell culture flasks reached confluence, they were digested with trypsin and transferred to 12-well cell culture plates at a bottom area ratio of 1:3. Once the cell density reached 50%, the original medium was discarded, and 1 mL of induction medium (F12 / DMEM medium + 10% FBS + 1% penicillin antibiotics + 300 µM oleic acid) was added to induce differentiation. Simultaneously, 10 µL / well of miR-1a-3p overexpressing lentivirus and its control lentivirus (titer 5 × 10⁻⁶) were added to each well. 8 TU / mL), miR-1a-3p inhibitors of lentivirus and its control lentivirus (titer 5×10⁻⁶) 8 The induction medium was changed 12 h after infection (TU / mL), and then changed daily thereafter. The plates were collected after 4 days of induction for further research.

[0106] 4. Oil Red O staining method for adipocytes Adipocytes overexpressing miR-1a-3p and those inhibiting lentiviral infection and inducing differentiation were subjected to culture medium removal. Cells were washed twice with PBS, and 600 μL of 4% paraformaldehyde was added to each well for fixation for 30 min. The fixative was removed, and 400 μL of Oil Red O solution was added to each well for staining at room temperature for 30 min. The staining agent was removed, and the cells were rinsed twice with sterile double-distilled water to thoroughly remove unstained dye. The cells were observed and photographed under an inverted microscope. 600 μL of isopropanol (for dye extraction) was added to each well, and the cells were shaken on a decolorizing shaker for 1 min to dissolve the Oil Red O dye. 150 μL of the above dye extraction solution was added to a 96-well plate (n=3, 3 replicates per well), and the OD value was measured at 492 nm using a microplate reader.

[0107] 5. The relative miR-1a-3p expression level of differentiated mature adipocytes was detected by qRT-PCR, referring to Example 1.

[0108] 6. Refer to Example 2 to detect the concentrations of TG and NEFA in cells.

[0109] 7. Using the Agilent Seahorse XFe24 Cell Energy Metabolism Analyzer, and referring to the instructions of the Agilent Seahorse XF Cell Mitochondrial Stress Test Kit (Agilent, catalog number 103015-100), the oxygen consumption of miR-1a-3p overexpressing lentivirus and adipocytes that inhibit lentivirus infection and induce differentiation and maturation was detected.

[0110] 8. Following step 4 of Example 1, RNA was extracted from primary adipocytes infected with miR-1a-3p overexpressing virus or control virus, reverse transcribed, and subjected to qRT-PCR to detect the mRNA levels of beige fat marker genes avUCP (AB088685.1), PPARGC1A (PGC-1A, NM_001006457.2), PPARA (NM_001001464.1), CPT1A (NM_001012898.1), PRDM16 (XM_004947378.5) and lipolysis-related genes ATGL (EU240627.2) and HSL (MZ410297.1).

[0111] II. Test Results After lentivirus infection with miR-1a-3p overexpression and induction of differentiated mature adipocytes, the expression level of miR-1a-3p in adipocytes was significantly increased. Figure 12 B); Oil Red O staining results showed that miR-1a-3p overexpression significantly inhibited adipocyte production (B); Figure 12 A and Figure 12 C), reduce TG content ( Figure 12 D), increase NEFA content ( Figure 12 The miR-1a-3p inhibition group showed the opposite trend (E), while the miR-1a-3p inhibition group showed the opposite trend.

[0112] To investigate the mechanism by which miR-1a-3p regulates chicken fat deposition, the oxygen consumption of adipocytes overexpressing miR-1a-3p and those inhibited by lentivirus infection and induced to differentiate into mature cells was detected using an Agilent Seahorse XFe24 cellular energy metabolism analyzer. The results showed that miR-1a-3p overexpression significantly increased oxygen consumption in chicken adipocytes, increased basal and maximum respiration rates, and ATP production, without affecting non-mitochondrial oxygen consumption. Figure 13 AE). Inhibition of miR-1a-3p expression in chicken adipocytes yielded the opposite results to overexpression. Figure 13 FJ).

[0113] To further determine the formation of beige adipocytes, this study measured the mRNA levels of beige adipocyte marker genes avUCP, PPARGC1A (PGC-1A), PPARA, CPT1A, PRDM16, and lipolysis-related genes ATGL and HSL in adipocytes infected with and induced to differentiate into mature adipocytes by miR-1a-3p overexpression. The results showed that miR-1a-3p overexpression significantly increased the expression of beige adipocyte marker genes and lipolysis-related genes. Figure 14 ).

[0114] In summary, miR-1a-3p can enhance mitochondrial utilization of fatty acids by promoting beige transformation in chicken primary adipocytes. The cellular-level validation of miR-1a-3p's negative regulation of adipocyte lipid production corroborates in vivo experimental results, clarifying its cellular and molecular mechanism of regulating fat deposition.

[0115] This invention is the first to discover that miR-1a-3p in muscle exosomes is a key factor regulating fat deposition; and the first to demonstrate that differential expression of miR-1a-3p in muscle exosomes is the main reason affecting the formation of beige adipocytes in chickens. This finding provides new insights into exosome-mediated miRNA regulation of muscle and fat development and interaction, and also provides new targets and materials for the regulation of animal meat quality.

[0116] In summary, this invention establishes for the first time a causal regulatory chain of "muscle exosomes - miR-1a-3p - beige adipocytes - fat deposition" in birds. This chain is fundamentally different from mammalian studies in four dimensions: species, carrier, target cells, and effector pathways. It solves the key bottleneck of the long-standing lack of inter-tissue communication perspective and thermogenic metabolic targets in avian fat regulation.

[0117] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of a reagent overexpressing muscle exosome miR-1a-3p in reducing abdominal fat percentage in Wenchang chickens, characterized in that... The nucleotide sequence of miR-1a-3p is shown in SEQ ID NO:

1.

2. The application of a reagent overexpressing muscle exosome miR-1a-3p in increasing breast muscle yield in Wenchang chickens, characterized by... The nucleotide sequence of miR-1a-3p is shown in SEQ ID NO:

1.

3. The application of a reagent overexpressing muscle exosome miR-1a-3p in promoting the generation of beige adipocytes in Wenchang chickens, characterized in that... The nucleotide sequence of miR-1a-3p is shown in SEQ ID NO:

1.

4. A method for reducing abdominal fat percentage and improving feed conversion efficiency in Wenchang chickens, characterized in that... It includes the following steps: (1) Design and synthesize an overexpression sequence containing miR-1a-3p pre-miRNA, insert it into an adeno-associated virus vector, and obtain a recombinant adeno-associated virus vector; (2) The recombinant adeno-associated virus vector constructed in step (1) is packaged with adeno-associated virus to obtain recombinant adeno-associated virus AAV-miR-1a-3p; (3) Inject the recombinant adeno-associated virus AAV-miR-1a-3p obtained in step (2) into the pectoral muscle of Wenchang chicken; The overexpression sequence described in step (1) is shown in SEQ ID NO:

2.

5. The method for reducing abdominal fat percentage and improving feed conversion efficiency in Wenchang chickens according to claim 4, characterized in that: The adeno-associated virus packaging described in step (2) specifically refers to: The recombinant adeno-associated virus vector constructed in step (1), the helper plasmid pHelper, and the packaging plasmid pRepCap were co-transfected into 293T cells. The virus was collected, purified, and adeno-associated virus AAV-miR-1a-3p was obtained. The mass ratio of the recombinant adeno-associated virus vector, the helper plasmid pHelper, and the packaging plasmid pRepCap is 1:1:

1.

6. The method for reducing abdominal fat percentage and improving feed conversion efficiency in Wenchang chickens according to claim 4, characterized in that: The injection dose mentioned in step (3) is 4 × 10 12 vg / only.

7. A method for promoting the formation of beige fat cells in Wenchang chicken, characterized in that... It includes the following steps: (1) Design and synthesize an overexpression sequence containing miR-1a-3p pre-miRNA, insert it into a lentiviral vector, and obtain a recombinant lentiviral vector; (2) The recombinant lentiviral vector constructed in step (1) is packaged to obtain recombinant lentivirus; (3) Using chicken SVF cells as the target, add induction culture medium containing the recombinant lentivirus obtained in step (2) to induce differentiation and obtain chicken beige adipocytes; The overexpression sequence described in step (1) is shown in SEQ ID NO:

4.

8. The method for promoting the generation of beige fat cells in Wenchang chickens according to claim 7, characterized in that: The virus packaging described in step (2) specifically refers to: The recombinant lentiviral vector constructed in step (1), helper plasmids psPAX2 and pMD2.G were co-transfected into 293T cells, the virus was collected, purified, and recombinant lentiviral particles were obtained. The mass ratio of the recombinant lentiviral vector, helper plasmid psPAX2, and pMD2.G is 4:3:1.

Images