A snp molecular marker related to large white pig sperm abnormality rate and application thereof

Abstract

The application belongs to the technical field of molecular biology and molecular marker, and particularly relates to a SNP molecular marker related to the abnormality rate of sperm of large white pigs and application thereof. The SNP site of the SNP molecular marker related to the abnormality rate of sperm of large white pigs corresponds to A>T mutation at 95275753bp on chromosome 3 of the international pig reference genome 11.1 version, and the polymorphism of the site base influences the abnormality rate of sperm of large white pigs. The application solves the genetic improvement problem of the abnormality rate of sperm of large white pigs by means of molecular breeding, and can increase the frequency of the advantageous allele of the above-mentioned SNP, reduce the abnormality rate of sperm of large white pigs, accelerate the genetic improvement progress of pigs, and thus effectively improve the economic benefits of pig breeding.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biotechnology and molecular marker technology, specifically relating to an SNP molecular marker related to sperm abnormality rate in Large White pigs and its application. Background Technology

[0002] The quality of boar semen is a core factor determining the economic benefits of pig farming. Continuous genetic improvement of key traits in boars through breeding techniques has become a crucial means of enhancing production efficiency and strengthening industry competitiveness. In large-scale farming systems, the reproductive performance of boars directly determines the effectiveness of artificial insemination programs and the overall reproductive efficiency of the herd. A single superior boar can inseminate hundreds or even thousands of sows, and its semen quality directly impacts conception rate, litter size, and offspring health. Therefore, semen quality, especially sperm abnormality rate, is a key reproductive trait restricting the utilization efficiency of boars and the economic benefits of pig farms.

[0003] Sperm deformity rate refers to the proportion of morphologically abnormal sperm in semen and is one of the core parameters for evaluating semen quality. Normally morphologically formed sperm possess complete acrosome, tail, and mitochondrial structures, which are prerequisites for successful sperm capacitation, penetration of cumulus cells, fertilization, and union with the egg. When the sperm deformity rate increases, abnormal sperm (such as head malformations, acrosome defects, and tail curvature) not only have reduced fertilization capacity themselves but may also interfere with the motility and capacitation of normal sperm, leading to fertilization failure or abnormal early embryonic development. Studies have shown that high sperm deformity rates are closely related to decreased sow conception rates, reduced litter sizes, and increased abortion risk. Therefore, reducing the sperm deformity rate in boars has significant economic and practical value for improving the success rate of artificial insemination, maximizing the utilization efficiency of superior genetic resources, reducing the number of boars, and lowering production costs.

[0004] Molecular marker-assisted breeding (MMR) is a technique that improves the efficiency of animal and plant breeding by screening for dominant genotypes through the detection of DNA molecular markers associated with target traits. Among these, the research and discovery of molecular markers related to sperm abnormality rate is a crucial foundation for improving the reproductive performance of boars and optimizing the genetic quality of breeding pigs. CN110452997A discloses a molecular marker related to sperm abnormality rate in Duroc boars, with its SNP site located on pig chromosome 14 and representing a C>A mutation. CN110144414A discloses a molecular genetic marker related to sperm abnormality rate in boars, with its SNP site corresponding to nucleotide 8647231 on chromosome 3 and representing a C>T mutation; this marker also focuses on the Duroc breed. CN110724745A discloses a molecular genetic marker related to sperm abnormality rate in pigs, with its SNP site corresponding to position 123567821 bp on pig chromosome 4 and representing a C>T mutation. CN116574816A discloses a molecular genetic marker related to the sperm abnormality rate in boars. The SNP site is located at position 133586233 on chromosome 1 of the pig genome. The base at this site is either A or G, and the specific pig breed is Duroc.

[0005] Currently, my country's commercial pig production mainly utilizes a breeding system centered on the Duroc × Landrace × Large White breed. Among these, the Large White pig serves as the terminal maternal breed, and its reproductive performance plays a decisive role in the production efficiency and genetic potential of its offspring. Genetic improvement of sperm abnormality rate in Large White pigs, screening for low-abnormality dominant genotypes, and developing anti- / low-abnormality rate strains through molecular marker-assisted selection or genomic selection will fundamentally improve the semen quality of boars, bringing significant economic benefits and sustainable development capabilities to pig farming enterprises. Summary of the Invention

[0006] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide an SNP molecular marker related to the sperm abnormality rate of Large White pigs.

[0007] Another object of the present invention is to provide applications of the above-mentioned SNP molecular markers.

[0008] Another object of the present invention is to provide an application of a product for detecting the above-mentioned SNP molecular markers.

[0009] The fourth objective of this invention is to provide a method for detecting sperm abnormality rate in Large White pigs.

[0010] The fifth objective of this invention is to provide a method for screening Large White pigs with low sperm deformity rates.

[0011] The sixth objective of this invention is a method for genetic improvement of Large White pigs.

[0012] The objective of this invention is achieved through the following technical solution: A SNP molecular marker associated with sperm abnormality rate in Large White pigs was identified. The SNP site corresponds to the A>T mutation at 95275753 bp on chromosome 3 of the International Pig Reference Genome Version 11.1. The polymorphism of the base at this site affects the sperm abnormality rate in Large White pigs. The sperm abnormality rates, from low to high, are: TT genotype, TA genotype, and AA genotype.

[0013] The preferred nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO:1, where M in the sequence is A or T. This SNP molecular marker affects the sperm abnormality rate of Porcine Large White pigs.

[0014] The SNP site of the SNP molecular marker is a single base mutation of nucleic acid, A109-T109, at position 109 of the sequence marked in SEQ ID NO:1, named SSC3:g.95275753 A>T (corresponding to position 95275753bp on chromosome 3 of the International Pig Reference Genome Version 11.1).

[0015] The application of the SNP molecular markers includes at least one of the following (1)-(6): (1) Identify the sperm abnormality rate of Large White pigs; (2) Prepare a product for identifying the sperm abnormality rate of Large White pigs; (3) Screening for pigs with low sperm abnormality rates; (4) Prepare products for screening pigs with low sperm abnormality rates; (5) Genetic breeding of sperm abnormality rate in Large White pigs; (6) Prepare products for genetic breeding of sperm abnormality rate trait in Large White pigs.

[0016] An application of a product for detecting SNP molecular markers associated with sperm abnormality rate in Large White pigs, said application comprising at least one of the following (1)-(6): (1) Identify the sperm abnormality rate of Large White pigs; (2) Prepare a product for identifying the sperm abnormality rate of Large White pigs; (3) Screening for pigs with low sperm abnormality rates; (4) Prepare products for screening pigs with low sperm abnormality rates; (5) Genetic breeding of sperm abnormality rate in Large White pigs; (6) Prepare products for genetic breeding of sperm abnormality rate trait in Large White pigs.

[0017] The product includes at least one of reagents, kits, chips, and testing devices.

[0018] The reagent comprises primer pairs or probes, wherein the primer pairs are used to amplify nucleic acid fragments containing the above-mentioned SNP sites, and the probes are capable of specifically recognizing and binding to the nucleic acid sequences of the above-mentioned SNP sites; probes carrying different labeling groups (e.g., fluorescent groups) can be designed to correspond to different genotypes of the above-mentioned SNP sites, thereby achieving genotyping detection.

[0019] The primer pair comprises primers primer-F and primer-R, and their nucleic acid sequences are as follows: Upstream primer-F: 5'-CAGAGCCGTCACATCCATTG-3'; Downstream primer primer-R: 5'-CCCATTTTTCCCCAGGAGATCAT-3'.

[0020] The kit contains the aforementioned primer pairs or probes; the kit also contains a reaction buffer.

[0021] The chip uses a solid-phase carrier to fix the primer pairs or probes to achieve high-throughput detection.

[0022] The aforementioned detection equipment is compatible with the detection process of the above-mentioned reagents, kits, and chips, and completes signal acquisition, genotype interpretation, and result output.

[0023] A method for detecting sperm abnormality rate in Large White pigs includes the following steps: The SNP sites of the aforementioned SNP molecular markers on chromosome 3 of Large White pigs were detected. Based on whether the single nucleotide of the SNP site was A or T, the sperm abnormality rate of Large White pigs was determined to be high or low. Among them, the sperm abnormality rate from low to high was as follows: TT genotype, TA genotype, and AA genotype.

[0024] A method for screening Large White pigs with low sperm deformity rates includes the following steps: The SNP sites of the above-mentioned SNP molecular markers on chromosome 3 of Large White pigs were detected. Individuals with the AA genotype were eliminated based on whether the single nucleotide of the SNP site was A or T, while individuals with the TT and TA genotypes were retained. Among them, the sperm abnormality rate from low to high was as follows: TT genotype, TA genotype, and AA genotype.

[0025] The detection method includes the following steps: (1) Extract genomic DNA from the pigs to be tested; (2) Using the above primer pair as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification was performed to obtain PCR amplification products; (3) Sequencing the PCR amplification products to obtain sequencing results; (4) Determine the genotype based on the sequencing results.

[0026] A method for genetically improving Large White pigs includes the following steps: The above-mentioned SNP molecular markers of breeding pigs in the core breeding pig herd were identified, and corresponding selections were made based on the SNP molecular markers: the TT and TA genotypes at chromosome 95275753bp on chromosome 3 of the International Swine Reference Genome 11.1 were selected for successive generations, and individuals with the AA genotype were eliminated, in order to increase the frequency of the T allele at this locus in each generation, thereby reducing the sperm abnormality rate of Large White pigs.

[0027] In breeding pigs, priority is given to selecting individuals with the TT genotype at chromosome 95275753bp on chromosome 3, according to the International Swine Reference Genome Version 11.1, while eliminating individuals with the TA and AA genotypes. This aims to increase the frequency of the T allele at this locus in each generation, thereby reducing the sperm abnormality rate in Large White pigs.

[0028] The application or method described is not for the purpose of disease treatment or diagnosis.

[0029] The present invention has the following advantages and effects compared with the prior art: (1) This invention takes Danish Large White pigs as the research object. Based on genome-wide association analysis and genotype filling strategies and methods, it studies and determines that the SNP molecular marker associated with the sperm abnormality rate trait of Large White pigs is located at 95275753bp on chromosome 3 of the International Pig Reference Genome Version 11.1. It is an A>T mutation. The polymorphism of the base at this SNP site is significantly associated with the sperm abnormality rate trait of pigs.

[0030] (2) Based on the above-mentioned SNP molecular markers, this invention provides a product for detecting the above-mentioned SNP molecular markers, including primer pairs and kits. Based on the SNP molecular markers, primer pairs and kits, this invention can identify traits related to sperm abnormality rate in Large White pigs, screen Large White pigs with low sperm abnormality rate, or use it for genetic breeding of Large White pigs with corresponding sperm abnormality rate traits. It also provides specific methods for detecting Large White pig sperm abnormality rate traits, specific methods for screening Large White pigs with low sperm abnormality rate, and specific methods for genetic improvement of Large White pigs. This invention establishes a set of efficient and accurate molecular marker-assisted breeding technology (corresponding to the above-mentioned complete set of products and methods). Applying it to the genetic improvement of pig sperm abnormality rate traits can reduce the sperm abnormality rate of Large White pigs, increase enterprise profits, and enhance core competitiveness.

[0031] (3) This invention uses molecular breeding to solve the problem of genetic improvement of sperm abnormality rate in Large White pigs. By selecting the superior alleles of the above-mentioned SNPs, the frequency of superior alleles can be increased generation by generation, reducing sperm abnormality rate in Large White pigs, accelerating the progress of pig genetic improvement, and thus effectively improving the economic benefits of breeding pigs. Attached Figure Description

[0032] Figure 1 This is a genome-wide association study (GWAS) diagram of the sperm abnormality rate trait on chromosome 3 of large white pigs; where: the horizontal axis represents the chromosome number of the pig; the vertical axis represents -log 10 ( P -value).

[0033] Figure 2 This is a graph showing the sperm abnormality rate analysis of different genotypes of Large White pigs; where, ***: p<0.001. Detailed Implementation

[0034] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0035] Example 1 provides a detailed explanation of the process for determining the sperm abnormality rate trait in Large White pigs as described in this invention. (1) Experimental animals Experimental pig herd: The experimental pig herd used in this invention consisted of the core breeding stock of a certain breeding farm, totaling 550 Danish Large White boars. The pigs had free access to feed and water, and the feeding method and rearing conditions remained consistent throughout, following conventional methods.

[0036] (2) Phenotypic trait determination This invention focuses on the sperm abnormality rate phenotype of boars. The measurement method is as follows: ① Select boars around 15 months old and collect semen every 7 days on average using conventional methods. The collection time is in the morning, and obtain multiple semen collection records for each boar at different time points.

[0037] ② After semen collection, the sperm abnormality rate was detected using the IMV CASA sperm analyzer. This instrument uses a sperm quality assessment system (CASA) to identify abnormal sperm through staining or high-resolution imaging, including sperm tail breakage, protoplasmic spots, and sperm head abnormalities (large heads), and can directly obtain the sperm abnormality rate index.

[0038] ③ A total of 33,979 semen collection records were collected from 550 Danish Large White boars, with an average of 61.78 records per boar. The final phenotypic data was obtained by weighted averaging of the sperm deformity rate data collected from each boar, using the following formula: Deformity rate = Σ[ (arithmetic mean of deformity rate observations in month i) × (number of semen collections in month i) ] / total number of semen collections.

[0039] (3) Sample collection Ear tissue samples from the above-mentioned pig herds were collected, soaked in a 75% ethanol solution, and stored at -20°C for later use.

[0040] Example 2 provides a detailed explanation of the invention process of the gene marker in this invention. (1) Extraction of DNA from pig ear-like tissue Genome DNA was extracted from the experimental pig herd in Example 1 using the standard phenol-chloroform method. The quality and concentration of the genome DNA from these pigs were determined using a Nanodrop-ND1000 spectrophotometer. A 260 / 280 ratio of 1.8-2.0 and an A260 / 230 ratio of 1.7-1.9 were considered acceptable. Finally, the acceptable DNA samples were uniformly diluted to 50 ng / μL.

[0041] (2) Pig whole genome genotyping and filling ① 50K SNP genotyping of the whole pig genome The whole genome DNA sample extracted in step (1) was sent to Beijing Compson Biotechnology Co., Ltd. Based on the SMIC 1 50K SNP genotyping platform, the chip hybridization and result scanning (i.e. genotype determination) were performed using the Illumina Infinium user manual and standard procedures. Finally, the genotype data was read using GenomeStudio software.

[0042] ②Quality control The genotype data obtained in step ① were quality controlled using PLINK v1.90 software, with a rejection rate <95%, a mimor allel frequency (MAF) <5%, or a deviation from Hardy-Weinberg Equilibrium (HWE). P ≤10 -6 The SNP markers were excluded, with a detection rate of <95%.

[0043] ③ Filling in missing genotypes in pigs Using 2259 individuals from the public database (https: / / swim.scau.pigselection.com / swim / # / home) as the reference population, the SNPs microarray data of the above-mentioned Large White pigs (50K) were filled into whole genome sequencing data based on the reference haplotype library using Beagle 5.5 software.

[0044] ④ Quality control The genotype-filled data obtained in step ③ underwent further quality control, using the same methods as in step (2) ②. Ultimately, 550 individuals and 15,262,981 SNPs were retained for subsequent analysis.

[0045] (3) Genome-wide association analysis (GWAS) This invention uses a mixed linear model (MLM) in GCTA software to perform GWAS analysis on the porcine sperm abnormality rate trait. The model is as follows:

[0046] in, For an individual's phenotypic vector; For fixed effect size, This is the fixed effects matrix; It is a genotype effect vector. Genotype matrix; It is a vector of random effects. This is the random effects matrix; It is the residual vector.

[0047] The specific analysis method is as follows: ① Using the genotype data obtained in step (2) as the object, the kinship matrix (GRM) of the experimental population was calculated using the --make-grm function of the GCTA software. The GRM, as the random effects covariance matrix in the mixed model, mainly plays the role of "true genetic similarity" between samples and is used to control the bias caused by population structure and implicit kinship.

[0048] ②Then add the genotype and phenotypic data to the model and use --mlma to perform genome-wide association analysis.

[0049] ③This invention references the significance threshold of the human genome, with a genome-wide significance threshold of 5.00 × 10⁻⁶. -8 The significance threshold at the chromosome level is 1.00 × 10⁻⁶. -6 .

[0050] GWAS analysis results are as follows Figure 1 As shown. From Figure 1 It is known that there are sites on chromosome 3 of pigs that significantly affect the sperm abnormality rate of Large White pigs. The most strongly associated SNP site corresponds to the A>T mutation at position 95275753 bp on chromosome 3 of the International Pig Reference Genome Version 11.1 (a single-base mutation of A109-T109 at position 109 of SEQ ID NO:1, named SSC3:g.95275753 A>T). P =2.19×10 -7 ).

[0051] (4) Association analysis between different genotypes and sperm abnormality rate phenotype in Large White pigs according to Figure 1 As shown in Table 1, the SNP site SSC3:g.95275753 A>T of the molecular marker was significantly correlated with the sperm abnormality rate trait.P =2.19×10 -7 This indicates that this molecular marker significantly affects the sperm abnormality rate trait in Large White pigs. Assisted selection at this SNP site can reduce the sperm abnormality rate in Large White pigs, thereby accelerating the breeding process for this trait. Furthermore, according to Table 1... Figure 2 It is also known that the TT genotype has the lowest sperm abnormality rate, the TA genotype has a higher rate, and the AA genotype has the highest rate, indicating that the AA genotype is the most detrimental to sperm abnormality in Large White pigs. Therefore, in the breeding process, it is necessary to gradually eliminate AA genotype breeding pigs and retain TT and TA genotype breeding pigs to increase the frequency of the T allele at this locus in each generation, thereby reducing the sperm abnormality rate in Large White pigs.

[0052] Table 1. Correlation between molecular marker site SSC3:g.95275753 A>T and sperm abnormality rate in Large White pigs.

[0053] Note: A total of 550 individuals were used for the analysis. Different lowercase letters in the superscript of peer data indicate significant differences. P <0.001), the same letter or no letter indicates that the difference is not significant.

[0054] Example 3 explains in detail the invention process of detecting SNP markers according to the present invention. (1) The target fragment containing SNP sites that are significantly associated with sperm abnormality rate in Large White pigs is a 192bp nucleotide sequence from chromosome 3 (SEQ ID NO:1). The upstream and downstream primers for sequence amplification are primer-F and primer-R, and their nucleic acid sequences are as follows: Upstream primer-F: 5'-CAGAGCCGTCACATCCATTG-3'; Downstream primer primer-R: 5'-CCCATTTTTCCCCAGGAGATCAT-3'.

[0055] (2) PCR amplification system and conditions Prepare a 10 μL system, including 1.0 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O. The PCR reaction program is as follows: 95°C for 3 min; 95°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0056] (3) DNA sequence sequencing identification Sequencing was performed at BGI Genomics Co., Ltd. in Shenzhen, with two sequencing reactions (forward and reverse). The obtained sequences were compared with the NCBI genome sequence to identify mutations at corresponding SNP sites. The sequencing results are shown below: CAGAGCCGTCACATCCATTG CCCCCTTCTCCTATACCTCCCCTCCCCACAAAAATGTACGAAGGCTGGATATGAAGGCAAGTAAATGCAGAAATGGAGGCTCCCM(A / T)GGGTTAGGAAATGTGAAAGAACTGAGGTAACAACGGGGACAAAGGGCAGGTTCTTTAGAA ATGATCTCCTGGGGAAAAATGGG Note: M marked in the sequence is the mutation site (the mutated base in parentheses is the allele mutation), and the underline at the beginning and end of the sequence indicates the primer binding position.

[0057] Example 4: SNP site analysis of molecular marker SSC3:g.95275753 A>T effect. This invention provides a SNP molecular marker that can significantly reduce sperm abnormality rate in Large White pigs. Using this SNP molecular marker for marker-assisted selection can significantly improve the reproductive performance of boars. Calculations show that in this experimental population, when this SNP locus is the dominant allele (e.g., selected from AA type to TT or TA type), the sperm abnormality rate can be reduced by an average of 17.25% or 7.10%. If this invention selects all AA type individuals, which are affected by molecular markers affecting semen volume traits, to become TT or TA type individuals, the sperm abnormality rate in boars can be significantly reduced, and semen quality improved. Therefore, this SNP molecular marker has great potential in improving the sperm production performance of boars and increasing the profitability of the pig farming industry.

[0058] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of a product for detecting SNP molecular markers associated with sperm abnormality rate in Large White pigs, characterized in that... The application includes at least one of the following (1)-(6): (1) Identify the sperm abnormality rate of Large White pigs; (2) Prepare a product for identifying the sperm abnormality rate of Large White pigs; (3) Screening for pigs with low sperm abnormality rates; (4) Prepare products for screening pigs with low sperm abnormality rates; (5) Genetic breeding of sperm abnormality rate in Large White pigs; (6) Prepare products for genetic breeding of sperm abnormality rate trait in Large White pigs; The SNP molecular markers mentioned above correspond to the A>T mutation at 95275753 bp on chromosome 3 of the International Swine Reference Genome Version 11.

1. The polymorphism of the base at this site affects the sperm abnormality rate of Large White pigs. Among them, the sperm abnormality rate from low to high is as follows: TT genotype, TA genotype and AA genotype. The application described is for purposes other than disease treatment or diagnosis; The large white pig mentioned is the Danish Large White breed.

2. The application according to claim 1, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO:1, where M in the sequence is A or T.

3. The application according to claim 1, characterized in that: The product contains at least one of reagents and kits.

4. The application according to claim 3, characterized in that: The reagents described include primer pairs or probes; The primer pair comprises primers primer-F and primer-R, and their nucleic acid sequences are as follows: Upstream primer-F: 5'-CAGAGCCGTCACATCCATTG-3'; Downstream primer primer-R: 5'-CCCATTTTTCCCCAGGAGATCAT-3'.

5. The application according to claim 3, characterized in that: The kit contains primer pairs or probes; The primer pair comprises primers primer-F and primer-R, and their nucleic acid sequences are as follows: Upstream primer-F: 5'-CAGAGCCGTCACATCCATTG-3'; Downstream primer primer-R: 5'-CCCATTTTTCCCCAGGAGATCAT-3'.

6. The application according to claim 5, characterized in that: The kit also includes a reaction buffer.

7. A method for detecting sperm abnormality rate in Large White pigs, characterized in that... It includes the following steps: The SNP sites of the SNP molecular markers described in claim 1 on chromosome 3 of Large White pigs are detected, and the sperm abnormality rate of Large White pigs is determined to be high or low based on whether the single nucleotide of the SNP site is A or T; wherein, the sperm abnormality rate from low to high is as follows: TT genotype, TA genotype and AA genotype; The method described is not for disease treatment or diagnosis purposes; The large white pig mentioned is the Danish Large White breed.

8. A method for screening Large White pigs with low sperm deformity rates, characterized in that... It includes the following steps: The SNP sites of the SNP molecular markers described in claim 1 on chromosome 3 of Large White pigs were detected. Based on whether the single nucleotide of the SNP site was A or T, individuals with the AA genotype were eliminated, while individuals with the TT and TA genotypes were retained. The sperm abnormality rate, from low to high, was as follows: TT genotype, TA genotype, and AA genotype. The method described is not for disease treatment or diagnosis purposes; The large white pig mentioned is the Danish Large White breed.

9. The method according to claim 7 or 8, characterized in that: The detection method includes the following steps: (1) Extract genomic DNA from the pigs to be tested; (2) Using primer pairs as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification was performed to obtain PCR amplification products; (3) Sequencing the PCR amplification products to obtain sequencing results; (4) Determine the genotype based on the sequencing results; The primer pair comprises primers primer-F and primer-R, and their nucleic acid sequences are as follows: Upstream primer-F: 5'-CAGAGCCGTCACATCCATTG-3'; Downstream primer primer-R: 5'-CCCATTTTTCCCCAGGAGATCAT-3'.

10. A method for genetic improvement of Large White pigs, characterized in that... It includes the following steps: Identify the SNP molecular markers as described in claim 1 for breeding pigs in the core breeding pig herd, and make corresponding selections based on the SNP molecular markers: select individuals with TT and TA genotypes at chromosome 95275753bp on chromosome 3 of the International Swine Reference Genome 11.1 for successive generations, and eliminate individuals with AA genotypes, so as to increase the frequency of allele T at this locus in each generation, thereby reducing the sperm abnormality rate of Large White pigs; The method described is not for disease treatment or diagnosis purposes; The large white pig mentioned is the Danish Large White breed.

Images