Compositions and methods for treating type 2 inflammatory diseases
Patent Information
- Application Number
- CN202580013812.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-09-29
- Filing Date
- 2025-02-07
- Publication Date
- 2026-09-22
AI Technical Summary
The existing traditional treatments have limited effects on type 2 inflammatory diseases such as asthma and atopic dermatitis, and have significant side effects in long-term use, and need to develop more accurate, more targeted and fewer side effects.
By combining polynucleotide molecules targeting specific genes with antibodies specifically targeting disease cell surface markers, antibody-conjugated polynucleotide technology is formed to achieve high specific targeting and treatment of specific pathological cells, using the highly specific recognition ability of antibodies and the gene silencing function of polynucleotides to improve the selectivity and efficiency of therapeutic agents.
It has achieved precise treatment of type 2 inflammatory diseases, reduced the impact on normal cells, reduced side effects, improved the accuracy and safety of treatment, supported the development of personalized medicine, and had wide application potential.
Smart Images

Figure CN122803857A_ABST
Abstract
Description
Compositions and methods for treating type 2 inflammatory diseases Join by reference This application claims priority to Chinese application No. 202410177736.X filed on February 8, 2024 and Chinese application No. 202411377164.6 filed on September 29, 2024. All publications, patents, and patent applications cited in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application were specifically set forth and individually incorporated herein by reference in its entirety. Technical Field The present disclosure belongs to the field of medical technology, and specifically relates to an innovative antibody-coupled polynucleotide technology, providing a novel treatment method for treating type 2 inflammatory diseases. Background Art Type 2 inflammatory diseases involve Th2 cell-mediated responses, in which increased levels of IL-4 and IL-13 play a central role in the pathological process. These diseases, including asthma, atopic dermatitis, and chronic obstructive pulmonary disease, are characterized by inflammatory responses and abnormal activation of the immune system. IL-4 and IL-13 bind to the IL-4Rα co-receptor, triggering a series of immune responses, leading to the recruitment and activation of inflammatory cells and the release of inflammatory mediators. These cytokines not only promote the differentiation and maintenance of Th2 cells but also influence B cells, prompting them to produce IgE, further exacerbating allergic reactions and inflammation. Therefore, regulation of type 2 immune responses is crucial for the treatment of these diseases. Traditional treatments are mainly aimed at symptom management and reducing inflammation. For type 2 inflammatory diseases, such as asthma and atopic dermatitis, treatment usually includes corticosteroids, antihistamines, bronchodilators and immunomodulators. Corticosteroids are intended to suppress inflammatory responses, while antihistamines are used to relieve allergic reactions. Bronchodilators are particularly effective for asthma patients to help relieve breathing difficulties. Immunomodulators, such as cyclosporine and biologics (antibodies targeting specific inflammatory pathways), are used to regulate the immune system response and reduce the activity of inflammatory cells and mediators. Although these treatments play a role in controlling symptoms and improving quality of life, they are often accompanied by side effects of long-term use, including immunosuppression and endocrine disorders. In addition, they usually cannot fundamentally resolve overactive Th2-mediated immune responses and have limited effectiveness for some patients. Therefore, the development of more precise, targeted and less side-effect-prone treatment strategies has become a research focus. Advances in antibody therapy have revolutionized the management of type 2 inflammatory diseases, particularly through strategies targeting key immune regulators such as IL-4 and IL-13 and their receptor, IL-4Rα. This approach leverages the high specificity of monoclonal antibodies to directly target the molecular mechanisms of disease, thereby reducing inflammation and modulating immune responses. Monoclonal antibodies, such as those targeting IL-5 / IL-5Rα, IgE, and IL-4Rα, have demonstrated significant clinical efficacy, offering new options for patients refractory to traditional treatments (Patel et al., 2018). Dupilumab, an antibody targeting IL-4Rα, has been approved for the treatment of atopic dermatitis, significantly improving clinical symptoms by blocking the effects of IL-4 and IL-13 (Tubau & Puig, 2021). Furthermore, the potential for paradoxical skin reactions associated with these targeted antibody therapies has also received attention, necessitating further research to optimize treatment options and management strategies (Murphy et al., 2020). With a deeper understanding of disease mechanisms, antibody-based therapies offer a more precise and personalized treatment option, particularly for patients refractory to traditional therapies. However, despite significant progress, monoclonal antibody therapies still face challenges with limited selectivity and penetration, particularly when targeting intracellular signaling pathways. This challenge has prompted scientists to explore more innovative approaches, such as antibody-conjugated siRNA technology, in order to achieve deeper therapeutic effects. Antibody-conjugated siRNA (small interfering RNA) technology represents a groundbreaking drug development platform that combines the specificity of targeted therapies with the powerful silencing effect of RNA interference (RNAi), offering new possibilities for treating a wide range of diseases. By directly conjugating small interfering RNA (siRNA) molecules to antibodies that precisely recognize surface markers of diseased cells, this technology enables highly specific targeting and treatment of diseased cells while minimizing effects on normal cells. In practical applications, antibody-conjugated siRNA technology has demonstrated therapeutic potential for a variety of cancers and inflammatory diseases. For example, the combination of an antibody targeting CD22 and siRNA to form a complex effectively targets B-cell lymphoma, specifically reducing the expression of key genes in diseased cells and thereby inhibiting tumor growth and spread (Palanca-Wessels et al., 2011). Furthermore, cetuximab conjugated to an siRNA targeting the KRAS G12C mutation has demonstrated the potential to improve therapeutic efficacy by precisely modulating gene expression in specific non-small cell lung cancer cells (Sreedurgalakshmi et al., 2021). The advantage of antibody-conjugated siRNA technology lies in its ability to combine the highly specific recognition capabilities of antibodies with the effective gene silencing function of siRNA. This integration not only improves the selectivity of therapeutic agents, reduces side effects, but also enhances therapeutic efficacy. Although the technology is still under development, its contribution to precision medicine is already beginning to emerge, particularly in targeting difficult-to-treat diseases and reducing treatment-related side effects. In the future, with further optimization of the technology and in-depth clinical trials, antibody-conjugated siRNA technology is expected to become the standard of care for a variety of diseases, especially when traditional treatments are ineffective or insufficient. The development of this technology will not only promote the development of new therapies but also help promote personalized medicine, providing patients with safer and more effective treatment options. Summary of the Invention The inventors unexpectedly discovered during their research that IL-4R antibodies can mediate cellular endocytosis after binding to IL-4R, and transport the substances they carry (such as polynucleotides) into the cells to exert their effects. Based on this, the present invention was completed. This disclosure relates to a novel antibody-polynucleotide conjugated technology. This technology combines polynucleotide molecules targeting specific genes with antibodies specifically targeting disease cell surface markers, enabling highly specific targeting and treatment of specific pathological cells. The core of this technology is the combination of the highly specific recognition capabilities of antibodies with the gene silencing capabilities of polynucleotides, thereby improving the selectivity and efficacy of therapeutic agents while minimizing the impact on normal cells. The disclosed antibody-coupled polynucleotide technology, as a revolutionary treatment method, has the following significant advantages: High specificity and accuracy: By combining polynucleotides targeting specific genes with specific antibodies, the present disclosure can ensure that therapeutic agents are directly targeted to disease-related cells, reducing the impact on surrounding normal cells, thereby greatly improving the accuracy and safety of treatment. Effective gene silencing: Polynucleotide molecules targeting specific genes can specifically bind to and silence the expression of target genes. This mechanism can regulate the disease process at the molecular level, providing a more direct and effective means of treatment. Reduced side effects and improved tolerance: Due to its high specificity, the present disclosure can reduce the side effects common in traditional treatment methods and improve patients' treatment tolerance and quality of life. Wide application potential: Although currently mainly used in type 2 inflammatory diseases, the principles of this technology can be extended to many other diseases, such as cancer, autoimmune diseases, etc., and has broad application prospects. Promoting the development of personalized medicine: This disclosure supports customized treatment strategies based on individual pathological characteristics, providing the possibility of achieving more precise personalized medicine. Due to its unique therapeutic mechanism and advantages, the present disclosure has broad application potential in the future medical field: Revolutionizing the Treatment of Type 2 Inflammatory Diseases: As a new approach to treating diseases such as asthma, atopic dermatitis, allergic rhinitis, and chronic sinusitis with nasal polyps, the present disclosure is expected to significantly improve treatment outcomes, especially for patients who are refractory to traditional treatments. Promoting the development of precision medicine: By precisely intervening in the molecular mechanisms of disease, this disclosure supports more accurate treatment decisions and provides new impetus for the development of precision medicine. Potentially broad medical applications: In addition to type 2 inflammatory diseases, this technology can also be used to treat other diseases related to dysregulated gene expression, such as cancer and genetic diseases, and has extremely broad application prospects. Future research and development: With in-depth research and optimization of this technology, more innovative treatments are expected to emerge, promoting progress in medicine and biotechnology. In one aspect of the present invention, an antibody-nucleotide conjugate is provided, characterized in that the antibody-nucleotide conjugate is formed by conjugating (i) a polynucleotide ligand and (iii) a target protein binding portion via (ii) a linker. In some embodiments, the polynucleotide ligand comprises double-stranded RNA. In some embodiments, the polynucleotide ligand comprises one or more of siRNA, ASO, PMO, mRNA, dsRNA, miRNA, and shRNA; preferably, the polynucleotide ligand comprises one or more of ASO and siRNA. In some embodiments, the polynucleotide targeting a specific gene can target one or more genes selected from genes encoding the interleukin cell family (including but not limited to IL-4Rα, IL13Ra1, CD132), genes encoding the JAK kinase protein family (including but not limited to JAK1 / JAK2 / JAK3 kinases), genes encoding the STAT factor family (including but not limited to STAT1, STAT2, STAT3, STAT4, STAT5A, STAT5B, STAT6 factors), and genes encoding the janus kinase protein family (including but not limited to TYK genes). In some embodiments, the polynucleotide ligand comprises double-stranded RNA, including the sense strand. In some embodiments, the polynucleotide ligand comprises double-stranded RNA, including an antisense strand. In some embodiments, each chain of the polynucleotide ligand is 15-25 nucleotides in length; preferably, each chain of the siRNA is 19-23 nucleotides in length. In some embodiments, the polynucleotide ligand comprises an antisense strand that is 19 to 23 nucleotides in length. In some embodiments, the polynucleotide ligand comprises a sense strand that is 19 to 23 nucleotides in length. In some embodiments, the polynucleotide ligand comprises a 3'-overhang sequence that is one or more nucleotides in length, wherein the 3'-overhang sequence is present on the antisense strand and / or the sense strand. In some embodiments, the antisense strand has an overhang. In some embodiments, the sense strand has an overhang. In some embodiments, the polynucleotide ligand comprises a 3'-overhang sequence that is two nucleotides in length. In some embodiments, the 3'-overhang sequence is present on the sense strand; preferably, the overhang sequence is selected from the group consisting of: GG, GA, GC, UC, UG, UU, UA, CA, CC, CG, CU, AA, AG, AU, and AC. In some embodiments, the 3'-overhang sequence is present on the antisense strand; preferably, the overhang sequence is selected from the group consisting of: UU, UC, UA, UG, GA, GG, GU, GC, TT, AG, AU, AA, AC, CA, CC and U; more preferably, the overhang sequence is UU. In some embodiments, the polynucleotide ligand comprises an antisense strand and a sense strand each ranging from 19 to 23 nucleotides in length. In some embodiments, the sense strand and the antisense strand of the polynucleotide ligand form a duplex region. In some embodiments, the sense strand and the antisense strand of the polynucleotide ligand are duplex structures with 19 / 21 pairing, 21 / 21 pairing, 21 / 23 pairing, or 23 / 23 pairing, respectively. In some embodiments, the polynucleotide ligand comprises a 3'-overhang sequence that is two nucleotides in length, wherein the 3'-overhang sequence is present on the antisense strand, and wherein the sense strand is 19 nucleotides in length and the antisense strand is 21 nucleotides in length, such that the sense strand and the antisense strand form a duplex portion that is 19 nucleotides in length. In some embodiments, the polynucleotide ligand comprises a 3'-overhang sequence that is two nucleotides in length, wherein the 3'-overhang sequence is present on the antisense strand and the sense strand, and wherein the sense strand is 21 nucleotides in length and the antisense strand is 21 nucleotides in length, such that the sense strand and the antisense strand form a duplex portion that is 19 nucleotides in length. In some embodiments, the polynucleotide ligand comprises a 3'-overhang sequence that is two nucleotides in length, wherein the 3'-overhang sequence is present on the antisense strand, and wherein the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length, such that the sense strand and the antisense strand form a duplex portion that is 21 nucleotides in length. In some embodiments, the polynucleotide ligand comprises a 3'-overhang sequence that is two nucleotides in length, wherein the 3'-overhang sequence is present on the antisense strand and the sense strand, and wherein the sense strand is 23 nucleotides in length and the antisense strand is 23 nucleotides in length, such that the sense strand and the antisense strand form a duplex portion that is 21 nucleotides in length. In some embodiments, the polynucleotide ligand further has the following modification features to improve its stability and reduce non-specific reactions: Nucleotide analogs or artificial nucleotide bases undergo a series of modifications at the 2' hydroxyl group of the ribose moiety, including but not limited to H, OR, R, halogen, SH, SR, NH2, NHR, NR2 or CN, wherein R represents a group moiety; examples of the group moiety include halogen, sulfur, thiol, thioether, thioester, amine (primary, secondary or tertiary amine), amide, ether, ester, alcohol and oxygen; further, the group moiety may be further modified, including but not limited to azo group, ketone group, aldehyde group, carboxyl group, nitro group, nitroso group, nitrile group, heterocyclic group (such as imidazole, hydrazine or hydroxyamino) group, isocyanate or cyanate group, and sulfur-containing groups (such as sulfoxide, sulfone, sulfide and disulfide); Preferably, the modification at the specific 2'hydroxyl group includes a 2'-O-methyl modification or a 2'-O-methoxyethyl (2'O-MOE) modification, and a 2'-O-aminopropyl modification, wherein the 2'-O-aminopropyl modification combines the amine group with the 2' oxygen through the extended amine group of the propyl linker, thereby neutralizing the total negative charge derived from the phosphate of the oligonucleotide molecule by introducing a positive charge; further, the modification also includes locked nucleic acid (LNA) and ethylene nucleic acid (ENA), which enhance the structural stability of the nucleotide by bridging or locking. Furthermore, nucleotide analogs also include modified bases, such as 5-propynyluridine and 5-propynylcytidine, as well as modifications of sugar moieties, such as mannose, arabinose, and other sugars based on or replacing ribose. In some embodiments, the design of the polynucleic acid molecule also involves modifications of the internucleotide linkages, such as phosphorothioate and methylphosphonate, as well as special modifications at the 3' or 5' termini, to further enhance the stability of the siRNA and reduce nonspecific activity. In some embodiments, the polynucleotide ligand comprises at least one modified nucleotide. In some embodiments, the modification is a modification selected from the group consisting of a 2'-methoxy (m) modification, a 2'-fluoro (f) modification, and a phosphorothioate (s) modification. In some embodiments, the modified nucleotide comprises a 2'-modification. In some embodiments, the 2'-modification is a modification selected from the group consisting of a 2'-aminoethyl modification, a 2'-fluoro modification, a 2'-O-methyl modification, a 2'-O-methoxyethyl modification, and a 2'-deoxy-2'-fluoro-β-d-arabinonucleotide modification. In some embodiments, all nucleotides of the polynucleotide ligand are modified. In some embodiments, the polynucleotide ligand comprises at least one modified internucleotide linkage. In some embodiments, the at least one modified internucleotide linkage is a phosphorothioate linkage. In some embodiments, the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand comprises a phosphate analog. In some embodiments, the phosphate analog is oxymethylphosphonate, vinylphosphonate, or malonylphosphonate. In some embodiments, at least one nucleotide of the polynucleotide ligand is conjugated to one or more targeting ligands. In some embodiments, each targeting ligand comprises a carbohydrate, an amino sugar, cholesterol, a polypeptide, or a lipid. In some embodiments, each targeting ligand comprises an N-acetylgalactosamine (GalNAc) moiety. In some embodiments, the GalNAc moiety is a monovalent GalNAc moiety, a divalent GalNAc moiety, a trivalent GalNAc moiety, or a tetravalent GalNAc moiety. In some embodiments, the siRNA comprises any one or more nucleotide sequences selected from Table 2, Table 3, or Table 4 of the specification. In some embodiments, the target protein binding portion includes an antibody or variant thereof or an antigen-binding fragment thereof that specifically binds to the target protein; wherein the antibody or variant thereof or antigen-binding fragment thereof includes but is not limited to: IgG-scFv, nanobody, BiTE, diabody, DART, TandAb, scDiabody, scDiabody-CH, triabody, minibody, minibody, TriBi minibody, scFv-CH3 KIH, Fab-scFv-Fc KIH, Fab-scFv, scFy-CH-CL-scFv, F(ab')2, F(ab')2-scFv2, scFv-KIH, Fab-scFy-Fc, tetravalent HCAb, scDiabody-Fc, diabody-FC, tandem scFv-Fc or intrabody. In some embodiments, the target protein binding portion includes an antibody or variant thereof or an antigen-binding fragment thereof that specifically binds to a human target protein. In some embodiments, the target protein binding portion includes an antibody or variant thereof or an antigen-binding fragment thereof that specifically binds to human IL-4Rα. In some embodiments, the DT3C method is used to detect the endocytic activity of IL-4Rα antibody in HEK293-IL-4R stably transfected cells, and the IC 50 The value is no greater than 100 nM, 50 nM, 10 nM, 5 nM, 4 nM, 3 nM, 2 nM, 1 nM, 0.5 nM, 0.3 nM, 0.2 nM or 0.1 nM. In some embodiments, the binding affinity of an IL-4Rα antibody or fragment thereof (e.g., scFv or VHH) to a human IL-4R protein is determined using surface plasmon resonance, and the KD value of the IL-4Rα antibody or fragment thereof is no greater than 20 nM, 15 nM, 10 nM, 5 nM, 1 nM, 0.5 nM, 0.4 nM, 0.3 nM, 0.2 nM, 0.1 nM, 0.05 nM, 0.03 nM, 0.02 nM, 0.01 nM, 0.005 nM, 0.004 nM, 0.003 nM, 0.002 nM, or 0.001 nM. Studies have shown that after IL-4 binds to the IL-4R as a ligand, the IL-4R can mediate cellular endocytosis. Antibody molecules differ significantly from IL-4 molecules in size and structure, so it is unknown whether antibody binding to the IL-4R can still lead to cellular endocytosis. The inventors of this application unexpectedly discovered in their research that IL-4R antibodies can mediate cellular endocytosis after binding to the IL-4R, and transport the substances they carry (e.g., polynucleotides) into the cell to exert their effects. In some embodiments, the antibody or variant thereof or antigen-binding fragment thereof that specifically binds to human IL-4Rα includes but is not limited to: dupilumab, AK120, CPB-201, MG-K10, AMG132, SHR-1819; preferably dupilumab. In some embodiments, the target protein binding portion comprises a heavy chain CDR selected from the group consisting of amino acid sequences of SEQ ID NOs: 65-67, and a light chain CDR selected from the group consisting of amino acid sequences of SEQ ID NOs: 68-70. In some embodiments, the target protein binding portion comprises a heavy chain CDR1 shown in the amino acid sequence of SEQ ID NO: 65, a heavy chain CDR2 shown in the amino acid sequence of SEQ ID NO: 66, and a heavy chain CDR3 shown in the amino acid sequence of SEQ ID NO: 67; and a light chain CDR1 shown in the amino acid sequence of SEQ ID NO: 68, a light chain CDR2 shown in the amino acid sequence of SEQ ID NO: 69, and a light chain CDR3 shown in the amino acid sequence of SEQ ID NO: 70. In some embodiments, the target protein binding portion comprises a heavy chain variable region selected from the amino acid sequences of SEQ ID NOs: 71 and 72, and a light chain variable region selected from the amino acid sequence of SEQ ID NO: 73. In some embodiments, the target protein binding portion comprises a heavy chain variable region represented by the amino acid sequence of SEQ ID NO: 71, and a light chain variable region represented by the amino acid sequence of SEQ ID NO: 73. In some embodiments, the target protein binding portion comprises a heavy chain variable region represented by the amino acid sequence of SEQ ID NO: 72, and a light chain variable region represented by the amino acid sequence of SEQ ID NO: 73. In some embodiments, the target protein binding portion comprises a heavy chain having an amino acid sequence as shown in SEQ ID NO:74, and a light chain having an amino acid sequence as shown in SEQ ID NO:75. In some embodiments, the polynucleic acid molecule conjugate comprises a linker that connects the target protein binding moiety to the polynucleic acid ligand. In some embodiments, the linker is coupled to the 3' end or the 5' end of the sense strand. In some embodiments, the linker is coupled to the 3' end or the 5' end of the antisense strand. In some embodiments, the linker is a cleavable linker or a non-cleavable linker. In some embodiments, the linker is a non-polymeric linker. A non-polymeric linker refers to a linker that does not contain monomeric repeating units generated by a polymerization process. Exemplary non-polymeric linkers include, but are not limited to, C1-C6 alkyls (e.g., C5, C4, C3, C2, or C1 alkyls), homobifunctional crosslinkers, heterobifunctional crosslinkers, peptide linkers, traceless linkers, self-immolative linkers, maleimide-based linkers, or combinations thereof. In some embodiments, the linker is a homobifunctional linker or a heterobifunctional linker. In some embodiments, the linker is a maleimide group. Preferably, the maleimide group further comprises hexanoic acid to form maleimidocaproyl (mc). Preferably, the linker comprises maleimidocaproyl (mc). Preferably, the linker is maleimidocaproyl (mc). Preferably, the maleimide group comprises a maleimidomethyl group, such as succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC) or sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo-SMCC) as described above. In some embodiments, the linker is a peptide moiety. Preferably, the peptide moiety comprises at least 2, 3, 4, 5, or 6 or more amino acid residues. More preferably, the linker is Val-Cit. In some embodiments, the linker comprises a benzoic acid group or a derivative thereof. In some embodiments, the linker comprises a polyethylene glycol-based linker. In some embodiments, the linker comprises an isothiocyanate linker. Preferably, the isothiocyanate linker is selected from one or more of SMPB, LC-SMCC, and SMCC; more preferably, the isothiocyanate linker is selected from succinimidyl (4-(N-maleimidomethyl)cyclohexane-1-carboxylate) (SMCC)-C6. In some embodiments, the linker has the structure shown in L-4: Among them, the wavy line The position indicates the location of attachment to the polynucleotide ligand or target protein binding portion. In some embodiments, the antibody nucleotide conjugate linker has a structure as shown in the examples of the present invention. The present invention further provides a pharmaceutical composition, characterized in that the pharmaceutical composition comprises any of the aforementioned antibody-nucleotide conjugates, and optionally, the pharmaceutical composition further comprises any pharmaceutically acceptable carrier. Another aspect of the present invention provides a method for treating type 2 inflammatory diseases in a subject in need thereof, characterized in that the method comprises administering to the subject a therapeutically effective amount of the antibody-nucleotide conjugate of the present invention or a pharmaceutical composition comprising the antibody-nucleotide conjugate. In some embodiments, the type 2 inflammatory disease is selected from the group consisting of chronic sinusitis, asthma, atopic dermatitis, allergic rhinitis, chronic sinusitis with nasal polyps, and the like. In some embodiments, the polynucleotide ligand is a specific double-stranded RNA, specifically siRNA, and the IL-4Rα antibody is an antibody specifically targeting IL-4Rα. The antibody is coupled to the siRNA via a linker to form an antibody-polynucleotide ligand complex. Furthermore, the formation of the complex involves precise coupling between the antibody and the siRNA, wherein the coupling technology uses a specific linker to achieve the connection between the antibody and the polynucleotide molecule; wherein the coupling site involves one or more specific sites of the antibody, such as a cysteine residue or a lysine residue, and the 5' end or the 3' end of the antisense chain of the siRNA. In some embodiments, the DAR value (Drug-to-Antibody Ratio, i.e., the ratio of the nucleic acid molecule to the antibody or its antigen-binding fragment) of the antibody-polynucleotide ligand complex is 1:1, 2:1, 3:1 or 4:1. In some embodiments, the antibody is an antibody to IL-4Rα, or a variant thereof, or an antigen-binding fragment thereof, or a similar antibody having the same complementarity determining region (CDR), which specifically binds to the human IL-4Rα protein. The antibody to IL-4Rα, or a variant thereof, or an antigen-binding fragment thereof, recognizes and binds to a unique epitope of IL-4Rα through its specific CDR region, thereby blocking the IL-4 and IL-13 signaling pathways and inhibiting type 2 immune responses. In some embodiments, the linker is selected based on its ability to provide stable connection between the antibody and the polynucleotide ligand while maintaining sufficient spatial flexibility and structural freedom to help maintain the biological activity of the coupled molecule and thus optimize the therapeutic effect. In addition, the design and selection of the selected linker take into account the stability of the entire antibody-polynucleotide ligand complex, drug release mode, therapeutic effect and expected biological activity, aiming to significantly improve the therapeutic index and reduce systemic toxicity through precise linker design. In some embodiments, the present disclosure primarily involves the generation of antibodies specifically targeting markers associated with type 2 inflammatory diseases. These antibodies are prepared using highly specific bioengineering techniques, ensuring they accurately recognize and bind to target proteins, such as IL-4Rα. Antibody characterization involves assessing affinity, specificity, and stability to ensure they can effectively perform their biological functions when subsequently coupled to siRNA. In some embodiments, gene-targeting polynucleotide ligands are designed to target key genes in type 2 inflammatory diseases, such as the IL-4 and IL-13 signaling pathways. These gene-targeting polynucleotide ligand sequences are carefully designed to ensure efficient gene silencing while avoiding interference with non-target genes. The design process also includes optimizing siRNA stability and intracellular delivery efficiency. In some embodiments, the sequences of polynucleotide ligands selected to target specific genes are synthesized using advanced biochemical methods. These sequences are precisely constructed to ensure that upon entry into target cells, they can effectively bind to their corresponding mRNA and promote its degradation, thereby inhibiting the expression of disease-related genes. In some embodiments, in order to verify the effect of the polynucleotide ligand designed to target a specific gene, an in vitro screening is performed. For example, by using different cell models, the inhibitory effect of siRNA on IL-4Rα expression and their potential role in regulating immune responses are evaluated. Further, the siRNA screened in the present disclosure is capable of downregulating the expression of target gene (such as IL-4Rα) mRNA transcripts, resulting in a reduction of at least 50%, at least 60% or at least 70% in the number of mRNA transcripts of the target gene in the cell. In some embodiments, in vitro screening of a JAK1 siRNA library was performed. As a key signaling molecule in the type 2 immune response, modulation of JAK1 activity is crucial for treating such diseases. In this example, the effects of various siRNAs on JAK1 expression and function were evaluated to identify the most effective candidate sequences. In some embodiments, an in vitro screening of a STAT6 siRNA library was performed. STAT6 is another key signaling molecule in the type 2 immune response, and targeting it can effectively modulate the immune response. In this example, different siRNAs were evaluated to determine their effectiveness in inhibiting STAT6 expression. In some embodiments, a conjugate of an antibody and siRNA is synthesized. Using advanced biochemical techniques, the siRNA molecule is firmly bound to the specific antibody, forming a complex capable of specifically recognizing and targeting pathological cells. This step is crucial for achieving the therapeutic goals of the present disclosure. In some embodiments, the present disclosure evaluates the in vitro activity of antibody-siRNA conjugates targeting IL-4Rα. This experimental design was designed to verify whether the conjugates could effectively silence IL-4Rα gene expression and observe their effects on cell signaling and immune responses. A series of cellular experiments, including gene expression analysis and functional testing, were performed to determine the efficacy and specificity of the conjugates. In some embodiments, the present disclosure evaluates the in vitro activity of IL-4Rα antibody-siRNA conjugates targeting JAK1. The conjugates were applied to various cell lines to investigate their effects on JAK1 gene silencing and subsequent effects on cell behavior. The efficacy and specificity of the conjugates were assessed by measuring JAK1 expression levels and related cell function parameters. In some embodiments, the conjugates of the present disclosure downregulate the level of mRNA transcript of the target gene in cells of the subject. Furthermore, the IL-4Rα antibody-JAK1 siRNA conjugate was co-incubated with JAK1-positive cells for 24 to 72 hours. Total RNA from the cells was extracted and transcribed into cDNA, and the expression level of JAK1 was subsequently detected by RT-qPCR. The results showed that the conjugate could effectively knock down the JAK1 gene, with a maximum inhibition rate exceeding 50%. In addition, cell proliferation was tested using CCK8 or cell-titer kits, and it was found that the conjugate significantly inhibited the proliferation activity of JAK1-positive cells. In some embodiments, the present disclosure explores the in vitro activity of IL-4Rα antibody-siRNA conjugates targeting STAT6. By applying the conjugates in in vitro cell models, their silencing effects on the STAT6 gene and their impact on cellular immune responses were studied. The efficacy and selectivity of the conjugates were evaluated by quantifying STAT6 gene expression and analyzing cellular immune function. Furthermore, an IL-4Rα antibody-STAT6 siRNA conjugate was applied to STAT6-positive cells and incubated for 24 to 72 hours. Similarly, total cellular RNA was extracted and transcribed into cDNA, and STAT6 expression levels were measured by RT-qPCR. The conjugate demonstrated effective knockdown, with a maximum inhibition rate exceeding 50%. Furthermore, CCK8 or cell-titer assays revealed that the IL-4Rα antibody-STAT6 siRNA conjugate effectively inhibited the proliferation of STAT6-positive cells. In some embodiments, the present disclosure evaluates the in vitro toxicity of antibody-IL-4Rα siRNA conjugates. This experiment aims to determine the safety of the conjugate in different cell types and its potential effects on normal cells. The safety and tolerability of the conjugate in vitro were evaluated by performing cell viability tests, cytotoxicity assays, etc. Furthermore, the in vitro toxicity of the antibody-IL-4Rα siRNA conjugate was evaluated. Human PBMCs were used as target cells and incubated with different concentrations of the conjugate, and complement-dependent cytotoxicity (CDC) was evaluated by detecting the level of LDH release in the supernatant. The results showed that the conjugate had no CDC activity. On the other hand, the antibody-dependent cell-mediated cytotoxicity (ADCC) of the conjugate was detected using Daudi cells as target cells and NK-92MI-CD16a cells as effector cells. The results showed that the conjugate also had no ADCC activity. In some embodiments, the present disclosure studies the knockdown effect of antibody-IL-4Rα siRNA conjugates in vivo. Conjugates that cross-react with mice and rats are selected and administered once through the tail vein. 7 days and 14 days after administration, various tissues and PBMCs are collected for analysis. Total RNA is extracted using the TRIZOL method, and the knockdown effect of IL-4Rα in target cells is detected by RT-qPCR. The results show that a single dose of the conjugate can induce significant knockdown of IL-4Rα in target cells in both the short and long term, showing a dose gradient effect. In some embodiments, the present disclosure evaluates the efficacy of antibody-IL-4Rα siRNA conjugates in asthma models. After administration of the conjugate in a compound-induced rat / mouse asthma model, significant improvement in asthma symptoms was observed. The transcription level of IL-4Rα in target cells was detected by RT-qPCR, and the results showed that the expression of IL-4Rα was significantly knocked down by more than 50% in the treated group. In contrast, the administration of the antibody alone did not affect the transcription level of IL-4Rα. In another aspect of the present invention, an antibody-nucleotide conjugate is provided, wherein the antibody-nucleotide conjugate is formed by conjugating (i) a polynucleotide ligand to (iii) a target protein binding portion via (ii) a linker. In some embodiments, the target protein is an interleukin 4 receptor (IL-4R), including type I IL-4R and type II IL-4R. For example, the target protein is IL-4Rα, and the target protein binding portion binds to IL-4Rα on the cell surface and causes endocytosis of the cell. In some specific embodiments, the target protein binding portion is an antibody or antigen-binding fragment thereof that specifically binds to IL-4Rα. In some embodiments, the antibody or antigen-binding fragment thereof has a structure selected from the group consisting of IgG-scFv, nanobody, BiTE, diabody, DART, TandAb, scDiabody, scDiabody-CH, triabody, minibody, minibody, TriBi minibody, scFv-CH3 KIH, Fab-scFv-Fc KIH, Fab-scFv, scFy-CH-CL-scFv, F(ab')2, F(ab')2-scFv2, scFv-KIH, Fab-scFy-Fc, tetravalent HCAb, scDiabody-Fc, diabody-FC, and tandem scFv-Fc. In some embodiments, the antibody or antigen-binding fragment thereof comprises a heavy chain CDR1, a heavy chain CDR2, a heavy chain CDR3, a light chain CDR1, a light chain CDR2 and a light chain CDR3, wherein the heavy chain CDR1 comprises the amino acid sequence of SEQ ID NO: 65, the heavy chain CDR2 comprises the amino acid sequence of SEQ ID NO: 66, the heavy chain CDR3 comprises the amino acid sequence of SEQ ID NO: 67, the light chain CDR1 comprises the amino acid sequence of SEQ ID NO: 68, the light chain CDR2 comprises the amino acid sequence of SEQ ID NO: 69, and the light chain CDR3 comprises the amino acid sequence of SEQ ID NO: 70; preferably, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region with an amino acid sequence of SEQ ID NO: 71 and a light chain variable region with an amino acid sequence of SEQ ID NO: 73; or the antibody or antigen-binding fragment thereof comprises a heavy chain variable region with an amino acid sequence of SEQ ID NO: 72 and a light chain variable region with an amino acid sequence of SEQ ID NO: 73. In some embodiments, the polynucleotide ligand is RNA; preferably, it includes siRNA, ASO, PMO, mRNA, dsRNA, miRNA; preferably, it includes ASO, siRNA. In some embodiments, the polynucleotide ligand comprises a targeting region that targets the target gene mRNA, and the targeting region is complementary to the target region in the target gene mRNA. In some specific embodiments, the target protein encoded by the target gene is a type 2 inflammatory disease-related protein; preferably, the target protein is selected from one or more proteins in the IL-4R signaling pathway, for example, the interleukin cell family (including but not limited to IL-4Rα, IL13Ra1, CD132), the JAK kinase protein family (including but not limited to JAK1 / JAK2 / JAK3 kinase), the STAT factor family (including but not limited to STAT1, STAT2, STAT3, STAT4, STAT5A, STAT5B, STAT6 factors), and the janus kinase protein family (including but not limited to TYK). In another aspect of the present invention, a method for delivering a polynucleotide into a cell is provided, comprising conjugating the polynucleotide to an antibody to form the antibody-nucleotide conjugate as described above, wherein the antibody specifically binds to a cell membrane surface protein of the cell, and the cell membrane surface protein mediates endocytosis of the cell after binding to the antibody; and contacting the antibody-nucleotide conjugate with the cell. In another aspect, the present invention also provides a method for treating a type 2 inflammatory disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an IL-4Rα antibody and a polynucleotide agent that inhibits proteins in the IL-4R signaling pathway, for example, the proteins in the IL-4R signaling pathway are the interleukin cell family (including but not limited to IL-4Rα, IL13Ra1, CD132), the JAK kinase protein family (including but not limited to JAK1 / JAK2 / JAK3 kinases), the STAT factor family (including but not limited to STAT1, STAT2, STAT3, STAT4, STAT5A, STAT5B, STAT6 factors), the janus kinase protein family (including but not limited to TYK); for example, the polynucleotide agent is siRNA; for example, the siRNA is conjugated to the IL-4Rα antibody to form an antibody nucleotide conjugate as described above. At the same time, innovative drug delivery systems are introduced for the treatment of type 2 inflammatory diseases. The composition can be combined with a variety of drug delivery systems, including but not limited to nanoparticles, liposomes, polymer microspheres, etc. The application of these systems is intended to optimize drug release, distribution, and targeting, thereby improving targeting, reducing side effects, and expanding the therapeutic window. In this way, not only is the drug's efficacy enhanced, but the patient's drug burden is also reduced, providing a more effective and safe solution for the treatment of type 2 inflammatory diseases. The methods disclosed herein are suitable for treating a range of type 2 inflammatory diseases, including but not limited to chronic sinusitis, asthma, and chronic sinusitis with nasal polyps. These diseases typically involve a Th2 cell-mediated immune response, in which IL-4 and IL-13 play a central role in the pathological process. By using the antibody-polynucleotide ligand complexes provided herein, it is possible to specifically target IL-4Rα for intervention, thereby effectively modulating the immune response, alleviating inflammatory symptoms, and improving the patient's clinical condition. In summary, the present disclosure provides a pharmaceutical composition based on an antibody or functional fragment thereof that specifically binds to IL-4Rα, or an antibody or functional fragment thereof that specifically binds to IL-4Rα, coupled to a nucleic acid molecule, offering new hope for the treatment of type 2 inflammatory diseases. By precisely targeting and modulating the IL-4 and IL-13 signaling pathways, the disclosed method can provide patients with a more effective and safer treatment option. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the surface plasmon resonance (SPR) results of the binding affinities of exemplary KNY-IL-4Rα antibody fragments VHH-1 (1A), KNY-IL-4Rα antibody fragment VHH-2 (1B), and KNY-IL-4Rα antibody fragment scFv (1C) to human IL-4Rα protein. FIG2 shows the effects of KNY-IL-4Rα antibody, IL-4Rα antibody fragment scFv, and two IL-4Rα antibody fragment VHHs on blocking IL-4-induced STAT6 activation. Figure 3 shows the results of the evaluation of the endocytic activity of KNY-IL-4Rα antibody on cells. Figure 3A shows the endocytic activity of KNY-IL-4Rα antibody and dupilumab; Figure 3B shows the endocytic activity of KNY-IL-4Rα antibody, dupilumab, AMG132, CBP-201, AK120, and MG-K10; Figures 3C and 3D show the pHrodo fluorescent dye (pHrodo) of Example 1. TM The results of endocytosis were detected by dye labeling method. FIG4 shows the SDS-PAGE results of KNY-IL-4Rα antibody-siRNA conjugates. FIG5 shows the results of liquid chromatography-mass spectrometry (LC-MS) analysis of KNY-IL-4Rα antibody. FIG6 shows the results of LC-MS analysis of KNY-IL-4Rα antibody-siRNA conjugate. FIG7A shows the results of Native MS analysis of the complete conjugate formed by coupling KNY-IL-4Rα antibody with one IL-4Rα siRNA. FIG7B shows the results of Native MS analysis of the complete conjugate formed by coupling KNY-IL-4Rα antibody with two IL-4Rα siRNAs. Figure 8A shows the binding activities of KNY-IL-4Rα antibody, IL-4Rα antibody-scramble siRNA conjugate DAR1, IL-4Rα antibody-IL-4Rα siRNA (19) conjugate DAR1 and DAR2 on HEK293_hIL-4Rα stably transfected cells. Figure 8B shows the binding activities of KNY-IL-4Rα antibody, IL-4Rα antibody-scramble siRNA conjugate DAR1, IL-4Rα antibody-IL-4Rα siRNA (19) conjugate DAR1 and DAR2 on Hep3B cells. FIG9 shows the endocytic activity of KNY-IL-4Rα antibody and IL-4Rα antibody-IL-4Rα siRNA (19) conjugate DAR1 in HEK293_hIL-4Rα stably transfected cells. FIG10A shows the knockdown activity of exemplary AMG132 antibody-scramble siRNA conjugates (DAR1) and IL-4Rα siRNA (19)-conjugates (DAR1 and DAR2) in HEK293_hIL-4Rα stably transfected cells. FIG10B shows the knockdown activity of exemplary CBP-201 antibody-scramble siRNA conjugates (DAR1) and IL-4Rα siRNA (19)-conjugated conjugates (DAR1 and DAR2) in HEK293_hIL-4Rα stably transfected cells. FIG10C shows the knockdown activity of exemplary AK120 antibody-scramble siRNA conjugates (DAR1) and IL-4Rα siRNA (19)-conjugated conjugates (DAR1 and DAR2) in HEK293_hIL-4Rα stably transfected cells. FIG10D shows the knockdown activity of exemplary KNY-IL-4Rα antibody-coupled scramble siRNA conjugates (DAR1) and IL-4Rα siRNA (19)-coupled conjugates (DAR1 and DAR2) in HEK293_hIL-4Rα stably transfected cells. FIG10E shows the knockdown activity of exemplary Dupilumab antibody-scramble siRNA conjugates (DAR1) and IL-4Rα siRNA (1098)-conjugated conjugates (DAR1 and DAR2) on HEK293_hIL-4Rα stably transfected cells. Figure 11A shows the binding activities of KNY-IL-4Rα antibody, KNY-IL-4Rα antibody-scramble siRNA conjugate DAR1, KNY-IL-4Rα antibody-JAK1 siRNA (JAK1-ref) conjugate DAR1 and DAR2 on HEK293_hIL-4Rα stably transfected cells. FIG11B shows the binding activities of KNY-IL-4Rα antibody, KNY-IL-4Rα antibody-scramble siRNA conjugate DAR1, and KNY-IL-4Rα antibody-JAK1 siRNA (JAK1-ref) conjugate DAR1 and DAR2 on Hep3B cells. FIG12 shows the knockdown activity of a KNY-IL-4Rα antibody-coupled scramble siRNA conjugate (DAR1) and a JAK1 siRNA (JAK1-ref)-coupled conjugate (DAR1 and DAR2) on PBMC-derived B cells. FIG13 shows exemplary TARC expression levels in mouse serum at different time points after a single AOC administration, wherein FIG13A shows the results of KNY-IL-4Rα and IL-4Rα siRNA conjugates, and FIG13B shows the results of KNY-IL-4Rα and STAT6 siRNA conjugates. FIG. 14 shows exemplary serum IgE expression levels in mice before and 21 days after a single AOC administration. FIG. 15 shows the serum IgE expression levels of the exemplary AOCs in Example 12 in cynomolgus monkeys after 28 days of administration. Related definitions In this disclosure, unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are those widely used in the respective fields and are common procedures. To facilitate a better understanding of this disclosure, definitions and explanations of relevant terms are provided below. As used herein, the term "type 2 inflammatory diseases" refers to a range of diseases caused by a Th2 cell-mediated immune response, typically involving interleukin-4 (IL-4) and interleukin-13 (IL-13) as central to the pathological process. Specific diseases include, but are not limited to, chronic sinusitis, asthma, and chronic sinusitis with nasal polyps. These diseases are characterized by allergic reactions, inflammatory responses, and abnormal activation of the immune system. As used herein, the term "polynucleotide ligand" refers to a double-stranded RNA molecule composed of two complementary RNA strands, specifically small interfering RNA (siRNA). siRNA can specifically bind to the corresponding target mRNA and, through the RNA-induced silencing complex (RISC)-mediated degradation of the target mRNA, thereby inhibiting the expression of a specific gene. As used herein, the term "IL-4Rα antibody" refers to antibodies specifically targeting the human interleukin-4 receptor α subunit (IL-4Rα). These antibodies can specifically recognize and bind to IL-4Rα, blocking its interaction with IL-4 and IL-13, thereby inhibiting the signaling pathway mediated by IL-4 and IL-13, thereby regulating the type 2 immune response. As used herein, the term "linker" or "connector" refers to a chemical linker used to couple IL-4Rα antibodies (or variants or antigen-binding fragments thereof) to siRNA. The choice of linker is crucial to ensuring the stability, biological activity, and therapeutic effect of the antibody-polynucleotide ligand complex. Common linker types include peptide linkers, polyethylene glycol (PEG) linkers, and isothiocyanate linkers, such as SMPB, LC-SMCC, SMCC, and particularly SMCC-C6, which form stable covalent bonds between antibodies and siRNAs through specific chemical reactions. As used herein, the term "antibody to IL-4Rα or a variant thereof or an antigen-binding fragment thereof or a similar antibody having the same complementary determining region (CDR)" refers to the specific antibody IL-4Rα monoclonal antibody or other antibody variants having the same antigen binding site (i.e., complementary determining region, CDR). These similar antibodies can maintain the specific binding ability to IL-4Rα by retaining the CDR of the IL-4Rα monoclonal antibody, thereby providing structural or functional optimization without changing the antigen recognition properties. "Interleukin-4" (IL-4) refers to a naturally occurring or endogenous mammalian IL-4 protein or a protein having the same amino acid sequence as the naturally occurring or endogenous corresponding mammalian IL-4 protein (such as a recombinant protein, a synthetic protein (i.e., a protein prepared by synthetic organic chemistry methods)). Accordingly, as defined herein, the term includes mature IL-4 protein, polymorphic or allelic variants, other isoforms of IL-4, and modified or unmodified forms (such as lipidates or glycosylation) of the above. Naturally occurring or endogenous IL-4 includes wild-type proteins such as mature IL-4, polymorphic or allelic variants, and other isoforms and mutant forms that occur naturally in mammals (e.g., humans, non-human primates). These proteins can be recovered or isolated from sources such as naturally occurring IL-4. These proteins, as well as proteins having the same amino acid sequence as the corresponding naturally occurring or endogenous IL-4, are named after the corresponding mammal. For example, when the corresponding mammal is human, the protein is referred to as human IL-4. Several mutant IL-4 proteins are known in the art, as disclosed in WO 03 / 038041. "Interleukin-13" (IL-13) refers to a naturally occurring or endogenous mammalian IL-13 protein or a protein having the same amino acid sequence as the corresponding naturally occurring or endogenous mammalian IL-13 protein (e.g., a recombinant protein, a synthetic protein (i.e., a protein prepared by synthetic organic chemistry)). IL-13 is a cytokine secreted by many cell types, including T helper type 2 (Th2) cells. Accordingly, as defined herein, the term includes mature IL-13 protein, polymorphic or allelic variants, other isoforms of IL-13 (e.g., produced by alternative splicing or other cellular processes), and modified or unmodified forms of the aforementioned (e.g., lipidated or glycosylated). Naturally occurring or endogenous IL-13 includes wild-type protein, such as mature IL-13, polymorphic or allelic variants, and other isoforms and mutant forms that occur naturally in mammals (e.g., humans, non-human primates). For example, IL-13 as used herein includes human IL-13 variants in which Arg at position 110 of mature human IL-13 is replaced with Gln (position 110 of mature IL-13 corresponds to position 130 of the precursor protein). Gln is associated with asthma (both atopic and non-atopic asthma), as well as other IL-13 variants (Heinzmann et al., Hum Mol Genet 9:549-559 (2000)). These proteins can be recovered or isolated from sources such as naturally occurring IL-13. These proteins, as well as proteins having the same amino acid sequence as the corresponding naturally occurring or endogenous IL-13, are named after the corresponding mammal. For example, when the corresponding mammal is human, the protein is referred to as human IL-13. Several mutant IL-13 proteins are known in the art, such as those disclosed in WO 03 / 035847. The amino acid sequence of an exemplary human IL-13 can be found, for example, under UniProtKB accession number P35225. IL-13 binds to an IL-13 receptor, which can include the IL-4 receptor alpha (IL4Rα) in complex with the IL-13 receptor subunit alpha 1 (IL13RA1) or the IL-13 receptor subunit alpha 2 (IL13RA2). For example, IL-13 can bind to a complex of the IL-4 receptor alpha and the IL-13 receptor subunit alpha 1. With respect to antibody chain polypeptide sequences, the phrase "substantially identical" is understood to mean antibody chains that exhibit at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference polypeptide sequence. With respect to nucleic acid sequences, the phrase is understood to mean nucleotide sequences that exhibit at least greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference nucleic acid sequence. The term "identity" or "homology" may refer to the percentage of nucleotide bases or amino acid residues in a candidate sequence that are identical to the residues in the corresponding sequence, after aligning the sequences and introducing gaps (if necessary) to achieve the maximum percentage identity over the entire sequence and excluding any conservative substitutions as part of the sequence identity. Neither N-terminal nor C-terminal extensions or insertions should be construed as reducing identity or homology. Methods and computer programs for alignment are readily available and well known in the art. Sequence identity can be measured using sequence analysis software. Phrases and terms such as "functional fragments, variants, derivatives, or analogs" of antibodies or antigens, and various forms thereof, refer to compounds or molecules that have qualitatively the same biological activity as the full-length antibody or antigen of interest. For example, a functional fragment or analog of an anti-IL-4 antibody is a fragment or analog that can bind to the IL-4 molecule, or a fragment or analog that can prevent or substantially reduce the ability of a ligand, or an agonist or antagonist antibody, to bind to IL-4. A "substitution" variant is one in which at least one amino acid residue in the native sequence has been removed and a different amino acid has been inserted in the same position. The substitution can be single, where only one amino acid is substituted in the molecule, or multiple, where two or more amino acids are substituted in the same molecule. Multiple substitutions can be at consecutive sites. Likewise, a single amino acid can be substituted by multiple residues, where such a variant includes both substitutions and insertions. An "insertion" variant is one in which one or more amino acids are inserted adjacent to an amino acid at a specific position in a native sequence. Adjacent to an amino acid means linked to the α-carboxyl or α-amino functional group of that amino acid. A "deletion" variant is one in which one or more amino acids in the native amino acid sequence have been removed. Typically, deletion variants have one or two amino acids deleted within a specific region of the molecule. As used herein, the term "antibody" is used in the broadest sense, specifically covering monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), antibody fragments or synthetic polypeptides carrying one or more CDRs or derived from CDR sequences, as long as these polypeptides exhibit the desired biological activity. Antibodies (Abs) and immunoglobulins (Igs) are glycoproteins with the same structural characteristics. "Antibody" may also refer to immunoglobulins and immunoglobulin fragments, whether natural or partially or fully synthetically (e.g., recombinantly), including any fragment that retains the binding specificity of a full-length immunoglobulin comprising at least a portion of the variable region of an immunoglobulin molecule. Thus, antibodies include any protein having a binding domain that is homologous or substantially homologous to an immunoglobulin antigen binding domain (antibody binding site). Antibodies include antibody fragments, such as anti-tumor stem cell antibody fragments. As used herein, the term antibody includes synthetic antibodies, recombinantly produced antibodies, multispecific antibodies (e.g., bispecific antibodies), human antibodies, non-human antibodies, humanized antibodies, chimeric antibodies, intrabodies, and antibody fragments, such as, but not limited to, Fab fragments, Fab' fragments, F(ab')2 fragments, Fv fragments, disulfide-linked Fv (dsFv), Fd fragments, Fd' fragments, single-chain Fv (scFv), single-chain Fab (scFab), diabodies, anti-idiotypic (anti-Id) antibodies, or antigen-binding fragments of any of the above. The antibodies provided herein include members of any immunoglobulin class (e.g., IgG, IgM, IgD, IgE, IgA, and IgY), any class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass (e.g., IgG2a and IgG2b). The antibodies described in the present disclosure may be antibodies of any class (e.g., IgG, IgE, IgM, IgD, IgA, etc.), or subclass (e.g., IgG1, IgG2, IgG2a, IgG3, IgG4, IgA1, IgA2, etc.) ("type" and "class", as well as "subtype" and "subclass" are used interchangeably herein). Natural or wild-type (i.e., obtained from a population member that has not been artificially manipulated) antibodies and immunoglobulins are typically heterotetrameric glycoproteins of about 150,000 daltons, consisting of two identical light chains (L) and two identical heavy chains (H). One end of each heavy chain has a variable domain (VH), followed by multiple constant domains. One end of each light chain has a variable domain (VL) and the other end has a constant domain. The so-called "unmanipulated" means that it has not been treated with the intention of containing or expressing foreign antigen-binding molecules. Wild-type can refer to the most common allele or species found in a population or to antibodies obtained from unmanipulated animals, as compared to an allele or polymorphic form, or to a variant or derivative obtained by some form of manipulation, such as mutagenesis, use of recombinant methods, etc., that alters the amino acids of the antigen-binding molecule. As used herein, "anti-IL-4 antibody" refers to an antibody that can specifically bind to IL-4 as defined herein or a polypeptide (derivative) derived from such an antibody, including but not limited to molecules that inhibit or substantially reduce the binding of IL-4 to its receptor or inhibit the activity of IL-4. With respect to the variable domains of antibodies, the term "variable" refers to those parts of the related molecule that have extensive sequence differences between antibodies and are used for specific recognition and binding of a particular antibody to its specific target. However, the variability is not evenly distributed throughout the variable domain of an antibody. The variability is concentrated in three segments called complementarity determining regions (CDRs; i.e., CDR1, CDR2, and CDR3) or hypervariable regions, which are located in the variable domains of both the light and heavy chains. The more highly conserved portions of the variable domains are called framework (FR) regions or framework sequences. Each variable domain of a native heavy and light chain includes four FR regions, which primarily adopt a β-sheet configuration, connected by three CDRs, which form loops that connect and, in some cases, form part of the β-sheet structure. The CDRs of each chain are typically linked adjacently by FR regions and, with the help of the CDRs from the other chain, contribute to the formation of the antibody target binding site (epitope or determinant) (see Kabat et al., Sequences of Proteins of Immunological Interest, National Institute of Health, Bethesda, MD (1987)). As used herein, the numbering of immunoglobulin amino acid residues is based on the immunoglobulin amino acid residue numbering system of Kabat et al., unless otherwise indicated. A CDR may have the ability to specifically bind to a cognate epitope. As used herein, the term "hinge" or "hinge region" refers to the flexible polypeptide comprising amino acids between the first and second constant domains of an antibody. As used herein, an "antibody fragment" or "antigen-binding fragment" of an antibody refers to any portion of a full-length antibody that is less than full-length but contains at least a portion of the variable region of the antibody that binds to an antigen (e.g., one or more CDRs and / or one or more antibody binding sites) and thus retains binding specificity and at least a portion of the specific binding ability of the full-length antibody. Thus, an antigen-binding fragment refers to an antibody fragment that contains an antigen-binding portion that binds to the same antigen as the antibody from which the antibody fragment was derived. Antibody fragments include antibody derivatives produced by enzymatic treatment of full-length antibodies, as well as synthetically produced derivatives, such as recombinantly produced derivatives. Antibodies include antibody fragments. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, single-chain Fv (scFv), Fv, dsFv, diabodies, Fd and Fd' fragments, and other fragments, including modified fragments (see, e.g., Methods in Molecular Biology, Vol 207: Recombinant Antibodies for Cancer Therapy Methods and Protocols (2003); Chapter 1; p 3-25, Kipriyanov). The fragment may include multiple chains linked together, for example, by disulfide bonds and / or by peptide linkers. Antibody fragments generally contain at least or about 50 amino acids, and typically at least or about 200 amino acids. Antigen-binding fragments include any antibody fragment that, when inserted into an antibody framework (e.g., by replacing corresponding regions), results in an antibody that immunospecifically binds (i.e., exhibits a Ka of at least or at least about 10⁷-10⁸M⁻¹) to an antigen. A "functional fragment" or "analog of an anti-IL-4 and / or IL-13 antibody" is a fragment or analog that prevents or substantially reduces the ability of the receptor to bind to a ligand or initiate signal transduction. As used herein, a functional fragment is generally synonymous with an "antibody fragment" and, with respect to antibodies, may refer to a fragment that prevents or substantially reduces the ability of the receptor to bind to a ligand or initiate signal transduction, such as an Fv, Fab, F(ab')2, etc. "Fv" fragments consist of a dimer (VH-VL dimer) formed by non-covalent association of the variable domains of one heavy chain and one light chain. In this configuration, the three CDRs of each variable domain interact to define a target binding site on the surface of the VH-VL dimer, as in the case of an intact antibody. The six CDRs collectively confer target binding specificity to the intact antibody. However, even a single variable domain (or half of an Fv comprising only three target-specific CDRs) can still have the ability to recognize and bind to a target. "Single-chain Fv," "sFv," or "scab" antibody fragments comprise the VH and VL domains of an antibody, wherein these domains are present in a single polypeptide chain. Generally, the Fv polypeptide also includes a polypeptide linker, which is typically a flexible molecule that allows the sFv to form the desired structure for target binding, between the VH and VL regions. As used herein, the term "diabody" refers to antibody fragments with two antigen-binding sites. These fragments may include a heavy chain variable domain (VH) connected to a light chain variable domain (VL) of the same polypeptide chain. By using a linker that is too short to allow the two variable domains on the same chain to pair, the diabody domains are forced to pair with the binding domains of another chain, generating two antigen-binding sites. As used herein, "monoclonal antibody" refers to a population of identical antibodies, meaning that each individual antibody molecule in the monoclonal antibody population is identical to other antibody molecules. This characteristic is in contrast to the characteristic of a polyclonal population of antibodies, which comprises antibodies with a variety of different sequences. Monoclonal antibodies can be prepared by many well-known methods (Smith et al. (2004) J. Clin. Pathol. 57, 912-917; and Nelson et al., J Clin Pathol (2000), 53, 111-117). For example, monoclonal antibodies can be prepared by immortalized B cells, for example, by fusion with myeloma cells to produce hybridoma cell lines or by infecting B cells with viruses such as EBV. Recombinant technology can also be used to prepare antibodies from a clonal population of host cells in vitro by transforming host cells with a plasmid carrying an artificial sequence of nucleotides encoding the antibody. As used herein, the term "hybridoma" or "hybridoma cell" refers to a cell or cell line (usually a myeloma or lymphoma cell) produced by the fusion of an antibody-producing lymphocyte and a non-antibody-producing cancer cell. As known to those of ordinary skill in the art, hybridomas can proliferate and continuously produce a specific monoclonal antibody. Methods for producing hybridomas are known in the art (see, for example, Harlow & Lane, 1988). When referring to the term "hybridoma" or "hybridoma cell," it also includes subclones and progeny cells of the hybridoma. As used herein, "conventional antibodies" refers to antibodies comprising two heavy chains (which may be designated as H and H') and two light chains (which may be designated as L and L') and two antigen-binding sites, wherein each heavy chain may be a full-length immunoglobulin heavy chain or any functional region thereof that retains antigen-binding ability (e.g., heavy chains include but are not limited to VH chains, VH-CH1 chains, and VH-CH1-CH2-CH3 chains), and each light chain may be a full-length light chain or any functional region thereof (e.g., light chains include but are not limited to VL chains and VL-CL chains). Each heavy chain (H and H') is paired with one light chain (L and L', respectively). As used herein, a full-length antibody is an antibody having two full-length heavy chains (e.g., VH-CH1-CH2-CH3 or VH-CH1-CH2-CH3-CH4) and two full-length light chains (VL-CL) and a hinge region, such as antibodies naturally produced by antibody-secreting B cells and antibodies with the same domains produced synthetically. As used herein, dsFv refers to an Fv with an engineered intermolecular disulfide bond that stabilizes the VH-VL pair. As used herein, Fab fragments are antibody fragments obtained by digesting full-length immunoglobulins with papain, or fragments having the same structure, for example, produced synthetically by recombinant methods. Fab fragments comprise a light chain (comprising VL and CL) and another chain comprising the variable domain (VH) of the heavy chain and one constant region domain (CH1) of the heavy chain. As used herein, a F(ab')2 fragment is an antibody fragment resulting from pepsin digestion of an immunoglobulin at pH 4.0-4.5, or a fragment having the same structure produced synthetically, for example, by recombinant methods. A F(ab')2 fragment essentially comprises two Fab fragments, each heavy chain portion of which contains several additional amino acids, including cysteine, which forms a disulfide bond linking the two fragments. As used herein, a Fab' fragment is a fragment comprising half (one heavy chain and one light chain) of a F(ab')2 fragment. As used herein, scFv fragments refer to antibody fragments comprising a variable light chain (VL) and a variable heavy chain (VH) covalently linked in any order by a polypeptide linker. The linker length allows for the two variable domains to be bridged without substantial interference. Exemplary linkers are (Gly-Ser)n residues interspersed with some Glu or Lys residues to increase solubility. As used herein, the term "chimeric antibody" refers to antibodies in which the variable region sequences are derived from one species and the constant region sequences are derived from another species, such as antibodies in which the variable region sequences are derived from a mouse antibody and the constant region sequences are derived from a human antibody. As used herein, "humanized" antibodies refer to non-human (e.g., mouse) antibody forms that are chimeric immunoglobulins, immunoglobulin chains, or fragments thereof (e.g., Fv, Fab, Fab', F(ab')2, or other antigen-binding subsequences of antibodies) that contain minimal sequence derived from non-human immunoglobulins. Preferably, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient antibody are replaced by CDR residues from a non-human species (donor antibody) such as mouse / rat / rabbit having the desired specificity, affinity, and capacity. In addition, in humanization, it is also possible to mutate the amino acid residues in the CDR1, CDR2 and / or CDR3 regions of VH and / or VL to thereby improve one or more binding properties (e.g., affinity) of the antibody. For example, PCR-mediated mutations can be used to introduce mutations, and their effects on antibody binding or other functional properties can be evaluated using in vitro or in vivo tests as described herein. Typically, conservative mutations are introduced. Such mutations can be amino acid substitutions, additions, or deletions. In addition, the mutations in the CDRs are typically no more than one or two. Therefore, the humanized antibodies described herein also encompass antibodies comprising one or two amino acid mutations in the CDRs. As used herein, the term "epitope" refers to any antigenic determinant on an antigen to which the paratope of an antibody binds. Epitopic determinants typically comprise chemically active surface patterns of molecules, such as amino acids or sugar side chains, and typically have specific three-dimensional structural characteristics as well as specific charge characteristics. As used herein, variable domain or variable region is the specific Ig domain of antibody heavy chain or light chain, and it is included in the aminoacid sequence that changes between different antibodies.Each light chain and each heavy chain has a variable region domain VL and VH respectively.Variable domain provides antigen specificity, and is therefore responsible for antigen recognition.Each variable region comprises CDR and framework region (FR), and CDR is the part of antigen binding site domain. As used herein, "antigen binding domain" and "antigen-binding site" are used synonymously to refer to the domain within an antibody that recognizes and physically interacts with a cognate antigen. A natural, conventional full-length antibody molecule has two conventional antigen-binding sites, each comprising a heavy chain variable region portion and a light chain variable region portion. A conventional antigen-binding site comprises loops connecting antiparallel beta chains within the variable region domain. An antigen-binding site may comprise other portions of the variable region domain. Each conventional antigen-binding site comprises three hypervariable regions from the heavy chain and three hypervariable regions from the light chain. Hypervariable regions are also referred to as complementarity determining regions (CDRs). As used herein, "hypervariable region," "HV," "complementarity determining region," "CDR," and "antibody CDR" are used interchangeably to refer to one of the multiple portions within each variable region that together form the antigen binding site of an antibody. Each variable region domain comprises three CDRs, designated CDR1, CDR2, and CDR3. For example, the light chain variable region domain comprises three CDRs, designated VL CDR1, VL CDR2, and VL CDR3; the heavy chain variable region domain comprises three CDRs, designated VH CDR1, VH CDR2, and VH CDR3. The three CDRs in the variable region are discontinuous along the linear amino acid sequence, but are proximal in the folded polypeptide. The CDRs are located within loops connecting the parallel strands of the beta sheet of the variable domain. As described herein, those of skill in the art know and can identify CDRs based on Kabat or Chothia numbering (see, e.g., Kabat, EA et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, US Department of Health and Human Services, NIH Publication No. 91-3242, and Chothia, C. et al. (1987) J. Mol. Biol. 196:901-917). As used herein, framework regions (FRs) are domains within the antibody variable region domains that are located within the beta sheets; in terms of amino acid sequence, FR regions are relatively more conserved than hypervariable regions. As used herein, a "constant region" domain is a domain in an antibody heavy or light chain that comprises an amino acid sequence that is relatively more conservative than the amino acid sequence of the variable region domain. In conventional full-length antibody molecules, each light chain has a single light chain constant region (CL) domain, while each heavy chain comprises one or more heavy chain constant region (CH) domains, including CH1, CH2, CH3, and CH4. Full-length IgA, IgD, and IgG isotypes comprise CH1, CH2, CH3, and a hinge region, while IgE and IgM comprise CH1, CH2, CH3, and CH4. The CH1 and CL domains extend the Fab arm of the antibody molecule, thereby contributing to interaction with the antigen and rotation of the antibody arm. The antibody constant region can serve effector functions, such as, but not limited to, clearing antigens, pathogens, and toxins to which the antibody specifically binds, such as by interacting with various cells, biomolecules, and tissues. As used herein, a functional region of an antibody is an antibody portion comprising at least the VH, VL, CH (eg, CH1, CH2, or CH3), CL, or hinge region domains of the antibody, or at least a functional region thereof. As used herein, a functional region of a VH domain is at least a portion of an intact VH domain that retains at least some of the binding specificity of the intact VH domain (e.g., by retaining one or more CDRs of the intact VH domain), such that the functional region of the VH domain binds to the antigen alone or in combination with another antibody domain (e.g., a VL domain) or a region thereof. An exemplary functional region of a VH domain is a region comprising CDR1, CDR2, and / or CDR3 of the VH domain. As used herein, a functional region of a VL domain is at least a portion of a complete VL domain that retains at least some of the binding specificity of the complete VL domain (e.g., by retaining one or more CDRs of the complete VL domain), such that the functional region of the VL domain binds to the antigen alone or in combination with another antibody domain (e.g., a VH domain) or a region thereof. An exemplary functional region of a VL domain is a region comprising CDR1, CDR2, and / or CDR3 of a VL domain. As used herein, "specific binding" or "immunospecifically binds" with respect to an antibody or antigen-binding fragment thereof are used interchangeably herein and refer to the ability of an antibody or antigen-binding fragment to form one or more non-covalent bonds with an antigen of the same species through non-covalent interactions between the antibody combining sites of the antibody and the antigen. The antigen can be an isolated antigen or present on a tumor cell. Typically, an antibody that immunospecifically binds (or specifically binds) to an antigen binds to the antigen with an affinity constant Ka of about or 1 x 107 M-1 or 1 x 108 M-1 or greater (or a dissociation constant (Kd) of 1 x 10-7 M or 1 x 10-8 M or less). Affinity constants can be determined by standard kinetic methods of antibody reactions, e.g., immunoassays, surface plasmon resonance (SPR) (Rich and Myszka (2000) Curr. Opin. Biotechnol 11:54; Englebienne (1998) Analyst. 123:1599), isothermal titration calorimetry (ITC), or other kinetic interaction assays known in the art (see, e.g., Paul, ed., Fundamental Immunology, 2nd ed., Raven Press, New York, pages 332-336 (1989); see also U.S. Pat. No. 7,229,619 for a description of exemplary SPR and ITC methods for calculating the binding affinity of an antibody). Instruments and methods for real-time detection and monitoring of binding rates are known and commercially available (see, BiaCore 2000, Biacore AB, Upsala, Sweden and GE Healthcare Life Sciences; Malmqvist (2000) Biochem. Soc. Trans. 27:335). As used herein, the term "competition" with respect to antibodies refers to a first antibody or its antigen-binding fragment binding to an epitope in a manner sufficiently similar to a second antibody or its antigen-binding fragment, such that the binding result of the first antibody to its associated epitope is detectably reduced in the presence of the second antibody compared to the absence of the second antibody. Alternatively, in the case where the binding of the second antibody to its epitope is also detectably reduced in the presence of the first antibody, this may be the case, but not necessarily so. That is, the first antibody can inhibit the binding of the second antibody to its epitope without the second antibody inhibiting the binding of the first antibody to its respective epitope. However, in the case where each antibody can detectably inhibit the binding of another antibody to its associated epitope or ligand, whether to the same, higher or lower degree, the antibodies are said to "cross-compete" with each other for binding to their respective epitopes. Competing and cross-competing antibodies are encompassed in the present disclosure. Regardless of the mechanism by which such competition or cross-competition occurs (e.g., steric hindrance, conformational change, or binding to a common epitope or fragment thereof), those skilled in the art will recognize that such competing and / or cross-competing antibodies are encompassed in the present disclosure and can be used in the methods disclosed herein based on the teachings provided herein. As used herein, "polypeptide" refers to two or more amino acids covalently linked. The terms "polypeptide" and "protein" are used interchangeably herein. By "isolated protein," "isolated polypeptide," or "isolated antibody" is meant a protein, polypeptide, or antibody that is (1) not associated with naturally associated components that accompany it in its native state, (2) is free of other proteins from the same species, (3) is expressed by cells from a different species, or (4) does not occur in nature. Thus, a polypeptide that is chemically synthesized or synthesized in a cellular system different from the cells from which the polypeptide naturally originates will be "isolated" from its naturally associated components. A protein can also be rendered substantially free of naturally associated components by isolation, i.e., using protein purification techniques well known in the art. In peptides or proteins, suitable conservative amino acid substitutions are known to those skilled in the art and can generally be made without altering the biological activity of the resulting molecule. Generally, those skilled in the art recognize that single amino acid substitutions in non-essential regions of a polypeptide do not substantially alter biological activity (see, e.g., Watson et al., Molecular Biology of the Gene, 4th Edition, 1987, The Benjamin / Cummings Pub.co., p. 224). As used herein, the terms "polynucleotide" and "nucleic acid molecule" refer to an oligomer or polymer comprising at least two linked nucleotides or nucleotide derivatives, including deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), usually linked together by phosphodiester bonds. As used herein, isolated nucleic acid molecules are nucleic acid molecules isolated from other nucleic acid molecules present in the natural origin of nucleic acid molecules. " Isolated " nucleic acid molecules such as cDNA molecules can be substantially free of other cellular materials or culture medium when prepared by recombinant technology, or substantially free of chemical precursors or other chemical compositions when chemosynthesis. The exemplary isolated nucleic acid molecules provided herein comprise the isolated nucleic acid molecules of the antibody or Fab provided by coding. As used herein, the term "C6 linker" generally represents a -NH-(CH2)6-linker (also known as a C6 amine linker or a C6 amino linker), which is connected to the portion to which it is connected through -NH- and -CH2-, such as a target protein binding portion, a polynucleotide molecule, or a portion thereof in a linker that can be connected to a C6 linker; Sequence "identity" or "identity" has a meaning recognized in the art, and the percentage of sequence identity between two nucleic acid or polypeptide molecules or regions can be calculated using published techniques. Sequence identity can be measured along the entire length of a polynucleotide or polypeptide or along a region of the molecule. (See, for example, Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). While there are many methods to measure the identity between two polynucleotides or polypeptides, the term "identity" is well known to those of skill in the art (Carrillo, H. & Lipman, D., SIAM J Applied Math 48: 1073 (1988)). As used herein, "operably linked" with respect to nucleic acid sequences, regions, elements, or domains means that the nucleic acid regions are functionally related to each other. For example, a promoter can be operably linked to a nucleic acid encoding a polypeptide such that the promoter regulates or mediates transcription of the nucleic acid. As used herein, "expression" refers to the process of producing a polypeptide through transcription and translation of a polynucleotide. The expression level of a polypeptide can be assessed using any method known in the art, including, for example, methods for measuring the amount of polypeptide produced by a host cell. Such methods may include, but are not limited to, quantification of polypeptides in cell lysates by ELISA, gel electrophoresis followed by Coomassie blue staining, Lowry protein assay, and Bradford protein assay. As used herein, a "host cell" is a cell that is used to receive, maintain, replicate, and amplify a vector. Host cells can also be used to express polypeptides encoded by the vector. When the host cell divides, the nucleic acid contained in the vector replicates, thereby amplifying the nucleic acid. The host cell can be a eukaryotic cell or a prokaryotic cell. Suitable host cells include, but are not limited to, CHO cells, various COS cells, HeLa cells, and HEK cells, such as HEK 293 cells. As used herein, a "vector" is a replicable nucleic acid that, when transformed into an appropriate host cell, can express one or more heterologous proteins from the vector. Vectors include those into which nucleic acids encoding polypeptides or fragments thereof can be introduced, typically by restriction digestion and ligation. Vectors also include those that contain nucleic acids encoding polypeptides. Vectors are used to introduce nucleic acids encoding polypeptides into host cells for the purpose of amplifying nucleic acids or for expressing / displaying polypeptides encoded by nucleic acids. Vectors are typically kept episomal, but can be designed to integrate genes or portions thereof into chromosomes of the genome. Artificial chromosome vectors, such as yeast artificial vectors and mammalian artificial chromosomes, are also contemplated. The selection and use of such vectors are well known to those skilled in the art. As used herein, vectors also include “viral vectors” or “viral vectors.” Viral vectors are engineered viruses that are operably linked to exogenous genes to transfer (as vehicles or shuttles) the exogenous genes into cells. As used herein, "expression vector" includes a vector capable of expressing DNA that is operably linked to a regulatory sequence such as a promoter region that can affect the expression of such DNA fragments. Such additional fragments may include promoter and terminator sequences, and may optionally include one or more origins of replication, one or more selection markers, enhancers, polyadenylation signals, etc. Expression vectors are generally derived from plasmid or viral DNA, or may contain elements of both. Therefore, an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, phage, recombinant virus or other vector, which, when introduced into an appropriate host cell, results in the expression of the cloned DNA. Suitable expression vectors are well known to those skilled in the art and include expression vectors that are replicable in eukaryotic cells and / or prokaryotic cells, as well as expression vectors that remain episomal or that are integrated into the host cell genome. As used herein, "treating" an individual suffering from a disease or condition means that the individual's symptoms are partially or completely alleviated, or remain unchanged after treatment. Thus, treatment includes prevention, treatment, and / or cure. Prevention refers to preventing the underlying disease and / or preventing the worsening of symptoms or progression of the disease. Treatment also includes any pharmaceutical use of any of the antibodies or antigen-binding fragments thereof provided, as well as the compositions provided herein. As used herein, "therapeutic effect" refers to an effect resulting from treatment of a subject that alters, typically ameliorates or improves the symptoms of a disease or condition, or cures the disease or condition. As used herein, "therapeutically effective amount" or "therapeutically effective dose" refers to an amount of a substance, compound, material, or composition comprising a compound that is at least sufficient to produce a therapeutic effect after administration to a subject. Thus, it is the amount necessary to prevent, cure, ameliorate, arrest, or partially arrest the symptoms of a disease or condition. As used herein, a "prophylactically effective amount" or "prophylactically effective dose" refers to an amount of a substance, compound, material, or composition comprising a compound that, when administered to a subject, will have the desired prophylactic effect, e.g., preventing or delaying the onset or recurrence of a disease or symptom, or reducing the likelihood of the onset or recurrence of a disease or symptom. A fully prophylactically effective dose need not occur by administering one dose, and may occur only after administering a series of doses. Thus, a prophylactically effective amount may be administered in one or more administrations. As used herein, the term "patient" refers to a mammal, such as a human. As used herein, AOC (Antibody–Oligonucleotide Conjugate) refers to a conjugate formed by an antibody and an oligonucleotide, wherein the oligonucleotide may be siRNA, and the antibody and siRNA may be connected via a linker. DETAILED DESCRIPTION The embodiments of the present disclosure are described in more detail below. Example 1: Production and characterization of antibodies (1) Anti-IL-4Rα antibodies (hereinafter referred to as "KNY-IL-4Rα antibodies") or antibody fragments thereof were prepared with reference to patent CN 110540590 B. Antibody fragments include scFv, nanobody, Fab, etc. The heavy chain sequence of the KNY-IL-4Rα antibody is SEQ ID NO: 74, and the light chain sequence is SEQ ID NO: 75. The KNY-IL-4Rα antibody cross-reacts with human, monkey, and rat IL-4Rα. KNY-IL-4Rα antibody light chain amino acid sequence: KNY-IL-4Rα antibody heavy chain amino acid sequence: (II) The purity of the antibodies and their antibody fragments was characterized using SEC-HPLC. The SEC-HPLC results for the KNY-IL-4Rα antibody fragment scFv (SEQ ID NO: 76) and two KNY-IL-4Rα antibody fragments VHH (VHH1 sequence shown in SEQ ID NO: 77, and VHH2 sequence shown in SEQ ID NO: 78) are shown in Table 1 below. The results showed that the monomer purity of the antibodies and their antibody fragments exceeded 90%, making them suitable for subsequent experimental development. Table 1 SEC_HPLC test results of exemplary antibodies / antibody fragments The relevant sequences of the antibodies are as follows: (III) The binding affinity of the antibodies and their fragments to the human IL-4R protein was evaluated using surface plasmon resonance. The SPR results for the KNY-IL-4Rα antibody fragment scFv and two KNY-IL-4Rα antibody fragment VHH are shown in Figure 1. The results showed that both the antibodies and their fragments had strong binding activity to the human IL-4R protein. (IV) After IL-4 binds to IL-4R, it causes downstream STAT6 phosphorylation and activation. Using a reporter gene assay, the antibodies or antibody fragments prepared above were tested for blocking STAT6 activation on HEK293-STAT6 reporter cells. HEK293-STAT6 reporter cells were prepared using the following method: the full-length human STAT6 gene was cloned into the eukaryotic expression vector pSecCAG containing the hygromycin B resistance gene by molecular cloning technology to obtain the pSecCAG-hSTAT6-hyg plasmid. Four or five tandem repeats of the C / EBP-STAT6 response element were inserted into the multiple cloning site region of the pGL4.22-Luc-puro vector located in front of the TK simplified promoter to obtain the pGL4-4×STAT6 luc-puro and pGL4-5×STAT6 luc-puro plasmids. pSecCAG-hSTAT6-hyg was transferred into HEK293 cells using cell electroporation technology, and the cells were screened for about two weeks by adding 200 μg / ml hygromycin B selection culture medium to obtain a cell population containing HEK293-hSTAT6 positive cell lines (HEK293-hSTAT6 mix pool). Then, HEK293-hSTAT6mix pool cells were electroporated with pGL4-4×STAT6 luc-puro and pGL4-5×STAT6 luc-puro plasmids, respectively, and 1μg / ml puromycin selection medium was added for continuous screening for about a week. Then, 1μg / ml puromycin or 200μg / ml hygromycin B antibiotic selection medium was used to continue alternating screening for about a week to obtain a cell population containing HEK293-hSTAT6-4×STAT6 luc positive cell lines (HEK293-hSTAT6-4×STAT6 luc mix pool) or a cell population containing HEK293-hSTAT6-5×STAT6 luc positive cell lines (HEK293-hSTAT6-5×STAT6 luc mix pool). Next, the HEK293-hSTAT6-4×STAT6 luc mix pool and the HEK293-hSTAT6-5×STAT6 luc mix pool were subcloned and plated into 96-well cell culture plates at 1 cell / well. The cells were cultured at 37°C in a 5% CO2 incubator. After single clones emerged, positive clones were screened and verified with 100 ng / ml IL-4. Finally, HEK293-STAT6 reporter cells that responded well to IL-4 or IL-13 were obtained. HEK293-STAT6 reporter gene cells were resuspended in complete medium containing 10% FBS, 1% double antibody, and 1% L-glutamine, and the cells were cultured at a rate of 3 × 10 450 μL of cells / well were added to a 96-well plate and cultured overnight. KNY-IL-4Rα antibody, KNY-IL-4Rα antibody fragment scFv, KNY-IL-4Rα antibody fragment VHH-1, and KNY-IL-4Rα antibody fragment VHH-2 were each diluted 1:4 in complete culture medium starting at a concentration of 40 μg / mL. 25 μL of the serially diluted antibody or antibody fragment was added to each well, with two replicates for each dilution. 25 μL of 0.6 ng / mL IL-4 (manufacturer: Peprotech) was then added to each well, gently mixed, and the cells were cultured in a 37°C, 5% CO2 cell culture incubator for 6 hours. Fluorescence intensity was measured using a luciferase assay kit. The results showed that the antibody or antibody fragment effectively antagonized IL-4-induced STAT6 activation. The blocking activities of KNY-IL-4Rα antibody, KNY-IL-4Rα antibody fragment scFv, and two KNY-IL-4Rα antibody fragment VHH are shown in Figure 2 , with IC50 values of 0.009, 0.074, 0.006, and 0.006 nM, respectively. (V) The DT3C method was used to evaluate the endocytic activity of various IL-4Rα antibodies in HEK293-IL-4R stably transfected cells. DT3C can bind to the Fc segment of the antibody and form a mAb-DT3C conjugate, simulating ADC drugs. The cell viability detected by CCK8 can reflect the antibody-mediated cell endocytosis activity.
[0253] -
[0258] Paragraph) Prepare HEK293-IL-4Rα stable cell line, the specific preparation method is as follows: the expression plasmid containing the full-length sequence of hIL-4Rα and PEI are mixed in Opti-MEM medium at a ratio of 1:3 and allowed to stand at room temperature for 20 minutes. Take out the cells inoculated in the 6-well plate the day before, and observe under a microscope that the cell confluence is about 80%. Aspirate the DMEM medium (Gibco) and add 4.5ml of preheated Opti-MEM medium (Gibco). Add the plasmid-PEI mixture dropwise to the cells, shake gently, and culture in a 37℃ carbon dioxide incubator; after 24 hours, add 1μg / ml concentration of eukaryotic screening agent puromycin (Gibco) for screening and culture. Cells grown in the screening medium are observed under a microscope, and subclone screening is performed by a step-by-step dilution method. Wait for the single clone cells to fill the well plate and perform FACS detection. Aspirate the culture medium, rinse the cells with PBS buffer, add 200 μl of trypsin for brief digestion, and then add 700 μl of complete culture medium to terminate digestion. Take 300 μl of the cell suspension for staining, and continue to incubate the remaining cells in a 37°C incubator. Add 500 μl of 0.5% BSA / PBS to each tube of cells to be stained, centrifuge at 200 × g for 3 minutes, and repeat washing twice. Take 2 μl of control antibody (Sino Biological, Cat: 10402-R209) as the primary antibody and add it to 800 μl of 1% BSA / PBS solution to a final concentration of 10 μg / ml; add 100 μl to each tube and incubate on ice for 1 hour. Similarly, add 500 μl of 0.5% BSA / PBS to each tube, centrifuge at 200 × g for 3 minutes, and repeat washing twice. Add 100 μl of the secondary antibody, FITC-conjugated Affini-Pure Goat Anti-Rabbit IgG (BD Biosciences, Cat: 554020), at a 1:200 dilution to each tube and incubate on ice for 1 hour in the dark. Similarly, add 500 μl of 0.5% BSA / PBS to each tube and centrifuge at 200 × g for 3 minutes. Repeat washing three times. Resuspend the cells in 300 μl of PBS and analyze them on a flow cytometer to obtain monoclonal HEK293 cells stably expressing hIL-4Rα. HEK293-IL-4R stably transfected cells in the logarithmic growth phase were resuspended in DMEM medium containing 10% FBS (low IgG) and plated at 5×10 3 100 μL of cells / well were added to a 96-well plate. In one experiment, dupilumab, KNY-IL-4Rα antibody, anti-KLH hIgG4, and DT3C were diluted in a 1:5 ratio using DMEM medium containing 10% FBS (low IgG) at a starting concentration of 120 μg / mL. Equal volumes of the diluted antibodies and DT3C were mixed, incubated at 37°C for 30 minutes, and 100 μL / well of the mixture was added to the cell plate. The plate was then incubated in a 37°C, 5% CO2 cell culture incubator for 3 days. After the cell culture was completed, the cell culture medium was discarded, and 100 μL / well of 10% CCK8 (prepared in 1640 medium) was added. The plate was incubated in a 37°C, 5% CO2 cell culture incubator for 3 hours. The absorbance was measured at 450 nm using a microplate reader. Exemplary results are shown in FIG3A . Both KNY-IL-4Rα antibody and Dupilumab have potent endocytic activity in HEK293-IL-4R stably transfected cells, with IC50 values of 0.008 nM and 0.017 nM, respectively. In another experiment, DT3C (starting at 12 μg / mL, or 160 nM) was diluted 1:4 in DMEM medium containing 10% FBS (low IgG). The diluted DT3C was then mixed with equal volumes of 4 μg / mL antibody. The mixture was incubated at 37°C for 30 minutes, and 100 μL / well was added to the cell plate. The plate was then incubated in a 37°C, 5% CO2 incubator for 3 days. After the cell culture was completed, the cell culture medium was discarded, and 100 μL / well of 10% CCK8 (prepared in 1640 medium) was added. The plate was incubated in a 37°C, 5% CO2 incubator for 3 hours, and the absorbance was measured at 450 nm using a microplate reader. Exemplary results are shown in Figure 3B. KNY-IL-4Rα antibody, Dupilumab, AMG132, CBP-201, AK120, and MG-K10 all have potent endocytosis activity in HEK293-IL-4R stably transfected cells, with IC50 values of 0.098 nM, 0.296 nM, 0.091 nM, 0.107 nM, 0.250 nM, and 0.094 nM, respectively. Relative activity (%) = (OD 实验孔 -OD 空白孔 ) / (OD 对照孔 -OD 空白孔 )*100% Dupilumab is a marketed fully humanized antibody targeting IL-4Rα, with the Chinese name Dupilumab. AMG132, CBP-201, AK120, and MG-K10 are self-expressed, prior-art IL-4Rα antibodies. The CBP-201 sequence was selected from the exemplary antibody L1020H1031 in patent WO2017211319A1; the AK120 sequence was selected from the exemplary antibody 13E5H4L4 in patent WO2020135710A1; the MG-K10 sequence was selected from the exemplary antibody 236-Hu in patent WO2021208881A1; and the AMG132 sequence was selected from the exemplary antibody MAb12B5 in patent US8679487B2. (VI) Using pHrodo fluorescent dye (pHrodo TM The endocytic activity of KNY-IL-4Rα antibody, KNY-IL-4Rα-Fab (heavy chain sequence as shown in SEQ ID NO: 79, light chain sequence as shown in SEQ ID NO: 80), KNY-IL-4Rα-VHH-1, and KNY-IL-4Rα-scFv was detected by a dye-labeling method. pHrodo TMThe dye does not show a signal under neutral conditions, but fluoresces in the acidic environment of the lysosome after being internalized. HEK293-IL-4R stably transfected cells in the logarithmic growth phase were resuspended in DMEM complete medium containing 10% FBS and incubated at 5×10 4 Cells / well / 100 μL were added to a 96-well plate. KNY-IL-4Rα antibody, KNY-IL-4Rα-Fab, KNY-IL-4Rα-VHH-1, KNY-IL-4Rα-scFv, Anti-KLH hIgG4, etc. were respectively detected by pHrodo TM Deep Red tetrafluorophenyl (TFP) ester refer to the instructions for the steps (pHrodo TM pHrodo fluorescent labeling was performed using the Antibody Labeling Kit (Cat. No. P35355, Invitrogen). After labeling, the cells were diluted with DMEM complete medium supplemented with 10% FBS and added to a 96-well cell culture plate at a working concentration of 33 nM (Figure 3C) or 5 μg / mL (Figure 3D). An equal volume of complete medium was then added to control wells. After incubation on ice for 1 hour, cells were washed once with 200 μL / well of DMEM complete medium supplemented with 10% FBS. Prewarmed DMEM complete medium supplemented with 10% FBS was then added at 100 μL / well and incubated in a 37°C, 5% CO2 cell culture incubator. After incubation at the corresponding time points, 100 μL / well of PI (1:100) solution was added, incubated on ice for 5 minutes, and the supernatant was removed by centrifugation. The cells were washed twice with 150 μL / well of PBS containing 1% BSA. PBS was then added to the cells at 50 μL / well for resuspending, and fluorescence intensity was measured in the Cy5 channel on a flow cytometer. Exemplary results are shown in Figures 3C and 3D. KNY-IL-4Rα antibody, KNY-IL-4Rα-Fab, KNY-IL-4Rα-VHH-1, and KNY-IL-4Rα-scFv all had strong endocytosis-mediating activity. Example 2: Design of siRNA The siRNA sequences used in this example share common characteristics: all siRNAs are duplexes consisting of a 19-base sense strand and a 21-base antisense strand, with a two-base overhang at the 3' end of the antisense strand. The sense and antisense strands are complementary, and 2'--F modifications are located only at positions 7, 8, and 9 of the sense strand, and 2'--F modifications are located only at positions 2, 6, 14, and 16 of the antisense strand. Except for the 2'--F modification, all other modifications are 2'--O--Me modifications. Phosphorothioate linkages are used between the first and second, and second and third, nucleotides at the 5' and 3' ends of each siRNA strand. (I) siRNA library design was performed based on the sequence information of the human full-length IL-4Rα transcript. A 19-base sense strand / passenger strand was designed for the full-length human IL-4Rα, which is complementary to a 21-base antisense strand / guide strand, with two nucleotides protruding from the 3' end of the antisense strand. Base, sugar, and phosphate modifications well described in the field of RNAi were used to improve the stability of siRNA and reduce nonspecific reactions. The selection of siRNA oligonucleotides was based on a combination of features that were beneficial to their knockdown efficacy. The siRNA sequences for human IL-4Rα are shown in Table 2. (II) Bioinformatics siRNA library design targeting full-length human JAK1 transcripts. siRNAs targeting full-length human JAK1 were designed using a similar approach to that used for IL-4Rα. The 19-mer sense strand is complementary to the 21-mer antisense strand, with a 2-nucleotide overhang at the 3' end of the antisense strand, ensuring efficient binding of the siRNA molecule and loading of the RNA-induced silencing complex (RISC). The sequences of the siRNAs targeting human JAK1 are shown in Table 4. (III) Bioinformatics siRNA library design targeting human full-length STAT6 transcripts. The design of this part also follows the method for IL-4Rα and JAK1, emphasizing the design of siRNA targeting the specific region of STAT6. The 19-base sense chain is complementary to the 21-base antisense chain, and the design of the antisense chain with 2 nucleotides protruding from the 3' end combines sequence specificity and RNAi efficiency. When selecting siRNA, the key role of STAT6 in immune response and cell differentiation was taken into consideration, and the candidate siRNA was comprehensively scored based on these functions. The efficiency and specificity of the screened siRNA in reducing STAT6 expression were verified by cell culture and molecular biology experiments, such as real-time PCR and quantification of protein levels. The siRNA sequences targeting human STAT6 are shown in Table 3. The mRNA sequence of human full-length IL-4Rα (NM_000418.4) used to design siRNA sequences targeting is as follows: The names, sequences and other information of the exemplary siRNAs targeting human full-length IL-4Rα mRNA that were initially screened are shown in Table 2 below: Table 2 siRNA sequences targeting human IL-4Rα The mRNA sequence of human full-length STAT6 (NM_003153.5) used to design siRNA sequences targeting is as follows: Table 3 siRNA sequences targeting human STAT6 The mRNA sequence of human full-length JAK1 (NM_002227.4) used to design siRNA sequences targeting is as follows: Table 4 siRNA sequences targeting mouse JAK1 Example 3: siRNA Sequence and Synthesis The specific steps of siRNA sequence synthesis and annealing are as follows: Synthesis of siRNA sequences: 1) Solid-phase synthesis conditions and reagents: Phosphoramidite chemical synthesis was performed on a 500 nmol scale solid-phase support using an LK-48 synthesizer (Lingkun Bio). The solid-phase support was a controlled pore glass Auxiliary synthesis reagents and 2-cyanoethyl phosphoramidite monomers (including 2′-deoxy-2′-fluoro, 2′-O-methyl, RNA, DNA, and 5′-Amino-Modifier C6-TFA Phosphoramidite) were from Wuhu Huaren Technology Co., Ltd. or Beijing Dinaxingke Biotechnology Co., Ltd. 2) Treatment of Phosphoramidite Monomers: Additional phosphoramidite monomers were obtained through commercial purchase, in-house preparation, or custom synthesis. A 50 mM solution of phosphoramidite monomer in acetonitrile or a 1:1 acetonitrile:dichloromethane solution was used for the synthesis. 3) Deprotection and coupling: The deprotection reagent was 3% trichloroacetic acid / dichloromethane solution, the reaction time was 30 seconds, and the deprotection was repeated 4 times. The coupling reaction used 0.25M 5-benzylthiotetrazolium (BTT) acetonitrile solution, the reaction time was 160 seconds, and the coupling was repeated 3 times. 4) Formation of phosphorothioate bonds: A 50 mM 1:1 acetonitrile:pyridine solution prepared with N,N-dimethyl-N'-(3-thioxo-3H-1,2,4-dithiazol-5-yl)formamidine was used for oxidation for 120 seconds and two cycles. 5) Capping treatment: using 10% acetic anhydride / tetrahydrofuran solution and N-methylimidazole / pyridine / tetrahydrofuran solution, the capping time is 20 seconds, and the capping is repeated twice. 6) Oligonucleotide Cleavage and Purification: After solid-phase synthesis, the oligonucleotides were treated with a 3:1 ammonia:ethanol mixture at 45°C for 16 hours to remove unstable protecting groups. The oligonucleotides were precipitated with 10% v / v 5M NaCl and 3 volumes of anhydrous ethanol, centrifuged at 4°C, and the supernatant removed. The oligonucleotides were re-dissolved in deionized water and purified using an Agilent 1260 HPLC. 7) Quantification and Quality Control: After freeze-drying, the solution was desalted by salt exchange, and then quantitatively analyzed by LC-MS and UV spectroscopy. The concentration of the oligonucleotide solution was determined by OD260 using a micro-spectrophotometer. Annealing of siRNA sequences: 1) Mixing and incubation: Mix the sense strand and antisense strand in equal molar ratios and incubate in a 95°C water bath for 5 minutes. 2) Slow cooling: Then slowly return to room temperature within 2-3 hours to form double-stranded siRNA. 3) Quality inspection: Confirm the concentration and information of each double-stranded siRNA before use in subsequent antibody coupling experiments. Through the above detailed synthesis and annealing steps, it is ensured that the prepared siRNA sequence has high purity (more than 70%) and specificity, and is suitable for further biological experiments and applications. LC-MS detection parameters: Column: Agilent AdvanceBio RP-mAb C4, 2.1 × 100 mm, 3.5 μm Mobile phase A: 0.1% FA-water solution Mobile phase B: 0.1% FA-acetonitrile solution Flow rate: 0.3 mL / min Chromatographic gradient: Mass spectrometry acquisition mode: positive ion Mass spectrometry acquisition m / z range: 900-10000 Example 4: In vitro screening of IL-4Rα siRNA (I) Single-dose 10nM concentration screening Hep3B cells were resuspended in complete medium containing 10% FBS and cultured at 10 4 Cells were plated at a density of 100 cells / well / 100 μL (96-well plate) and 0.3 μL Lipofectamine TM RNAiMAX transfection reagent (Thermo) was mixed with 1 pmoL of siRNA (not conjugated with an antibody) and allowed to stand for 5 minutes before adding it to the cells for a single dose of 10 nM transfection. The cells were cultured in a 37°C incubator with 5% CO2 for 24 hours and then used Total RNA of the cells was extracted using 96 Fast Cell RNA Kit (Beijing Quanshijin Biotechnology Co., Ltd.) and dissolved in 40 μL / well DEPC water. 8 μL RNA was reverse transcribed into cDNA at 37°C for 5 min and 85°C for 5 sec using 2 μL of reverse transcription reagent HiScript III RT SuperMix for qPCR (Nanjing Novogene Biotechnology Co., Ltd.). After the cDNA was diluted 3 times with ultrapure water, the expression of the IL-4Rα gene was evaluated by RT--qPCR (AceQ Universal U+Probe Master Mix, Nanjing Novogene Biotechnology Co., Ltd.). The siRNA sequences screened using the above method were evaluated for their knockdown activity in the positive cell line Hep3B cells to identify candidate siRNA sequences with better activity. The negative control group was the scramble-1 siRNA transfection group. In this embodiment, compared with the residual value (%) of the IL-4Rα gene expression in the negative control group, the lower the residual value, the better the siRNA activity. Table 5 shows the activity of exemplary IL-4Rα siRNAs in Hep3B cells at a concentration of 10 nM. Sequences with lower residual values were selected for IC50 screening. The siRNA names and the residual values of IL-4Rα gene expression are shown in Table 5 below: Table 5. siRNA sequence single dose concentration screening results Note: @10nM indicates the detected siRNA concentration is 10nM. (II) Gradient concentration IC50 screening Hep3B cells were cultured at 10 4The cells were plated at a density of 10 cells / well (96-well plate), and the transfection reagent RNAimax was mixed with the siRNA. Then, 5-fold gradient dilution was performed using Opti-MEM, with a starting concentration of 10nM, 7 concentration gradients, and 3 replicates for each concentration. The gradient diluted complex was added to the cells for multiple dose transfection. 24 hours after transfection, the total RNA of the cells was extracted and reverse transcribed into cDNA using a reverse transcription kit, and then the expression of the IL-4Rα gene was evaluated by RT-qPCR. The specific experimental steps refer to the above-mentioned Example 4 (a). The siRNA sequences screened using the above method were evaluated for their activity in the positive cell line Hep3B cells to identify candidate siRNA sequences with better activity. The data shown in this example are expressed as the maximum inhibition rate (MAX KD, %) compared to the negative control group. The larger the MAX KD, the smaller the IC50 value, which means that the siRNA activity is better. The negative control group is the scramble-1 siRNA transfection group. Table 6 shows the activity of exemplary IL-4Rα siRNA at dose concentrations in Hep3B cells. The molecules with better activity were selected for the next step of conjugate synthesis. The siRNA sequences and corresponding screening results are shown in Table 6 below: Table 6 siRNA sequence gradient concentration IC 50 Screening results table Example 5: In vitro screening of JAK1 siRNA library (1) Screening by single dose concentration The cells were resuspended in complete medium containing 10% FBS and plated at 2 × 10 4 Cells / well / 100μL density were plated (96-well flat-bottom plates) and a single dose transfection was performed using RNAiMAX transfection reagent. After transfection, the total RNA of the cells was extracted and reverse transcribed into cDNA using a reverse transcription kit, and then the expression of the JAK gene was evaluated by RT-qPCR. The specific experimental steps refer to the aforementioned Example 4 (I). The siRNA sequences screened using the above method were evaluated for their activity in positive cell lines / B16F10 and Hepa1-6 cells to identify candidate siRNA sequences with better activity. In this embodiment, the negative control group was a scramble-1 siRNA transfection group. Compared with the residual value (%) of the negative control group, the lower the residual value, the better the siRNA activity. Residual values below 50% entered the IC50 screening. The human-targeted JAK1 reference sequence (JAK1-ref, sense chain: GGACAUCAGCUACAAGCGA (SEQ ID NO: 59); antisense chain: UCGCUUGUAGCUGAUGUCCUU (SEQ ID NO: 60)) was taken from the HJ1D8 sequence (sense: GGACAUCAGCUACAAGCGAUA (SEQ ID NO: 61), antisense: UCGCUUGUAGCUGAUGUCCUU (SEQ ID NO: 62)) of the patent publication US20220298512A1. In this example, 11 siRNA sequences were designed based on the reference sequence. Their activity in mouse B16F10 and Hepa1-6 cells was evaluated at a concentration of 10 nM to identify candidate siRNA sequences with enhanced activity. In this example, the negative control group consisted of a group transfected with scramble-1 siRNA. Compared to the residual value (%) in the negative control group, a lower residual value indicates greater siRNA activity. Table 7 Screening results of siRNA sequences at single dose concentration in B16F10 and Hepa1-6 cells Note: @B16F10 indicates experiments performed with B16F10 cells, and @Hepa1-6 indicates experiments performed with Hepa1-6 cells. (II) IC50 screening at multiple dose concentrations The cells were plated at 2 × 10 4 / well / 100 μL density plating (96-well flat bottom plate), using RNAiMAX transfection reagent according to the starting concentration of 10nM, 4-fold dilution gradient dose transfection. After transfection, the total RNA of the cells was extracted and reverse transcribed into cDNA using a reverse transcription kit, and then the expression of the JAK gene was evaluated by RT-qPCR. For specific experimental steps, refer to the above-mentioned Example 4 (I) and (II). The siRNA sequences screened using the above method were evaluated for their activity in the positive cell line B16F10 cells to identify candidate siRNA sequences with better activity. In this embodiment, the negative control group was a scramble-1 siRNA transfection group. Compared with the residual value (%) of the negative control group, the lower the residual value, the better the siRNA activity. The residual value below 50% entered the IC50 screening. The above method was used to evaluate the activity of the five candidate sequences with better activity and the JAK1-ref sequence in B16F10 cells. Table 8 siRNA sequence gradient concentration screening results in B16F10 cells Example 6: In vitro screening of STAT6 siRNA library (1) IC analysis with multiple dose concentrations 50 filter Hep3B cells and B16F10 cells were cultured at 2×10 4 / well / 100 μL density plating (96-well flat bottom plate), gradient dose transfection was performed using RNAiMAX transfection reagent. After transfection, total RNA of the cells was extracted and reverse transcribed into cDNA using a reverse transcription kit, and then the expression of the STAT6 gene was evaluated by RT-qPCR to identify candidate siRNA sequences with better activity. For specific experimental steps, refer to the above-mentioned Example 4 (II). In this embodiment, the negative control group was a scramble-1 siRNA transfection group. Compared with the residual value (%) of the negative control group, the smaller the residual value, the greater the MAX KD (maximum knockdown), and the smaller the IC50, the better the siRNA activity. Table 9 Screening results of STAT6 siRNA gradient concentration in B16F10 and Hep3B cells Example 7: Synthesis of IL-4Rα Antibody-siRNA Conjugate Using (4-(N-maleimidomethyl)cyclohexane-1-carboxylic acid succinimidyl ester)-C6 (SMCC-C6) as Linker Exemplary conjugation of IL-4Rα antibody to IL-4Rα siRNA was performed using the SMCC-C6 linker. An exemplary IL-4Rα antibody is the KNY-IL-4Rα antibody prepared in Example 1. An exemplary IL-4Rα siRNA is a duplex siRNA with a 19-base sense strand complementary to the antisense strand, a 21-base antisense strand, and a two-nucleotide overhang at the 3' end of the antisense strand. The sense strand sequence (5' to 3') is CAGAUUUCAGAAUCUAUAA (SEQ ID NO: 63), and the antisense strand sequence (5' to 3') is UUAUAGAUUCUGAAAUCUGCC (SEQ ID NO: 64), i.e., "IL4R_ENST00000395762_0707_0724" herein. The 5' end of the sense strand of the siRNA contains a C6-NH2 conjugation handle, which is linked to the siRNA passenger strand via a phosphodiester at the terminal base. Step 1: SMCC-C6-siRNA preparation Purified, annealed NH2-C6-siRNA was dissolved in 50 mM phosphate buffer (pH 7.4) containing 1 mM EDTA to a concentration of 10 mg / ml. SMCC was dissolved in DMSO, and 10 equivalents of SMCC was added dropwise to the NH2-C6-siRNA to a DMSO concentration of 10%. The reaction mixture was vortexed and shaken at 200 rpm in a 25°C water bath for 2 hours. The resulting reaction mixture was exchanged four times using a 3KD ultrafiltration centrifuge tube with 50 mM phosphate buffer (pH 6.5) containing 1 mM EDTA to remove DMSO and unreacted excess SMCC. Step 2: Reduction of antibody interchain disulfide bonds using TCEP The antibody solution was exchanged into 50 mM phosphate buffer (pH 6.5) containing 1 mM EDTA to a concentration of 10 mg / ml. 2 equivalents of TCEP (10 mM aqueous solution) were added to the solution and shaken at 200 RPM in a 25°C water bath shaker for 2 hours. Step 3: SMCC-C6-siRNA conjugated to antibodies At room temperature, add 1.5 equivalents of SMCC-C6-siRNA prepared in step 1 dropwise to the reduced antibody solution from step 2. Vortex to mix thoroughly, and shake at 200 RPM in a 25°C water bath for 2 hours. The resulting reaction mixture was exchanged four times using a 50KD ultrafiltration centrifuge tube to 20 mM TRIS buffer (pH 8.0). Step 4: Purification 1. Column: Cytiva, HiTrap Capto Q ImpRes, 7mm ID×25mm, 36-44μm 2. Solvent A: 20 mM TRIS-citrate buffer, pH 8.0; Solvent B: 20 mM TRIS-citrate, 1.5 M NaCl, pH 8.0; Flow rate: 1.0 ml / min 3. Gradient: The DAR1 and DAR>2 antibody-siRNA conjugates were separated and purified using the above-mentioned anion exchange chromatography method using an SCG-P protein purifier. The separated fractions were collected and concentrated, and the solution was exchanged into pH 7.4 PBS. Step 5: Analysis of the Purified Antibody-Nucleic Acid Conjugate The purified conjugate was characterized by mass spectrometry or SDS-PAGE. (1)SDS-PAGE method. The IL-4Rα antibody prepared in Example 1 and the conjugate obtained in Step 4 were first added to a loading buffer containing 1% mercaptoethanol and mixed thoroughly, followed by denaturation at 95°C for 10 minutes. The results are shown in Figure 4 . Lane 1 represents the antibody prepared in Example 1, with bands corresponding to the light and heavy chains having molecular weights of approximately 24 kDa and 50 kDa, respectively. Lanes 2 to 6 represent the various purified fractions obtained in Step 4. Compared to Lane 1, Lanes 3 to 6 exhibit new band signals between 50 and 70 kDa. Since the molecular weight of the siRNA sense chain (SS) after SMCC-C6 conjugation is approximately 7 kDa, this new band represents the molecular signal of the reduced IL-4Rα antibody heavy chain-SMCC-C6-siRNA SS chain conjugate. This indicates that a conjugate is formed between the IL-4Rα antibody and siRNA via the SMCC-C6 linker. (2) UPLC-RP-MS method. The antibody or the product from step 4 was injected directly without TCEP reduction. LC-MS detection parameters are as follows: Column: Waters ACQUITY Premier Protein SEC, 4.6*150 mm, 1.7 μm, Mobile phase: 100 mM ammonium acetate Flow rate: 0.35 mL / min Column temperature: 25°C Chromatographic gradient: Mass spectrometry acquisition mode: positive ion Use a high-performance liquid chromatograph to introduce the sample into a mass spectrometer. Set the chromatographic conditions to optimize separation, and select the appropriate ionization method and mass spectrometry detection parameters. Analyze the sample using the LC-MS system to obtain a mass spectrum of the conjugate. UPLC-RP-MS analysis was performed on the antibody prepared in step 2 and the conjugate obtained in step 4. The LC-MS analysis results are shown in Figures 5 and 6. As a control, Figure 5 shows a single clear peak at m / z 73472.0, indicating the main mass peak of the IL-4Rα monoclonal antibody treated in step 2, which demonstrates the purity and consistency of the antibody under the analytical conditions. The mass spectrum in Figure 6 shows multiple peaks, the most prominent of which is located at m / z 80181.6. This peak represents the conjugate formed by the heavy chain of the reduced IL-4Rα monoclonal antibody and the SS chain of the siRNA via the SMCC-C6 linker, indicating that the conjugation reaction was successful. The purified fractions were analyzed using native MS, as shown in Figure 7. Figure 7A shows the main peak at m / z 160581.5. Based on molecular weight, this peak represents the complete AOC (DAR1) of the IL-4Rα monoclonal antibody coupled to one IL-4Rα siRNA. Based on peak area calculation, DAR1 accounts for 86.7% of the AOC. Figure 7B shows the main peak at m / z 174214.2. Based on molecular weight, this peak represents the complete AOC (DAR2) of the IL-4Rα monoclonal antibody coupled to two IL-4Rα siRNAs. Based on peak area calculation, DAR2 accounts for 100%. This demonstrates that a purified, intact fraction with a single DAR value can be obtained. LC-MS analysis confirmed that the KNY-IL-4Rα antibody formed a conjugate with SMCC-C6 and siRNA, with an appropriate molecular mass. This provided important structural information for further functional studies and biological evaluation. These analytical results will enable further investigation of the conjugate's biodistribution, pharmacokinetics, and efficacy in disease models. Simultaneously, the isolated conjugate characteristics and purity were evaluated using size exclusion chromatography-1, anion exchange chromatography-1 or anion exchange chromatography-2 or cation exchange chromatography-1, and analytical HPLC. An exemplary analysis method is as follows: Size Exclusion Chromatography-1 1. Column: Tosoh Bioscience, TSKgle G3000SW XL, 7.8mm ID*30cm, 5μm 2. Mobile phase: 100mM phosphate + 100mM sodium sulfate buffer solution 3. Flow rate: 0.5ml / min, 30min Anion exchange chromatography-1 1. Column: Sepax Technologies, Proteomix SAX-NP5, 4.6×250mm, 5μm 2. Mobile phase A: 80% 10 mM sodium phosphate (pH = 8), 20% acetonitrile; mobile phase B: 80% 0.6 M sodium perchlorate (pH = 8), 20% acetonitrile 3. Flow rate: 1.0ml / min 4. The gradient is shown in Table 10 below: Table 10 Anion Exchange Chromatography-1 Mobility Concentration Gradient Anion Exchange Chromatography-2 1. Column: Thermo Scientific, PropacTM SAX--10, Bio LCTM, 4×250mm 2. Mobile phase A: 80% 10 mM TRIS (pH = 8), 20% ethanol; mobile phase B: 80% 10 mM TRIS (pH = 8), 20% ethanol, 1.5 M NaCl; 3. Flow rate: 0.75ml / min 4. The gradient is shown in Table 11 below: Table 11 Anion Exchange Chromatography-2 Mobility Concentration Gradient Cation exchange chromatography-1 1. Column: Thermo Scientific, PropacTM Elite WCX, 4×150mm, 5μm 2. Mobile phase A: 20 mM MES, (pH = 6.9); Mobile phase B: 20 mM MES + 150 mM NaCl, (pH = 6.9) 3. Flow rate: 0.8ml / min 4. The gradient is shown in Table 12 below: Table 12 Cation Exchange Chromatography-1 Mobility Concentration Gradient According to the above analysis method, the peak time of the antibody nucleic acid conjugate is 5 to 18 minutes, and the purity is above 50%. Example 8: In vitro activity of IL-4Rα antibody-IL-4Rα siRNA conjugate 1. Binding of Antibody-IL-4Rα siRNA Conjugate to IL-4Rα Flow cytometry (FACS) was used to evaluate the binding of the KNY-IL-4Rα antibody prepared in Example 1 and the anti-IL-4Rα antibody-IL-4Rα siRNA conjugate prepared in Example 7 to HEK293-IL-4Rα stably transfected cell lines or positive expression cell lines. HEK293_hIL-4Rα stably transfected cells or Hep3B cells were first washed twice with 4% FBS / PBS solution, and then blocked with a blocking solution containing ChromPure Mouse IgG (whole molecule) diluted to 100 μg / mL in 4% BSA / PBS solution. After blocking at 4°C for 30 minutes, 5×10 4Cells were seeded at a density of 100 μL / well in a 96-well U-shaped plate. KNY-IL-4Rα antibody and KNY-IL-4Rα antibody-IL-4Rα siRNA conjugate were diluted fourfold at a starting concentration of 1.67 nM and incubated with the cells at 4°C for 60 min. After the primary antibody incubation, the primary antibody was washed away with 4% FBS / PBS. The cells were then incubated with 50 μL of AF647 Goat Anti-human IgG and Fcγ secondary antibody, which carries AF647 fluorescence. After incubation on ice for 15 min, 50 μL of 1 mg / mL propidium iodide (PI) solution was added and incubated on ice for 5 min. The cells were then washed twice with 4% FBS / PBS, and 80 μL of PBS was added to each well to resuspend the cells. The cells were then analyzed by flow cytometry (IQue screener). GraphPad Prism software was used for data analysis. As shown in Figures 8A-8B, the KNY-IL-4Rα antibody-IL-4Rα siRNA conjugate, the KNY-IL-4Rα antibody-scramble siRNA conjugate, and the KNY-IL-4Rα antibody all bound to HEK293 stably transfected cells and Hep3B cells expressing human IL-4Rα in a dose-dependent manner. The IL-4Rα siRNA (19) in the KNY-IL-4Rα antibody-IL-4Rα siRNA conjugate is IL4R_ENST00000395762_0707_0724. The scramble siRNA sequence in the AOC negative control group is scramble-1. 2. Antibody-IL-4Rα siRNA conjugate-mediated endocytosis activity The DT3C method was used to evaluate the endocytic activity of the KNY-IL-4Rα antibody prepared in Example 1 and the KNY-IL-4Rα antibody-IL-4Rα siRNA conjugate prepared in Example 7 in HEK293-IL-4Rα stably transfected cells. HEK293-IL-4R stably transfected cells in the logarithmic growth phase were resuspended in DMEM medium containing 10% FBS (low IgG) and then incubated at 3.5×10 3Cells were added to a 96-well plate at a density of 100 μL per well. DT3C, starting at a concentration of 9 μg / mL (120 nM), was diluted 1:3 in DMEM containing 10% FBS (low IgG) for a total of nine concentration gradients. The diluted DT3C was mixed with equal volumes of 1 μg / mL antibody or antibody-siRNA conjugate. The mixture was incubated at 37°C for 30 minutes, and 100 μL / well was added to the cell plate. The plate was then cultured in a 37°C, 5% CO2 cell culture incubator for 3 days. After the cell culture was completed, the cell culture medium was discarded, and 10% CCK8 (prepared with 1640 medium) was added at 100 μL / well. The cells were incubated in a 37°C, 5% CO2 cell culture incubator for 3 hours. The absorbance was measured at 450 nm using a microplate reader, and the relative cell viability, which is reflected as endocytic activity, was calculated. Relative activity (%) = (OD experimental well - OD blank well) / (OD control well - OD blank well) * 100% Data analysis was performed using GraphPad Prism software. As shown in Figure 9, the endocytic activity of the KNY-IL-4Rα antibody-IL-4Rα siRNA conjugate and the KNY-IL-4Rα antibody in stably transfected cells was comparable, indicating that the conjugated siRNA did not affect the cellular endocytosis caused by the binding of the IL-4Rα antibody to IL-4Rα. The IL-4Rα siRNA (19) in the exemplary KNY-IL-4Rα antibody-IL-4Rα siRNA conjugate is IL4R_ENST00000395762_0707_0724. 3. In vitro knockdown mediated by free uptake of antibody-IL-4Rα siRNA conjugates In this example, the knockdown activity of the KNY-IL-4Rα antibody-IL-4Rα siRNA conjugate prepared in Example 7 and other anti-IL-4Rα antibody-IL-4Rα siRNA conjugates using non-KNY-IL-4Rα antibodies in HEK293-IL-4Rα stably transfected cells was evaluated by free uptake. The preparation of the other anti-IL-4Rα antibody-IL-4Rα siRNA conjugates can refer to the steps of Example 7, the only difference being the type of antibody used. HEK293-IL-4Rα stably transfected cells were resuspended in high-glucose DMEM medium containing 10% FBS and cultured at 8×10 3 / well / 100 μL density was plated into a 96-well plate. The antibody-IL-4Rα siRNA conjugate was diluted with a starting concentration of 200nM or 600nM (Dupilumab) in a 1:3 gradient, with 3 replicates for each concentration, and added to a 96-well cell plate. The cells were cultured in a 37°C incubator containing 5% CO2. After 72 hours, the supernatant was discarded, and the cell RNA was extracted using an RNA extraction kit and reverse transcribed into cDNA. The expression of the IL-4Rα gene was evaluated by RT-qPCR. For specific experimental steps, refer to the above-mentioned Example 4 (I) and (II). All treatment groups were normalized to the untreated cell group. The IL-4Rα siRNA (1098) in the exemplary IL-4Rα antibody-IL-4Rα siRNA conjugate is IL4R_ENST00000395762_1098_1115. IL-4Rα siRNA (19) is IL4R_ENST00000395762_0707_0724. The negative control sequence scramble siRNA is scramble-2. Referring to Figures 10A-10E of the specification, AOCs of complete DAR1 or DAR2 formed by linker-coupling IL-4Rα siRNA (1098 or 19) using different types of anti-IL-4Rα antibodies exhibited significant knockdown activity after free uptake for 72 hours in HEK293-IL-4Rα stably transfected cells. The negative control siRNA sequences used in the present invention are shown in Table 13. Table 13 Example 9: In vitro activity of IL-4Rα antibody-JAK1 siRNA conjugate 1. Binding of Antibody-JAK1 siRNA Conjugate to IL-4Rα Flow cytometry (FACS) was used to evaluate the binding of KNY-IL-4Rα antibody and KNY-IL-4Rα antibody-JAK1 siRNA conjugate to HEK293-IL-4Rα stably transfected cells or positive expression cell line Hep3B. HEK293_IL-4Rα stably transfected cells or Hep3B cells were first washed twice with 4% FBS / PBS solution, and then blocked with 4% BSA / PBS solution containing ChromPure Mouse IgG (whole molecule) at 100 μg / mL. After blocking at 4°C for 30 minutes, 5×10 4Cells were seeded at a density of 100 μL / well in a 96-well U-shaped plate. KNY-IL-4Rα antibody and KNY-IL-4Rα antibody-JAK1 siRNA conjugate were serially diluted fourfold at a starting concentration of 1.67 nM and incubated with the cells at 4°C for 60 min. After the primary antibody incubation, the primary antibody was washed away with 4% FBS / PBS. The cells were then incubated with 50 μL of AF647 Goat Anti-human IgG and Fcγ secondary antibody, which carries AF647 fluorescence, for further incubation on ice for 15 min. After that, 50 μL of 1 mg / mL propidium iodide (PI) solution was added and incubated on ice for 5 min. The cells were then washed twice with 4% FBS / PBS, and 80 μL of PBS was added to each well to resuspend the cells. The cells were then analyzed by flow cytometry (IQue screener). Data were analyzed using GraphPad Prism software. As shown in Figures 11A-11B, both the KNY-IL-4Rα antibody-JAK1 siRNA conjugate and the KNY-IL-4Rα antibody bind to HEK293 stably transfected cells and Hep3B cells expressing human IL-4Rα in a dose-dependent manner, with comparable binding activity. The JAK1 siRNA in the exemplary KNY-IL-4Rα antibody-JAK1 siRNA conjugate is JAK1-ref. The negative control scramble siRNA is scramble-1. 2. Antibody-JAK1 siRNA conjugate-mediated knockdown. The knockdown activity of the KNY-IL-4Rα antibody-JAK1 siRNA conjugate was evaluated on primary B cells derived from human PBMC. Take fresh anticoagulated whole blood and an equal volume of PBS and mix them upside down. Slowly add it along the wall to 1 / 2 volume of Ficoll, centrifuge at 800g for 30 minutes at room temperature, carefully aspirate the PBMC layer, add 10 ml of PBS to resuspend, centrifuge at 250g for 10 minutes at room temperature, and discard the supernatant to obtain PBMC cells. Then use the magnetic bead method B cell separation kit (Miltenyyi Biotec, 130-091-151) to separate B cells according to the instructions. After the separation, resuspend them in 1× PBS, centrifuge at 300g for 5 minutes at 4°C, and repeat the operation. Resuspend the cells in 1640 complete medium supplemented with 10% FBS, 50μM 2-mercaptoethanol, and 1% double antibody and count them according to 1×10 5The cells were plated in a flat-bottom 96-well plate at a density of 100 μL / well. Three-fold serial dilutions of the KNY-IL-4Rα antibody-JAK1 siRNA conjugate or the KNY-IL-4Rα antibody-scramble siRNA conjugate were then added to a 3-fold serial dilution with an initial concentration of 200 nM. The cells were incubated in a 5% CO2, 37°C incubator. After 72 hours, the supernatant was discarded, and cellular RNA was extracted using an RNA extraction kit and reverse-transcribed into cDNA. JAK1 gene expression was assessed by RT-qPCR. For specific experimental steps, refer to the aforementioned Example 4 (i) and (ii). As shown in Figure 12, the KNY-IL-4Rα antibody conjugated to the reference sequence of JAK1 (KNY-IL-4Rα antibody-JAK1 siRNA conjugate) was effectively knocked down by free uptake on human PBMC-derived B cells for 72 hours. The JAK1 siRNA in the exemplary KNY-IL-4Rα antibody-JAK1 siRNA conjugate is JAK1-ref. The negative control group was KNY-IL-4Rα antibody-scramble siRNA conjugate, and the scramble siRNA sequence was scramble-2. Example 10: In vitro activity of IL-4Rα antibody and STAT6 siRNA conjugates (I) IL-4Rα antibody-STAT6 siRNA conjugate-mediated knockdown. STAT6-positive cells were incubated with IL-4Rα antibody-STAT6 siRNA conjugate for 24-72 hours. Total RNA was extracted and reverse-transcribed into cDNA, and STAT6 expression was measured by RT-qPCR. IL-4Rα antibody-STAT6 siRNA conjugate effectively knocked down STAT6, with a maximum inhibition rate exceeding 50%. Example 11: In vivo efficacy of IL-4Rα antibody and siRNA (targeting IL-4Rα / JAK1 / STAT6) conjugate In this example, IL-4Rα humanized mice were used to evaluate the in vivo efficacy of IL-4Rα antibody-siRNA conjugates. Clean-grade, 14-week-old female IL-4Rα humanized mice were purchased from Biocytogen (Beijing) Pharmaceutical Technology Co., Ltd. After 7 days of animal acclimation, three female IL-4Rα humanized mice were randomly assigned to each group and administered via the tail vein at a volume of 5 kg / mL, 80 mg / kg, of KNY-IL-4Rα antibody, KNY-IL-4Rα antibody-IL-4Rα siRNA conjugate, KNY-IL-4Rα antibody-JAK1 siRNA conjugate, KNY-IL-4Rα antibody-STAT6 siRNA conjugate, or an equal volume of PBS (vehicle group). All dosing groups were diluted with PBS. Since unconjugated siRNA (without a targeting group) does not mediate cellular endocytosis, it was not necessary to administer it separately in this example. Blood was collected before administration, and on the 7th, 14th, 21st, and 28th days after administration to detect the level of TARC (thymus and activation regulated chemokine) in mouse serum. A decrease in TARC levels can be used as an indication of suppression of type 2 immune response. The day the mouse was dosed (only once during the experiment) was recorded as day 0, the next 7 days were recorded as day 7, and so on. An ELISA kit (Xitang Bio) that recognizes mouse TARC and IgE was used to detect the level of TARC in mouse serum according to the instructions. Briefly, the standard and the diluted serum to be tested were added to the reaction plate and incubated at 37°C for 40 minutes. After washing the plate 4 times, the first antibody working solution, enzyme-labeled antibody working solution, substrate working solution, and stop solution were incubated in sequence, and the absorbance value was read at 450nM using an enzyme-labeled plate within 30 minutes. The KNY-IL-4Rα antibody is coupled to siRNA that recognizes human IL-4Rα, siRNA that recognizes mouse JAK1, and siRNA that recognizes mouse STAT6 to form an antibody-nucleic acid conjugate. The STAT6 siRNA in the exemplary KNY-IL-4Rα antibody-STAT6 siRNA conjugate is STAT6_1599. The JAK1 siRNA in the exemplary KNY-IL-4Rα antibody-JAK1 siRNA conjugate is ENSMUST00000102781_958_975 (the targeting sequence is 100% homologous in humans and mice). The IL-4Rα siRNA (1098) in the exemplary KNY-IL-4Rα antibody-IL-4Rα siRNA conjugate is IL4R_ENST00000395762_1098_1115. IL-4Rα antibodies have been shown to inhibit the release of TARC and IgE by suppressing type 2 inflammatory responses (Allergy. 2020 May; 75(5):1188-1204. doi:10.1111 / all.14151.). As shown in Figure 13, compared with the control vehicle group, a single tail vein injection of KNY-IL-4Rα antibody or KNY-IL-4Rα antibody-siRNA conjugate reduced the serum TARC level of mice from day 7 to day 21. On day 28, serum TARC in mice in the KNY-IL-4Rα antibody-treated group rebounded to above baseline levels. The KNY-IL-4Rα antibody-IL-4Rα siRNA conjugate (Figure 13A) and the KNY-IL-4Rα antibody-STAT6 siRNA conjugate (Figure 13B) still maintained the knockdown of TARC levels, indicating that the KNY-IL-4Rα antibody-siRNA conjugate has a longer-lasting efficacy than the KNY-IL-4Rα antibody. As shown in Figure 14, compared with the control vehicle group, a single tail vein injection of the KNY-IL-4Rα antibody or the KNY-IL-4Rα antibody-siRNA conjugate can reduce the serum IgE level of mice for 21 days. Example 12: Efficacy of IL-4Rα Antibody siRNA (IL-4Rα / JAK1 / STAT6) Conjugate in Cynomolgus Monkeys In this example, the efficacy of IL-4Rα antibody siRNA conjugate was further evaluated using cynomolgus monkeys. After 7 days of adaptation, cynomolgus monkeys (3-5 years old, female, 2-5 kg) were randomly divided into groups. Each group was intravenously infused with 80 mg / kg of KNY-IL-4Rα antibody, KNY-IL-4Rα antibody-IL-4Rα siRNA conjugate, KNY-IL-4Rα antibody-JAK1 siRNA conjugate, and KNY-IL-4Rα antibody-STAT6 siRNA conjugate, respectively. All dosing groups were diluted with PBS. Blood was collected before administration and on the 14th and 28th days after administration. The level of IgE in monkey serum was detected using an ELISA kit (Abnova, catalog number KA2450) that recognizes monkey IgE according to the instructions. The standard and the diluted serum to be tested were added to the reaction plate and incubated at 25°C for 60 minutes. After washing the plate 5 times, TMB working solution and stop solution were added. The absorbance was read at 450 nM using an ELISA plate within 5 minutes. The STAT6 siRNA in the exemplary KNY-IL-4Rα antibody-STAT6 siRNA conjugate is STAT6_1596. The JAK1 siRNA in the exemplary KNY-IL-4Rα antibody-JAK1 siRNA conjugate is ENSMUST00000102781_958_975. The IL-4Rα siRNA (1098) in the exemplary KNY-IL-4Rα antibody-IL-4Rα siRNA conjugate is IL4R_ENST00000395762_1098_1115. As shown in Figure 15, a single administration of the KNY-IL-4Rα antibody-IL-4Rα siRNA conjugate group and the KNY-I-4Ra antibody-STAT6 siRNA conjugate group significantly reduced the monkey serum IgE level on day 28. In addition, the KNY-IL-4Ra antibody-JAK1siRNA conjugate group also significantly reduced the monkey serum IgE level on days 14 and 28.
Claims
1. An antibody nucleotide conjugate, characterized in that The antibody-nucleotide conjugate is formed by conjugating (i) a polynucleotide ligand to (iii) a target protein binding portion via (ii) a linker.
2. The antibody-nucleotide conjugate according to claim 1, wherein The target protein is interleukin 4 receptor (IL-4R), and the IL-4R includes type I IL-4R (type I IL4 receptor) and type II IL-4R (type I IL4 receptor).
3. The antibody-nucleotide conjugate according to claim 1 or 2, wherein The target protein is IL-4Rα.
4. The antibody-nucleotide conjugate according to claim 3, wherein The target protein binding portion binds to IL-4Rα on the cell surface and causes endocytosis of the cell.
5. The antibody-nucleotide conjugate according to claim 4, wherein The target protein binding portion is an antibody or an antigen-binding fragment thereof that specifically binds to IL-4Rα.
6. The antibody-nucleotide conjugate according to claim 5, wherein The antibody or antigen-binding fragment thereof has a structure selected from the group consisting of IgG-scFv, nanobody, BiTE, diabody, DART, TandAb, scDiabody, scDiabody-CH, triabody, minibody, minibody, TriBi minibody, scFv-CH3 KIH, Fab-scFv-Fc KIH, Fab-scFv, scFy-CH-CL-scFv, F(ab')2, F(ab')2-scFv2, scFv-KIH, Fab-scFy-Fc, tetravalent HCAb, scDiabody-Fc, diabody-FC, and tandem scFv-Fc.
7. The antibody-nucleotide conjugate according to claim 5 or 6, wherein The antibody or antigen-binding fragment thereof comprises a heavy chain CDR1, a heavy chain CDR2, a heavy chain CDR3, a light chain CDR1, a light chain CDR2, and a light chain CDR3, wherein the heavy chain CDR1 comprises the amino acid sequence set forth in SEQ ID NO: 65, the heavy chain CDR2 comprises the amino acid sequence set forth in SEQ ID NO: 66, the heavy chain CDR3 comprises the amino acid sequence set forth in SEQ ID NO: 67, the light chain CDR1 comprises the amino acid sequence set forth in SEQ ID NO: 68, the light chain CDR2 comprises the amino acid sequence set forth in SEQ ID NO: 69, and the light chain CDR3 comprises the amino acid sequence set forth in SEQ ID NO: 70; Preferably, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO: 71 and a light chain variable region with an amino acid sequence as shown in SEQ ID NO: 73; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO: 72 and a light chain variable region with an amino acid sequence as shown in SEQ ID NO:
73.
8. The antibody-nucleotide conjugate according to any one of claims 1 to 7, wherein The polynucleotide ligand is RNA; Preferably, it includes siRNA, ASO, PMO, mRNA, dsRNA, miRNA; Preferably, ASO and siRNA are included.
9. The antibody-nucleotide conjugate according to any one of claims 1 to 8, wherein The polynucleotide ligand comprises a targeting region that targets the target gene mRNA, and the targeting region is complementary to the target region in the target gene mRNA.
10. The antibody-nucleotide conjugate according to claim 9, wherein The target protein encoded by the target gene is a type 2 inflammatory disease-related protein; Preferably, the target protein is selected from one or more proteins in the IL-4R signaling pathway, for example, the interleukin cell family (including but not limited to IL-4Rα, IL13Ra1, CD132), the JAK kinase protein family (including but not limited to JAK1 / JAK2 / JAK3 kinases), the STAT factor family (including but not limited to STAT1, STAT2, STAT3, STAT4, STAT5A, STAT5B, STAT6 factors), and the janus kinase protein family (including but not limited to TYK).
11. The antibody-nucleotide conjugate according to any one of claims 1 to 10, wherein The polynucleotide ligand is double-stranded RNA; Preferably, each chain of the polynucleotide ligand is 15-25 nucleotides in length; preferably, each chain of the siRNA is 19-23 nucleotides in length; Preferably, the polynucleotide ligand comprises an antisense strand having a length of 19 to 23 nucleotides, wherein the antisense strand comprises a sequence complementary to the target site in the target gene mRNA; Preferably, the polynucleotide ligand comprises a sense strand having a length of 19 to 23 nucleotides.
12. The antibody-nucleotide conjugate according to any one of claims 1 to 11, wherein The polynucleotide ligand comprises a 3'-overhang sequence having a length of one or more nucleotides, wherein the 3'-overhang sequence is present on the antisense strand and / or the sense strand; Preferably, the antisense strand has an overhang; Preferably, the sense strand has an overhang; Preferably, the polynucleotide ligand comprises a 3'-overhang sequence of two nucleotides in length; Preferably, the 3'-overhang sequence is present on the sense strand; preferably, the overhang sequence is selected from the group consisting of: GG, GA, GC, UC, UG, UU, UA, CA, CC, CG, CU, AA, AG, AU and AC; Preferably, the 3'-overhang sequence is present on the antisense strand; preferably, the overhang sequence is selected from the group consisting of: UU, UC, UA, UG, GA, GG, GU, GC, TT, AG, AU, AA, AC, CA, CC and U; more preferably, the overhang sequence is UU.
13. The antibody-nucleotide conjugate according to any one of claims 1 to 12, wherein The polynucleotide ligand comprises an antisense strand and a sense strand each ranging from 19 to 23 nucleotides in length; Preferably, the sense strand and the antisense strand of the polynucleotide ligand form a duplex region; Preferably, the sense strand and the antisense strand of the polynucleotide ligand are duplex structures with 19 / 21 pairing, 21 / 21 pairing, 21 / 23 pairing or 23 / 23 pairing, respectively; Preferably, the polynucleotide ligand comprises a 3'-overhang sequence of two nucleotides in length, wherein the 3'-overhang sequence is present on the antisense strand, and wherein the sense strand is 19 nucleotides in length and the antisense strand is 21 nucleotides in length, such that the sense strand and the antisense strand form a duplex portion of 19 nucleotides in length; Preferably, the polynucleotide ligand comprises a 3'-overhang sequence of two nucleotides in length, wherein the 3'-overhang sequence is present on the antisense strand and the sense strand, and wherein the sense strand is 21 nucleotides in length and the antisense strand is 21 nucleotides in length, such that the sense strand and the antisense strand form a duplex portion of 19 nucleotides in length; Preferably, the polynucleotide ligand comprises a 3'-overhang sequence of two nucleotides in length, wherein the 3'-overhang sequence is present on the antisense strand, and wherein the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length, such that the sense strand and the antisense strand form a duplex portion of 21 nucleotides in length; Preferably, the polynucleotide ligand comprises a 3'-overhang sequence of two nucleotides in length, wherein the 3'-overhang sequence is present on the antisense strand and the sense strand, and wherein the sense strand is 23 nucleotides in length and the antisense strand is 23 nucleotides in length, such that the sense strand and the antisense strand form a duplex portion of 21 nucleotides in length.
14. The antibody-nucleotide conjugate according to any one of claims 1 to 13, wherein The polynucleotide ligand comprises at least one modified nucleotide; Preferably, the modification is selected from the group consisting of a 2'-methoxy (m) modification, a 2'-fluoro (f) modification, and a phosphorothioate (s) modification; Preferably, the modified nucleotide comprises a 2'-modification; Preferably, the 2'-modification is a modification selected from the group consisting of 2'-aminoethyl modification, 2'-fluoro modification, 2'-O-methyl modification, 2'-O-methoxyethyl modification and 2'-deoxy-2'-fluoro-β-d-arabinonucleotide modification; Preferably, all nucleotides of the polynucleotide ligand are modified.
15. The antibody-nucleotide conjugate according to any one of claims 1 to 14, wherein The polynucleotide ligand comprises at least one modified internucleotide linkage; Preferably, the at least one modified internucleotide bond is a phosphorothioate bond; Preferably, the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand comprises a phosphate analogue; Preferably, the phosphate analog is oxymethylphosphonate, vinylphosphonate or malonylphosphonate.
16. The antibody nucleotide conjugate according to any one of claims 1 to 15, wherein At least one nucleotide of the polynucleotide ligand is conjugated to one or more targeting ligands; Preferably, each targeting ligand comprises a carbohydrate, an amino sugar, cholesterol, a polypeptide, or a lipid; Preferably, each targeting ligand comprises an N-acetylgalactosamine (GalNAc) moiety; Preferably, the GalNAc moiety is a monovalent GalNAc moiety, a divalent GalNAc moiety, a trivalent GalNAc moiety or a tetravalent GalNAc moiety.
17. The antibody-nucleotide conjugate according to any one of claims 1 to 16, wherein The polynucleotide ligand is siRNA, and the target gene of the siRNA is selected from one or more of the following: The target gene of the siRNA is the IL-4Rα gene, and the siRNA comprises any one or more nucleotide sequences listed in Table 2 or modified forms thereof; The target gene of the siRNA is the STAT6 gene, and the siRNA comprises any one or more nucleotide sequences listed in Table 3 of the specification or modified forms thereof; and The target gene of the siRNA is the JAK1 gene, and the siRNA comprises any one or more nucleotide sequences listed in Table 4 of the specification or modified forms thereof.
18. The antibody-nucleotide conjugate according to any one of claims 1 to 17, wherein The linker is selected from one or more of a peptide linker, a polyethylene glycol linker, and an isothiocyanate linker; preferably, the isothiocyanate linker is selected from one or more of SMPB, LC-SMCC, and SMCC; more preferably, the isothiocyanate linker is selected from SMCC-C6.
19. The antibody nucleotide conjugate according to any one of claims 1 to 18, wherein The antibody nucleotide conjugate linker has the structure shown in L-4: Among them, the wavy line The position indicates the location of attachment to the polynucleotide ligand or target protein binding portion.
20. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the antibody-nucleotide conjugate according to any one of claims 1 to 19, and optionally, further comprises any pharmaceutically acceptable carrier.
21. The pharmaceutical composition according to claim 20, wherein The pharmaceutical composition is formulated to be administered to a subject in need of treatment by intravenous injection, subcutaneous injection, intraperitoneal injection or intramuscular injection.
22. A method for treating a type 2 inflammatory disease in a subject in need thereof, characterized in that The method comprises administering to the subject a therapeutically effective amount of the antibody-nucleotide conjugate of any one of claims 1-19 or the pharmaceutical composition of claim 20 or 21.
23. The method according to claim 22, wherein The polynucleotide ligand in the antibody-nucleotide conjugate is capable of downregulating the expression of the target gene.
24. The method according to claim 22 or 23, wherein The type 2 inflammatory diseases include chronic sinusitis, asthma, atopic dermatitis, allergic rhinitis, chronic sinusitis with nasal polyps, prurigo nodularis, chronic obstructive pulmonary disease, pemphigus, and urticaria.
25. Use of the antibody-nucleotide conjugate according to any one of claims 1 to 19 or the pharmaceutical composition according to claim 20 or 21 in the preparation of a medicament for treating a type 2 inflammatory disease, preferably, the type 2 inflammatory disease is selected from chronic sinusitis, asthma, atopic dermatitis, allergic rhinitis and chronic sinusitis with nasal polyps, prurigo nodularis, chronic obstructive pulmonary disease, pemphigus, and urticaria.
26. A method for delivering a polynucleotide into a cell, comprising conjugating the polynucleotide to an antibody to form the antibody-nucleotide conjugate according to any one of claims 1 to 19, wherein the antibody specifically binds to a cell membrane surface protein of the cell, and the cell membrane surface protein mediates endocytosis of the cell after binding to the antibody; and The antibody-nucleotide conjugate is contacted with the cell.