Compositions and methods for multi-modal immune activation and delivery

Abstract

This invention provides therapeutic agents comprising polymer macromolecules, each of which comprises a plurality of linked pattern recognition receptor (PRR) agonists, wherein each PRR agonist comprises an RNA molecule capable of activating a specific PRR. Specifically, the patterns of the PRR agonists are designed to reproduce different portions of the characteristics of one or more PRR agonists for one or more pathogens. Multiple PRR agonists are formulated together in a manner that allows for combined presentation in mammalian subjects to modulate an immune response.

Description

Cross-reference to related applications

[0001] This application claims priority to U.S. Provisional Application No. 63 / 604458, filed November 30, 2023, the entire contents of which are incorporated herein by reference.

[0002] Statement regarding federally funded research or development This invention was developed with government support under license number EB035261 granted by the National Institutes of Health (NIH). The government holds certain rights to this invention.

[0003] sequence list The accompanying computer-readable sequence list text, titled "UM_42619_601_SequenceListing.xml", was created on November 25, 2024, and is 8,953 bytes in size. Its entire contents are incorporated herein by reference. Technical Field

[0004] This invention provides therapeutic agents comprising polymer macromolecules, each of which comprises a plurality of linked pattern recognition receptor (PRR) agonists, wherein each PRR agonist comprises an RNA molecule capable of activating a specific PRR. Specifically, the patterns of the PRR agonists are designed to reproduce different portions of the characteristics of one or more PRR agonists for one or more pathogens. Multiple PRR agonists are formulated together in a manner that allows for combined presentation in mammalian subjects to modulate an immune response. Background Technology

[0005] Despite the significant success of cancer immunotherapies such as immune checkpoint blockade over the past decade, clinical benefits remain limited to a small percentage of patients. Vaccines offer promising strategies for enhancing immunotherapy and training the immune system to recognize and attack tumor cells. The development of effective vaccines is also crucial for many infectious diseases that remain leading causes of morbidity and mortality in infants, children, and the elderly. Generating potent and durable immune responses against infectious diseases or cancer is a key challenge in designing effective vaccines and cancer immunotherapies. Such effective immune responses require the internalization of viral, bacterial, or tumor antigens by antigen-presenting cells (APCs) to trigger cellular and humoral immune responses. Activation of the innate immune system is essential in mediating these responses. The innate immune system has evolved to perceive and respond to complex combinations of pathogen-associated molecular patterns via pattern recognition receptors (PRRs) such as toll-like receptors (TLRs) and retinoic acid-induced gene I (RIG-I). To this end, numerous synthetic innate immune agonists that activate specific PRRs have been developed as vaccine adjuvants for cancer and infectious diseases. However, currently only a few adjuvants are clinically approved for vaccines or cancer immunotherapies, often due to insufficient potency or excessive toxicity. The rational design of intrinsic immune agonists that can generate durable and safe immune responses remains a critical unmet need in vaccine development, particularly for subunit vaccines that typically require adjuvants, due to knowledge and technology gaps: (1) insufficient understanding of how agonists and their combinations mediate different immune responses; and (2) a lack of robust, modular agonist platforms capable of precisely modulating the spectrum of immune responses.

[0006] This invention addresses these needs. Summary of the Invention

[0007] Generating potent disease-specific immune responses is a key challenge in cancer immunotherapy and infectious disease vaccines, and despite significant successes, many cancer immunotherapies offer clinical benefit only in a small subset of patients. Utilizing the innate immune system—which has evolved to sense and respond to complex combinations of pathogen-associated molecular patterns—shows great promise for enhancing cancer immunotherapy and infectious disease vaccines. While many synthetic innate immune agonists that activate pattern recognition receptors (PRRs) have been developed as vaccine adjuvants, only a few have been clinically approved. The generation of durable immune responses faces key hurdles: (1) many current PRR agonist-based adjuvants rely on a single agonist, making it difficult to reproduce the recognition of natural pathogens by the innate immune system; (2) while mounting evidence suggests that combined PRR agonists can promote synergistic activation, control and understanding of the combined effects and spatial regulation of multiple agonists remain insufficient; and (3) further exacerbating these gaps is the lack of platforms for precisely modulating the combination and spatial arrangement of innate immune agonists. To address these knowledge and technology gaps, polymeric RNA macromolecules are engineered as multifunctional agonists and molecularly layer-defined scaffolds to shape immune responses via (1) precise spatial patterns and multivalence of PRR agonists; (2) combined control of innate immune signaling pathways; and (3) targeted self-delivery. The polymeric RNA molecules consist of numerous repetitive sequences, including double-stranded and single-stranded RNA regions that can activate specific PRRs and hybridize with complementary DNA strands linked to other innate immune agonists.

[0008] The experiments described herein resulted in the construction of a polyRNA scaffold modeled with a TLR9 agonist (CpG DNA oligomer) and a cGAS agonist (dsDNA oligomer), which is capable of activating multiple PRRs for multimodal innate immune activation. PolyRNAs can also serve as scaffolds for templated delivery biomolecules such as sugar- and lipid-based moieties, which can protect RNA from nuclease degradation and promote target cell uptake and / or endosome escape. For example, the innate immune cell targeting capabilities of fungal wall polysaccharides can be utilized to create bio-inspired “monolithic” synthetic sugar-RNAs that can target and activate antigen-presenting cells. This highly modular RNA scaffold platform has the potential to enable fundamental research into (1) how combinations and spatial arrangements of innate immune agonists function at the molecular, cellular, and organismal levels; and (2) the precise modulation of disease-specific immune responses for applications in cancer and infectious diseases. Additional experiments demonstrated the in vivo therapeutic efficacy of this polymeric RNA scaffold.

[0009] Therefore, the present invention provides therapeutic agents comprising polymer macromolecules, wherein each of the polymer macromolecules comprises a plurality of linked pattern recognition receptor (PRR) agonists, wherein each of the PRR agonists comprises an RNA molecule capable of activating a specific PRR. In particular, the patterns of the PRR agonists are designed to reproduce different portions of the characteristics of one or more PRR agonists for one or more pathogens. Multiple PRR agonists are formulated together in a manner that allows for combined presentation in mammalian subjects to modulate an immune response.

[0010] In some aspects, the present invention provides compositions comprising one or more polymer macromolecules, wherein each of the polymer macromolecules comprises a plurality of linked pattern recognition receptor (PRR) agonists, wherein each of the polymer macromolecules comprises at least two different PRR agonists, and wherein each of the PRR agonists comprises a nucleic acid molecule capable of activating a specific PRR. In some aspects, the plurality of linked PRR agonists are formulated together for combined presentation upon administration to a mammalian subject.

[0011] In some aspects, multiple linked PRR agonists are arranged to reproduce different portions of one or more PRR agonist characteristics of one or more pathogens. In some aspects, a particular PRR agonist among the multiple linked PRR agonists is present two or more times. In some aspects, the presence of two or more times is between 2 and 1,000,000 times. In some aspects, two or more different PRR agonists among the multiple linked PRR agonists are each present two or more times independently. In some aspects, the presence of two or more times is between 2 and 1,000,000 times.

[0012] In some respects, at least one of the PRR agonists includes a hairpin loop within the nucleic acid molecule.

[0013] In some aspects, at least one of the PRR agonists comprises single-stranded RNA (ssRNA) and / or single-stranded DNA (ssDNA) within a nucleic acid molecule. In some aspects, the ssRNA and / or ssDNA within the nucleic acid molecule are between 4 and 1000 bases.

[0014] In some respects, the percentage of guanine / uracil bases in ssRNA is between 0 and 100% (e.g., 0, 1, 2, 3, 4, 5, 10, 15, 20, 25, 27, 30, 35, 40, 50, 55, 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100%).

[0015] In some aspects, at least one of the PRR agonists comprises double-stranded RNA (dsRNA) and / or double-stranded DNA (dsDNA) within a nucleic acid molecule. In some aspects, the dsRNA and / or dsDNA within the nucleic acid molecule are between 1 and 500 base pairs.

[0016] In some respects, at least one of the PRR agonists includes a 5'-triphosphate moiety within the nucleic acid molecule.

[0017] In some respects, at least one of the PRR agonists includes a stem portion within the nucleic acid molecule.

[0018] In some aspects, multiple connected PRR agonists are arranged in a linear successive manner. In some aspects, each PRR agonist within a linearly connected PRR agonist series is sequentially positioned in a linear successive manner. In some aspects, multiple connected PRR agonists are arranged in a non-linear manner.

[0019] In some aspects, the plurality of PRR agonists is between 2 and 10,000 PRR agonists; or the plurality of PRR agonists is between 2 and 1,000 PRR agonists; or the plurality of PRR agonists is between 2 and 100 PRR agonists; or the plurality of PRR agonists is between 2 and 10 PRR agonists.

[0020] In some respects, the number of different PRR agonists within each polymer macromolecule is between 2 and 10,000; or the number of different PRR agonists within each polymer macromolecule is between 2 and 1,000; or the number of different PRR agonists within each polymer macromolecule is between 2 and 100; or the number of different PRR agonists within each polymer macromolecule is between 2 and 10.

[0021] In some aspects, the plurality of PRR agonists are selected from 3 PRR agonists, 4 PRR agonists, 5 PRR agonists, 6 PRR agonists, 7 PRR agonists, 8 PRR agonists, 9 PRR agonists, 10 PRR agonists, 11 PRR agonists, 12 PRR agonists, 13 PRR agonists, 14 PRR agonists, 15 PRR agonists, 16 PRR agonists, 17 PRR agonists, 18 PRR agonists, 19 PRR agonists, 20 PRR agonists, 25 PRR agonists, and 50 PRR agonists. In some respects, the various PRR agonists within each polymer macromolecule are selected from 3 PRR agonists, 4 PRR agonists, 5 PRR agonists, 6 PRR agonists, 7 PRR agonists, 8 PRR agonists, 9 PRR agonists, 10 PRR agonists, 11 PRR agonists, 12 PRR agonists, 13 PRR agonists, 14 PRR agonists, 15 PRR agonists, 16 PRR agonists, 17 PRR agonists, 18 PRR agonists, 19 PRR agonists, 20 PRR agonists, 25 PRR agonists, and 50 PRR agonists.

[0022] In some aspects, at least one of the polymer macromolecules and / or the composition further includes a targeting portion. In some aspects, at least one of the polymer macromolecules is associated with the targeting portion (e.g., composite, conjugation, encapsulation, absorption, adsorption, and incorporation). In some aspects, the composition is associated with the targeting portion (e.g., composite, conjugation, encapsulation, absorption, adsorption, and incorporation).

[0023] In some aspects, the targeted portion is selected from: vitamins, ligands, amines, peptide fragments, antibodies, aptamers, transferrin, antibodies or fragments thereof, sialic acid Lewis X antigen, lipids, lipids (including cationic, neutral and steroidal lipids, viral microsomes and liposomes), fungal cell wall polysaccharides, hyaluronic acid, mannan, mannose derivatives, glucose derivatives, cell-specific lectins, galactagogues, galactose lectins, lactose ceramides, steroidal derivatives, RGD sequences, EGF, EGF-binding peptides, urokinase receptor-binding peptides, platelet-reactive protein-derived peptides, albumin derivatives and / or molecules derived from combinatorial chemistry. In some aspects, the targeted portion is selected from: sialic acid, 9-N-(4H-thieno[3,2-c]chromene-2-carbamoyl)-Neu5Acα2-3Ga1β-4G1cNAc (TCCNeu5Ac), folic acid, methotrexate, folate, galactose residues, lactose, low-density lipoprotein (LDL), ovalbumin (OVA), lactobionic acid, mannan, mannose, mannose-rich glycoconjugates, mannosylated poly(L-lysine) (MPL), yeast polysaccharides, and other β-glucan, dextran, polyguanine, and apoB protein fragments.

[0024] In some aspects, at least one of the polymer macromolecules further comprises a fungal cell wall polysaccharide portion, wherein the fungal cell wall polysaccharide portion is conjugated to the polymer macromolecule, wherein the fungal cell wall polysaccharide portion is mannan or mannose; and / or the composition further comprises a fungal cell wall polysaccharide portion, wherein the fungal cell wall polysaccharide portion is mannan or mannose.

[0025] In some aspects, at least one of the polymer macromolecules further comprises one or more of mannan, mannose, β-glucan, N-acetylgalactosamine, polysaccharide A1, hyaluronic acid, α-galactosylceramide, cholesterol, and α-tocopherol succinate; and / or the composition further comprises one or more of mannan, mannose, β-glucan, N-acetylgalactosamine, polysaccharide A1, hyaluronic acid, α-galactosylceramide, cholesterol, and α-tocopherol succinate.

[0026] In some aspects, the composition is partially associated with liposomes, wherein the association is selected from complexation, conjugation, encapsulation, absorption, adsorption, and incorporation. And / or the polymer macromolecule is partially associated with liposomes, wherein the association is selected from complexation, conjugation, encapsulation, absorption, adsorption, and incorporation.

[0027] In some respects, each of the plurality of PRRs and PRR agonists is independently selected from: TLR2 and TLR2 agonists TLR3 and TLR3 agonists TLR4 and TLR4 agonists TLR5 and TLR5 agonists TLR7 / 8 and TLR7 / 8 agonists TLR9 and TLR9 agonists NOD1 and NOD1 agonists NOD2 and NOD2 agonists TLR2 / NOD2 and TLR2 / NOD2 agonists NOD1 / NOD2 and NOD1 / NOD2 agonists RIG1 / MDA5 and RIG1 / MDA5 agonists DAI and DAI agonists LRRFIP1 and LRRFIP1 agonists, AIM2 and AIM2 agonists RIG1 and RIG1 agonists Dectin-1 and Dectin-1 agonists Mincle and Mincle agonists STING and STING agonists MDA5 and MDA5 agonists LGP2 and LGP2 agonists DDX41 and DDX41 agonists DHX9 and DHX9 agonists DDX3 and DDX3 agonists DDX36 and DDX36 agonists DDX-1-DDX-21-DDX36 and DDX-1-DDX-21-DDX36 agonists, DDX60 and DDX60 agonists KU70 and KU70 agonists cGAS and cGAS agonists NLRP3 and NLRP3 agonists IFI16 and IFI16 agonist, LRRFIP1 and LRRFIP1 agonists, DAI and DAI agonists CDS and CDS agonists RLR and RLR agonists, CLR and CLR agonists IFIT1 and IFIT1 agonists IFIT2 and IFIT2 agonists IFIT3 and IFIT3 agonists, and IFIT5 and IFIT5 agonists.

[0028] In some aspects, at least one of the plurality of PRR agonists within a polymer macromolecule includes: one or more RIG-1 agonists, one or more TLR7 / 8 agonists, one or more TLR9 agonists, and one or more TLR3 agonists. In some aspects, one or more of the PRR agonists includes a hairpin loop. In some aspects, one or more of the RIG-1 agonists includes a 5'-triphosphate moiety. In some aspects, one or more of the TLR7 / 8 agonists includes ssRNA. In some aspects, one or more of the TLR7 / 8 agonists includes ssRNA having a guanine / uracil percentage between 0 and 100. In some aspects, one or more of the TLR3 agonists includes dsRNA. In some aspects, one or more of the TLR9 agonists includes ssDNA. In some aspects, one or more of the RIG1 agonists includes dsRNA or ssRNA.

[0029] In some respects, the composition is able to stimulate and / or modulate the innate immune response in mammalian subjects after administration to them.

[0030] In some respects, one or more of the polymer macromolecules also include one or more portions of a nucleic acid molecule that are not characterized as a PRR agonist.

[0031] In some aspects, the composition is used to induce an immune response to vaccine application. In some aspects, the composition, upon administration to the subject, is capable of stimulating an innate immune response in at least one cancer cell, wherein the mammalian subject has cancer. In some aspects, stimulating an innate immune response includes stimulating an innate cytokine response mediated by cytokines, wherein the innate cytokine response is mediated by type I interferon.

[0032] In some aspects, the composition further associates with the antigen, wherein the association is selected from complexing, conjugation, encapsulation, absorption, adsorption, and blending. And / or the polymer macromolecule further associates with the antigen, wherein the association is selected from complexing, conjugation, encapsulation, absorption, adsorption, and blending.

[0033] In some respects, the antigen is selected from the group consisting of: α-actin-4, Bcr-Abl fusion protein, Casp-8, β-linkin, cdc27, cdk4, cdkn2a, coa-1, dek-can fusion protein, EF2, ETV6-AML1 fusion protein, LDLR-fucosyltransferase AS fusion protein, HLA-A2, HLA-A11, hsp70-2, KIAAO205, Mart2, Mum-1, 2 and 3, neo-PAP, myosin class I, OS-9, pml-RARα fusion protein, PTPRK, K-ras, N-ras, triose phosphate isomerase, Bage-1, Gage 3, 4, 5, 6, 7, GnTV, Herv-K-mel, Lage-1, Mage-A1, 2, 3, 4, 6, 10, 12, Mage-C2, NA-88, NY-Eso-1 / Lage-2, SP17, SSX-2, and TRP2-Int2, MelanA (MART-I), gp100 (Pmel17), tyrosinase, TRP-1, TRP-2, MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, p15(58), CEA, RAGE, NY-ESO (LAGS), SCP-1, Hom / Mel-40, PRAME, p53, H-Ras, HER-2 / neu, BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR, Epstein-Barr virus antigen, EBNA, human papillomavirus (HPV) antigens E6 and E7, TSP-180, MAGE-4, MAGE-5, MAGE-6, p185erbB2, p180erbB-3, c-met, nm-23H1, PSA, TAG-72-4, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, β-linkin, CDK4, Mum-1, p16, TAGE, PSMA, PSCA, CT7, telomerase, 43-9F, 5T4, 791Tgp72, α-alpha-fetoprotein, 13HCG, BCA225, BTAA, CA 125, CA 15-3 (CA27.29\BCAA), CA 195, CA 242, CA-50, CAM43, CD68\KP1, CO-029, FGF-5, G250, Ga733 (EpCAM), human EGFR protein or fragments thereof, such as human EGFR residues 306-325 (SCVRACGADSYEMEEDGVRK (SEQ ID NO:1)) and residues 897-915 (VWSYGVTVWELMTFGSKPY (SEQ ID NO:2)).HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB / 70K, NY-CO-1, RCAS1, SDCCAG16, TA-90 (Mac-2 binding protein / cyclic protein C-related protein), TAAL6, TAG72, TLP, TPS, WT1 (and WT1-derived peptide sequences: WT1 126–134 (RMFPNAPYL (SEQ ID NO:3)), WT1 122–140 (SGQARMFPNAPYLPSCLES (SEQ ID NO:4)) and WT1 122–144 (SGQARMFPNAPYLPSCLESQPTI (SEQ ID NO:5)), MUC1 (and MUC1-derived peptides and glycopeptides, such as RPAPGS (SEQ ID NO:6), PPAHGVT (SEQ ID NO:7) and PDTRP (SEQ ID NO:6)). NO:8), LMP2, EGFRvIII, Idiotype, GD2, Ras mutant, p53 mutant, proteinase 3 (PR1), survivin, hTERT, sarcoma translocation breakpoint, EphA2, EphA4, LMW-PTP, PAP, ML-IAP, AFP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, ALK, androgen receptor, cyclin B1, polysialic acid, MYCN, RhoC, TRP-2, GD3, fucose GM1, mesothelin, sLe (animal), CYP1B1, PLAC1, GM3, BORIS, Tn, GloboH, NY-BR-1, RGS5, SART3, STn, carbonic anhydrase IX, PAX5, OY-TES1, spermin 17, LCK, HMWMAA, AKAP-4, XAGE 1. B7H3, podase, Tie2, Page4, VEGFR2, MAD-CT-1, FAP, PDGFR-α, PDGFR-β, MAD-CT-2, Fos-associated antigen 1, ERBB2, folate receptor 1 (FOLR1 or FBP), IDH1, IDO, LY6K, fms-associated tyrosine kinase 1 (FLT1, best known as VEGFR1), KDR, PADRE, TA-CIN (recombinant HPV16 L2E7E6), SOX2, neoantigen, and aldehyde dehydrogenase.

[0034] In some respects, the antigen is derived from its own antigen.

[0035] In some respects, the antigen is conjugated to the outer surface of the composition. And / or the antigen is conjugated to a polymer macromolecule.

[0036] In some aspects, the composition is associated with an adjuvant, wherein the association is selected from compounding, conjugation, encapsulation, absorption, adsorption, and blending; and / or the polymer macromolecule is associated with an adjuvant, wherein the association is selected from compounding, conjugation, encapsulation, absorption, adsorption, and blending.

[0037] In some aspects, the adjuvant is selected from the group consisting of: CPG, polyIC, poly-ICLC, 1018 ISS, aluminum salts (e.g., aluminum hydroxide, aluminum phosphate), Amplivax, BCG, CP-870, CP-893, CpG7909, CyaA, dSLIM, cytokines (such as GM-CSF, IL-2, IFN-α, Flt-3L), IC30, IC31, imiquimod, ImuFact IMP321, ISPatch, ISS, ISCMATRIX, Juvlmmune, LipoVac, MF59, monophospholipid A, Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, Montanide ISA-51, OK-432, OM-174, OM-197-MP-EC, ONTAK, PepTel.RTM, vector system, PLGA microparticles, imiquimod, remiquimod, gademod, 3M-052, SRL172, viral microsomes and other virus-like particles, YF-17D, VEGF trap, β-glucan, Pam3Cys, Aquila's QS21 stimulator, vardemisinin, AsA404 (DMXAA), 3M MEDI9197, glucanyl pyranosyl lipid adjuvants (GLA), GLA-SE, CD1d ligands (such as C20:2, OCH, AH04-2, α-galactosylceramide, α-C-galactosylceramide, α-mannoseceramide, α-fructoseceramide, β-galactosylceramide, β-mannoseceramide), STING agonists (e.g., cyclic dinucleotides, including cyclic [G(3',5')pA(3',5')p], cyclic [G(2',5')pA(3',5')p], cyclic [G(2',5')pA(2',5')p], cyclic diadenosine monophosphate, cyclic diguanosine monophosphate), CL401, CL413, CL429, flagellin, RC529, E6020, imidazoquinone-based small molecule TLR-7 / 8a (including its lipid analogues), viral microsomes, AS01, AS02, AS03, AS04, AS15, IC31, CAF01, ISCOM, cytokines (such as GM-CSF, IL-2, IFN-α, Flt-3L), bacterial toxins (such as CT and LT), any derivatives of adjuvants, and any combination of adjuvants.

[0038] In some aspects, the composition is associated with nanoparticles, wherein the association is selected from composite, conjugation, encapsulation, absorption, adsorption, and doping; and / or the polymer macromolecule is associated with nanoparticles, wherein the association is selected from composite, conjugation, encapsulation, absorption, adsorption, and doping.

[0039] In some aspects, the nanoparticles are selected from the group consisting of: sHDL nanoparticles, metal-polyhistidine-DOPE@liposomes, metal-polyhistidine-PEG, 4-arm-PEG-polyhistidine-metal hydrogels, sHDL-polyhistidine, fullerenes, metal-embedded fullerene briquette spheres, trimetallic nitride-templated metal-embedded fullerenes, single-walled and multi-walled carbon nanotubes, branched and dendritic carbon nanotubes, gold nanorods, silver nanorods, single-walled and multi-walled boron / nitrate nanotubes, carbon nanotube pods, carbon Nanohorns, carbon nanocarob pods, liposomes, nanoshells, dendritic polymers, any nanostructure, microstructure or derivative thereof formed using layer-by-layer processes, self-assembly processes or polyelectrolytes, microparticles, quantum dots, superparamagnetic nanoparticles, nanorods, cellulose nanoparticles, glass and polymer microspheres and nanospheres, biodegradable PLGA microspheres and nanospheres, gold nanoparticles, silver nanoparticles, carbon nanoparticles, iron nanoparticles, modified micelles, and metal-organic framework (MOF) coordination polymers (CP).

[0040] In some aspects, the composition is associated with one or more of the following: nanoparticles, liposomes, dendritic polymers, micelles, nanoemulsions, nanosuspensions, vesicles, nanocapsules, magnetic nanoparticles, lipoprotein-based carriers, and / or lipid complex nanoparticles; wherein the association is selected from complexing, conjugation, encapsulation, absorption, adsorption, and doping; and / or the polymer macromolecule is associated with one or more of the following: nanoparticles, liposomes, dendritic polymers, micelles, nanoemulsions, nanosuspensions, vesicles, nanocapsules, magnetic nanoparticles, lipoprotein-based carriers, and / or lipid complex nanoparticles; wherein the association is selected from complexing, conjugation, encapsulation, absorption, adsorption, and doping.

[0041] Some aspects of the present invention provide a method for treating or preventing immune dysregulation in a mammalian subject, comprising administering to the mammalian subject the composition of claim 1, wherein the administration results in stimulation and / or modulation of the mammalian subject's innate immune response.

[0042] In some respects, the mammalian subject suffers from a disease or condition characterized by the immune dysregulation. In some respects, the disease or condition is cancer, an infectious disease, an autoimmune disease, and / or an inflammatory disease.

[0043] In some respects, the cancers are selected from the group consisting of: breast cancer, brain cancer, thyroid cancer, prostate cancer, colorectal cancer, pancreatic cancer, cervical cancer, stomach cancer, endometrial cancer, liver cancer, bladder cancer, ovarian cancer, testicular cancer, head and neck cancer, skin cancer, mesothelial lining leukocyte carcinoma, esophageal cancer, muscle cancer, connective tissue cancer, lung cancer, adrenal cancer, kidney cancer, bone cancer, or testicular cancer and their metastases.

[0044] In some respects, the disease or condition is selected from one or more of the following: acne vulgaris; acute disseminated encephalomyelitis; acute hemorrhagic leukoencephalitis; Addison's disease; agammaglobulinemia; allergy; alopecia areata; Alzheimer's disease; amyotrophic lateral sclerosis; autoimmune anemia, hemolytic anemia; pernicious anemia; ankylosing spondylitis; anti-GBM / TBM nephritis; antiphospholipid syndrome; antisynthetic enzyme syndrome; temporal arteritis (also known as "giant cell arteritis"); juvenile arthritis; psoriatic arthritis; reactive arthritis (Rea syndrome); rheumatoid arthritis; asthma; Atherosclerosis; Atopic allergy; Atopic dermatitis; Autoimmune enteropathy; Autoimmune aplastic anemia; Barlow disease / Barlow concentric sclerosis; Bart syndrome; Behçet's syndrome; Berger's disease; Bickerstaff's encephalitis; Blau syndrome; Chronic bronchitis; Bullous pemphigoid; Bursitis; Autoimmune cardiomyopathy; Kassman's disease; Celiac disease; Chronic fatigue syndrome; Chronic inflammatory demyelinating polyneuropathy; Chronic relapsing multifocal osteomyelitis; Churg-Strauss syndrome Cerebral pemphigoid syndrome; primary biliary cirrhosis, Cogan syndrome; cold agglutinin disease; colitis; complement component 2 deficiency; connective tissue disease, mixed type; connective tissue disease, undifferentiated COPD (chronic obstructive pulmonary disease); cranial arteritis; CREST syndrome; cryoglobulinemia; Cushing's syndrome; cutaneous leukocytic vasculitis; interstitial cystitis; dacryoadenitis; Dego's disease; Dercum's disease; dermatitis; herpetic dermatitis; autoimmune progesterone dermatitis; dermatomyositis; diabetes mellitus; nephrotic diabetes insipidus Type 1 diabetes; diffuse systemic sclerosis of the cutaneous region; discoid lupus erythematosus; diverticulitis; Dresler syndrome; dysmenorrhea (menstrual cramps / pain); eczema; endometriosis; enthesitis-associated arthritis; eosinophilic fasciitis; eosinophilic gastroenteritis; acquired epidermolysis bullosa; erythema nodosum, primary mixed cryoglobulinemia; Evan syndrome; progressive ossifying fibrosis; fibromyalgia; fibrotic alveolitis; atrophic gastritis; gastrointestinal pemphigoid; giant cell arteritis; glomerulonephritis; Goodpasture's syndrome Syndrome); Acute gout; Arthritic gout; Graves' disease; Guillain-Barré syndrome (GBS); Hemolytic anemia; Hashimoto's encephalitis; Hashimoto's thyroiditis; Autoimmune hemolytic anemia; Allergic purpura; Autoimmune hepatitis; Viral hepatitis; Herpes gestationis; Hypogammaglobulinemia; Idiopathic inflammatory demyelinating disease; Idiopathic pulmonary fibrosis; Iga nephropathy; Intestinal obstruction (Ileus); Inclusion body myositis; Inflammatory bowel disease, Crohn's disease; Inflammatory bowel disease, ulcerative colitis;Inflammatory demyelinating polyneuropathy; autoimmune inner ear disease; interstitial cystitis; irritable bowel syndrome (IBS); juvenile idiopathic arthritis; juvenile rheumatoid arthritis; Kawasaki disease; kidney stones; Lambert-Eaton myasthenic syndrome; leukocytic vasculitis; lichen planus; sclerosing lichen; linear IgA disease (LAD); Lujarig's disease (also known as amyotrophic lateral sclerosis); lupus-like hepatitis; lupus; systemic lupus erythematosus; autoimmune lymphoproliferative syndrome; Majid syndrome; Meniere's disease; meningitis; microscopic polyangiitis; Miller-Fischer syndrome Symptoms; scleroderma; Muhar-Haberman disease; multiple sclerosis; multiple sclerosis; myasthenia gravis; myositis; inclusion body myositis; nephritis; nephrotic syndrome; neuromyelitis optica (also known as Dweck's disease); neuromuscular rigidity; neutropenia; neutropenia caused by myelosuppressive chemotherapy; ocular cicatricial pemphigoid; ocular inflammation (acute and chronic nonbacterial inflammation of the anterior segment of the eye); oculoclonus-myoclonus syndrome; Od thyroiditis; osteoarthritis; Paget's bone disease; relapsing rheumatoid arthritis; autoimmune pancreatitis; PANDAS (and streptococci); streptococcus Related pediatric autoimmune neuropsychiatric disorders; paraneoplastic cerebellar degeneration; Parkinson's disease; paroxysmal nocturnal hemoglobinuria (PNH); Parry-Ronberg syndrome; pars plana inflammation; Parsonnage-Turner syndrome; pelvic inflammatory disease; pemphigus; pemphigus vulgaris; nonrheumatic pericarditis; autoimmune peripheral neuropathy; perivenous encephalomyelitis; POEMS syndrome; polyarteritis nodosa; relapsing polychondritis; autoimmune polyendocrine syndrome; polymyalgia rheumatica; polymyositis; primary sclerosing cholangitis; progressive inflammatory neuropathy; prostatitis; chronic pseudogout; psoriasis; pure red cell aplasia; pyoderma gangrenosa; Rasmussen's encephalitis; Raynaud's phenomenon; Reiter's syndrome. Syndrome); Restless legs syndrome; Retinopathy of prematurity; Retroperitoneal fibrosis; Rheumatoid fever; Allergic rhinitis; Sarcoidosis; Schmidt syndrome; Schnitzler syndrome; Scleritis; Scleroderma; Systemic sclerosis; Sjögren's syndrome; Spondyloarthritis; Still's disease; Subacute bacterial endocarditis (SBE); Sussac syndrome; Sweet's syndrome; Sydenham's chorea; Sympathetic ophthalmia; Takayasu arteritis; Temporomandibular joint disorder (TMJD or TMD) or TMJ syndrome; Autoimmune thrombocytopenic purpura; Idiopathic thrombocytopenic purpura, Tolosa-Hunter syndrome; Transplant rejection; Transverse myelitis; Undifferentiated spondyloarthritis; Urticaria; Autoimmune uveitis; Nonrheumatic valvular disease; Vasculitis; Vitiligo and Wegener's granulomatosis.

[0045] In some respects, the cancer is selected from one or more of the following: bladder cancer, brain cancer, breast cancer, cervical cancer, ovarian cancer, colorectal cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, nasopharyngeal cancer, pancreatic cancer, prostate cancer, skin cancer, stomach cancer, gastric cancer, head and neck cancer, testicular cancer, melanoma, acute myeloid leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, T-cell lymphocytic leukemia, B-cell lymphoma, and uterine cancer.

[0046] In some respects, the autoimmune disorders are selected from systemic lupus erythematosus, Aicardi-Goutières syndrome, acute pancreatitis, age-dependent macular degeneration, alcoholic liver disease, liver fibrosis, metastasis, myocardial infarction, non-alcoholic steatohepatitis (NASH), Parkinson's disease, polyarthritis / fetal and neonatal anemia, sepsis, inflammatory bowel disease, and multiple sclerosis.

[0047] In some respects, the composition is administered in an amount that effectively modulates the adaptive immune response in the mammalian subject.

[0048] In some respects, the composition is administered intradermally, subcutaneously, intravenously, intraperitoneally, intraarterially, intrasheathically, intracystically, intraorbitally, intracardiacly, intradermally, transcutaneously, transtracheally, subepidermally, intra-articularly, intratumorally, subcystically, subarachnoidly, intraspinally, intrasternally, orally, sublingually, buccally, rectally, vaginally, nasally, or ocularly, or by infusion, inhalation, or nebulization.

[0049] In some cases, the site of application is the skin or subcutaneous tissue. In some cases, the site of application is the intestine. In some cases, the site of application is not the intestine. In some cases, the site of application is the respiratory tract.

[0050] In some respects, the composition is formulated to allow for systemic distribution of the PRR agonist after administration.

[0051] In some aspects, the composition is administered in multiple doses over a duration of administration, and the duration of administration is at least two weeks. In some aspects, the doses are administered subcutaneously daily or every other day.

[0052] In some respects, mammalian subjects are human patients. In some respects, human patients are immunosuppressed or immunocompromised. In some respects, human patients are elderly. In some respects, human patients are pediatric patients.

[0053] In some respects, the method further includes the co-administration of one or more additional therapeutic agents.

[0054] In some aspects, the additional therapeutic agent is selected from the group consisting of: disease-modifying antirheumatic drugs (e.g., leflunomide, methotrexate, sulfasalazine, hydroxychloroquine), biologics (e.g., rituximab, infliximab, etanercept, adalimumab, golimumab), nonsteroidal anti-inflammatory drugs (e.g., ibuprofen, celecoxib, ketoprofen, naproxen, piroxicam, diclofenac), analgesics (e.g., acetaminophen, tramadol), immunomodulators (e.g., anaerobiculin, abatacept), glucocorticoids (e.g., prednisone, methylprednisone), TNF-α inhibitors (e.g., adalimumab, penicillin, etanercept, golimumab, infliximab), IL-1 inhibitors, and metalloproteinase inhibitors. In some aspects, the therapeutic agent includes, but is not limited to, infliximab, adalimumab, etanercept, parenteral gold, or oral gold.

[0055] In some respects, the additional therapeutic agents are selected from the group consisting of: interleukin, hexamethylmelamine, amifostine, asparaginase, bleomycin, capecitabine, carboplatin, carmustine, clavibine, cisapride, cisplatin, cyclophosphamide, cytarabine, dacarbazine (DTIC), actinomycin D, docetaxel, doxorubicin, dronabinol, epoetin alpha, etoposide, filgrastim, fludarabine, fluorouracil, gemcitabine, granisetron, hydroxyurea, idarubicin, isopyridine, and other similar drugs. Cyclophosphamide, interferon-alpha, irinotecan, lansoprazole, levamisole, leucovorin, megestrol acetate, mesna, methotrexate, metoclopramide, mitomycin, mitotane, mitoxantrone, omeprazole, ondansetron, paclitaxel (TAXOL), pilocarpine, prochloroperazine, rituximab, tamoxifen, paclitaxel, topotecan hydrochloride, trastuzumab, vincristine, vinblastine, and vinorelbine tartrate.

[0056] Certain aspects of the present invention provide compositions comprising DNA molecules encoding one or more polymer macromolecules as described herein. In some aspects, the DNA molecule is a circular DNA molecule. In some aspects, rolling circle transcription of the circular DNA molecule with an RNA polymerase results in the generation of one or more polymer macromolecules encoded by the circular DNA molecule. In some aspects, the RNA polymerase is a T7 RNA polymerase.

[0057] Certain aspects of the present invention provide a method comprising transcribing a circular DNA molecule encoding one or more polymer macromolecules as described herein, wherein the circular DNA molecule is transcribed using rolling circle transcription with an RNA polymerase, wherein the transcription results in the generation of one or more polymer macromolecules encoded by the circular DNA molecule. In some aspects, the RNA polymerase is a T7 RNA polymerase.

[0058] Based on the teachings contained herein, additional aspects will be readily apparent to those skilled in the art. Attached Figure Description

[0059] Figure 1 : A schematic diagram of an "integrated" glycopolymer RNA that serves as a multifunctional agonist and molecular scaffold for inducing anti-tumor immunity.

[0060] Figure 2A-C (A) PolyRNA synthesized via rolling circle transcription. (B) In vitro TLR3 and TLR7 activation in reporter cell lines via polyRNA or poly(I:C) complexed with a biodegradable polymer. (C) Overall survival in an ID8Trp53- / - ovarian cancer mouse model treated intraperitoneally with polyRNA or poly(I:C) complex. *p<0.05, **p<0.01, ****p<0.0001, log-rank (Mantel-Cox) test.

[0061] Figure 3 This diagram shows a polymer macromolecule with RIG-1 PRR agonist, TLR7 / 8 PRR agonist, TLR9 PRR agonist, and TLR3 PRR agonist. Activation data for hTLR3, hTLR7, hTLR8, and hRIG-1 are also provided.

[0062] Figure 4 The formation of hybrids (polyRNA, DNA comb, polyRNA-DNA comb) is shown; mTLR9 activation via T19:D12-CpG; RAW-Dual NF-kB activation via T19:D12-CpG; and RAW-dual IRF activation via T19:D12-CpG.

[0063] Figure 5 The distribution of ionizable lipids (DLin-MC3-DMA(MC3))(OF-C4-Deg-Lin(C4)) is shown; the molecular weight distribution of polyRNAs (T19 polyRNA, T51 polyRNA and T52 polyRNA); MC3 LNP (IRF activation); and MC3 versus C4 (activation).

[0064] Figures 6A-6DThis study demonstrates the in vivo therapeutic efficacy of a polymeric RNA scaffold. (A) CT26 colorectal tumor-bearing mice were treated via intratumoral injection with polyRNA (T52), polyRNA:CpG DNA hybrid (T52:D15-CpG), and a baseline control. T52:D15-CpG and T51:D15ctl-CpG represent polyRNAs hybridized with CpG combs and mismatched CpG DNA controls, respectively. (BD) Tumor growth curves (BC) and overall survival (D). *p<0.05; **p<0.01; *****p<0.0001.

[0065] definition To facilitate understanding of this invention, the following terms and phrases are defined: An "immunogen" is a molecule or a composition including such a molecule that can trigger an immune response by an organism's immune system. An "antigen" is a molecule that can bind to products of an immune response.

[0066] A "pathogen" is a known agent that causes infection in a host in nature, such as microorganisms, bacteria, or viruses, and in this sense, the term "pathogen" in the context of this invention refers to a "natural pathogen." Although a wide range of microorganisms may be able to cause infection under artificial conditions, such as by artificially inoculating microorganisms into tissues, the range of microorganisms that naturally cause infection is necessarily limited and well determined by medical practice.

[0067] An infection is a state or condition in which the body or a part of it is invaded by a pathogenic factor (such as a microorganism, like bacteria), which multiplies under favorable conditions and produces harmful effects (Taber's Cyclopedic Medical Dictionary, 14th Ed., CL Thomas, Ed., FA Davis Company, PA, USA). Infections may not always be clinically apparent and may only cause localized cellular damage. If the body's defense mechanisms are effective, the infection may remain subclinical and transient. Infections can spread locally, clinically presenting as acute, subacute, or chronic clinical infection or disease states. Local infections can also become systemic infections when the pathogenic factor enters the lymphatic system or blood vessels. Infections are usually accompanied by inflammation, but inflammation can occur in the absence of infection.

[0068] "Inflammation" is a characteristic tissue response to injury (marked by swelling, redness, heat, and pain) and includes a series of changes that occur within the tissue when a living tissue is damaged. Infection and inflammation are distinct conditions, although one can be caused by the other (Taber's Cyclopedic Medical Dictionary, 14th Ed., CL Thomas, Ed., FA Davis Company, PA, USA). Therefore, inflammation can occur without infection, and infection can occur without inflammation (although inflammation is usually caused by infection with pathogens or viruses). Inflammation is characterized by the following symptoms: redness (rubor), heat (calorie), swelling (tumour), and pain (dolor). Localized inflammation on the skin can become apparent from a combination of these symptoms, particularly redness at the application site.

[0069] Various subjects may be treated, measured, or sampled according to alternative aspects of the invention. As used herein, “subject” is an animal, such as a vertebrate or mammal. Thus, a subject may be a patient with an immune dysregulation, such as a human. A subject may also be an experimental animal, such as an animal model of an immune dysregulation. In some aspects, the terms “subject” and “patient” may be used interchangeably and may include humans, non-human mammals, non-human primates, rats, mice, or dogs. A healthy subject may be a person who does not have or is not suspected of having a disease such as cancer or immune dysfunction, or who does not have a chronic disease or condition. A “healthy subject” may also be a subject who is not immune-impaired. Immune impairment means any condition in which the immune system functions abnormally or incompletely. Immune impairment may be due to disease, certain medications, or a condition present at birth. Immune-impaired subjects may be more commonly found in infants, the elderly, and individuals receiving extensive medication or radiation therapy.

[0070] The “sample” from the subject can include any relevant biological material, including, for example, samples of cells, tissues, or bodily fluids taken from the patient. For example, samples can conveniently include skin, cheek, blood, feces, hair, or urine. Nucleic acids from the sample used for diagnostic and prognostic methods can be obtained, for example, from a selected cell type or tissue of the subject. For example, bodily fluids (e.g., blood) from the subject can be obtained using known techniques. Alternatively, nucleic acid testing can be performed on dry samples (e.g., hair or skin).

[0071] "Immune response" includes, but is not limited to, the induction or activation of one or more of the following responses in mammals: antibodies, neutrophils, monocytes, macrophages (including both M1-like macrophages and M2-like macrophages as described herein), B cells, or T cells (including helper T cells, natural killer cells, cytotoxic T cells, and γ-δ (γδ) T cells), such as by induction or activation by one or more immunogens in the immunogenic composition after administration of the composition. Therefore, an immune response to the composition generally includes the development of a cellular and / or antibody-mediated response in the host animal to the composition. In some respects, the immune response will also lead to a slowing or halting of the progression of immune dysregulation or a disease characterized by immune dysregulation. Therefore, an immune response may include one or both of cellular and / or humoral immune responses, and may be an adaptive or innate immune response.

[0072] "Immune dysregulation" refers to an inappropriately regulated immune response, such as inappropriate suppression or excessive immune response. Immune dysregulation can occur, for example, in the context of autoimmune, inflammatory, or degenerative diseases (such as rheumatoid arthritis, Crohn's disease, inflammatory bowel disease, multiple sclerosis, neurodegenerative diseases, or allergies) or neoplastic diseases such as cancer or host defense against pathogens. Inflammatory bowel disease (IBD) is a common name for a group of inflammatory conditions of the colon and small intestine, typically characterized by similar symptoms of immune dysregulation and an uncertain etiology. The main subtypes of IBD are clinically considered to be Crohn's disease and ulcerative colitis. In addition to Crohn's disease and ulcerative colitis, IBD can also include conditions considered to be any of the following: collagenous colitis, lymphocytic colitis, ischemic colitis, shunt colitis, Behçet's syndrome, or undifferentiated colitis. The differences between these conditions are primarily related to the location and nature of the inflammatory changes in the gastrointestinal tract (GIT). For example, Crohn's disease is generally considered to potentially affect any part of the gastrointestinal tract from mouth to anus, with most cases marked by relapsing and remission of granulomatous inflammation of the digestive tract in the terminal ileum and colon. In contrast, ulcerative colitis is generally thought to be confined to the colon and rectum. These inflammatory conditions can manifest symptoms in various regions of the gastrointestinal tract, including: the bowel or intestinal tract, comprising: the small intestine (which has three parts: the duodenum, jejunum, and ileum); the large intestine (which has three parts: the cecum, the colon, which includes the ascending colon, transverse colon, descending colon, and sigmoid colon; and the rectum); and the anus.

[0073] “Cancer” or “hypertrophy” is any unwanted growth of cells that do not perform their physiological function. Typically, cancer cells have broken free from the normal control of cell division; that is, their growth is no longer regulated by the ordinary biochemical and physical influences of the cellular environment. Therefore, “cancer” is a general term for a disease characterized by abnormal, uncontrolled cell growth. In most cases, cancer cells proliferate to form malignant clonal cells, masses or clusters of cells, “hypertrophies” or “tumors,” which are often capable of invading and destroying surrounding normal tissue. As used herein, reference to “malignant” refers to the abnormal growth of any cell type or tissue that has a harmful effect in an organism with abnormal growth. The terms “malignant” or “cancer” include cell growth that is technically benign but has the risk of becoming malignant. Cancer cells can spread from their original site to other parts of the body through a process called “metastasis” via the lymphatic system or bloodstream. Many cancers are difficult to treat and have proven fatal. Examples of cancer or hypertrophies include, but are not limited to, transformed and immortalized cells, tumors, and carcinomas in various organs and tissues described herein or known to those skilled in the art.

[0074] Most cancers fall into three broad histological categories: carcinoma, which is the primary cancer and is cancer of epithelial cells or cells covering the outer or inner surface of organs, glands, or other body structures (e.g., skin, uterus, lungs, breast, prostate, stomach, intestines), and it tends to metastasize; cancer, which originates from connective or supporting tissues (e.g., bone, cartilage, tendons, ligaments, fat, muscle); and hematologic malignancies, which originate from bone marrow and lymphatic tissue. Carcinoma can be adenocarcinoma (which typically develops in secretory organs or glands, such as the breast, lungs, colon, prostate, or bladder) or squamous cell carcinoma (which originates from squamous epithelium and typically develops in most areas of the body). Sarcomas can be osteosarcomas or osteogenic sarcomas (bone), chondrosarcomas (cartilage), leiomyosarcomas (smooth muscle), rhabdomyosarcomas (skeletal muscle), mesotheliomas or mesotheliomas (membranous lining of body cavities), fibrosarcomas (fibrous tissue), angiosarcomas or hemangioendotheliomas (blood vessels), liposarcomas (adipose tissue), gliomas or astrocytomas (neurogenic connective tissue found in the brain), myxosarcomas (primordial embryonic connective tissue), or mesenchymal tumors or mixed mesodermal tumors (mixed connective tissue types). Hematologic malignancies can include myeloma, which originates from plasma cells in the bone marrow; leukemia, which can be a "liquid cancer" and a cancer of the bone marrow, and can be myeloid or granulocytic leukemia (myeloid and granulocytic white blood cells), lymphocytic, lymphocytic, or lymphoblastic leukemia (lymphocytic and lymphocytic blood cells), or polycythemia vera or polycythemia vera (various blood cell products, but predominantly red blood cells); or lymphoma, which can be a solid tumor and develop in glands or lymph nodes of the lymphatic system, and can be Hodgkin's or non-Hodgkin's lymphoma. Additionally, mixed cancers exist, such as adenosquamous carcinoma, mixed mesodermal tumors, carcinosarcoma, or teratoma.

[0075] Cancers can also be named based on the organ from which they originate, the "primary site," such as breast cancer, brain cancer, lung cancer, liver cancer, skin cancer, prostate cancer, testicular cancer, bladder cancer, colon and rectal cancer, cervical cancer, uterine cancer, etc. This naming persists even if the cancer metastasizes to other parts of the body different from the primary site. Using this invention, treatment targets the site of the cancer, rather than the type of cancer, so that, for example, any type of cancer, whether symptomatic or causative, located in the lungs will be treated based on that location within the lungs. Detailed Implementation

[0076] Many PRR agonist-based adjuvants are administered as single agonists and can only activate one or a few innate immune pathways, failing to well mimic naturally occurring immune responses to pathogens. Growing evidence suggests that concomitant PRR agonists can promote synergistic immune activation. Furthermore, the multivalent nature of TLR agonists can enhance innate immune activation via receptor oligomerization. However, the combination and spatial arrangement of PRR agonists remain largely unexplored: how combinations of agonists with different compositions, spatial densities, and ratios function at the molecular, cellular, and organismal levels and influence innate and adaptive immune responses remains poorly understood. Further exacerbating these knowledge gaps is the lack of modular tools capable of precisely controlling the spatial organization of PRR agonists and their stoichiometry within concomitant agonist platforms. While numerous synthetic nanomaterials have been developed for the spatial modulation and delivery of TLR agonists, increased translational complexity, the risk of material-induced inflammatory responses, and potential batch-to-batch variations associated with many nanoparticle formulations remain challenges. These knowledge and technological gaps underscore the need to develop modular platforms capable of precisely spatially and concomitantly controlling innate immune activation to modulate desired immune responses and potentially achieve dose savings.

[0077] Inspired by the clinical success of RNA therapeutics such as messenger RNA vaccines, experiments were conducted to address the aforementioned challenges by leveraging the multifunctionality of RNA's structure, sequence, and function to develop an "all-in-one" innate immune agonist platform. Based on the recognition of RNA structural motifs by specific PRRs, polymeric RNA (polyRNA) structures comprising numerous repeating units were engineered as modular multifunctional agonists and molecular scaffolds for patterning various agonists and other modalities. Figure 1 By leveraging the versatility of a previously developed rolling circle transcription (RCT) approach for synthesizing small interfering RNA (siRNA) in polymeric form, RNAs with modular agonist motifs and building blocks were constructed to shape immune responses. Further inspired by the recently discovered immune cell targeting and activation capabilities of endogenous glycosylated RNAs and fungal cell wall polysaccharides, mannans were generated along a polyRNA scaffold to create synthetic glycoRNAs capable of self-delivery, targeting APCs, and multimodal innate immune activation. This “all-in-one” adjuvant demonstrates a close mimicry of the multifaceted recognition of RNA viruses and other pathogens naturally occurring by the innate immune system. The “all-in-one” adjuvant offers multiple advantages: (1) precise spatial regulation and combination of innate immune agonists, juxtaposed in the same molecule to ensure co-activation of innate immune pathways in the same cell; (2) multivalent presentation of agonists with structural flexibility to optimally bind PRRs; (3) technical realization of mechanistic studies on how the combination and spatial density of agonists mediate different immune responses; and (4) all-natural bioactive components for agonist design and targeted delivery.

[0078] The “integrated” adjuvant also offers the following conceptual innovations: (1) using RNA as a multifunctional scaffold to precisely couple innate immune agonists in a spatially controlled manner to understand combinatorial and synergistic effects and optimize the immune response profile, representing a departure from the status quo in the use of synthetic nanomaterials or complex chemicals for spatial modulation or integration of multiple agonists; (2) engineering “integrated” RNA as both an adjuvant cargo and a targeted delivery platform, in contrast to most approaches that focus only on the design of delivery loads or agonist molecules; and (3) introducing a bio-inspired synthetic glyco-RNA platform for the targeted delivery of RNA therapeutics to immune cells.

[0079] In combination, the "integrated" adjuvant offers key technological innovations: (1) an enzymatic synthesis platform for polymeric RNA encoded by multifunctional DNA, enabling precise spatial patterning of innate immune agonists and other multiple functions; and (2) the elimination of the need for synthetic nanomaterials for multivalent presentation or delivery of innate immune agonists, thereby reducing translational complexity and the risk of material-induced inflammatory responses. Furthermore, the sequence-defined patterning of agonists in the polymeric RNA, aided by templated enzymatic synthesis, provides absolute consistency in spatial separation.

[0080] Therefore, the present invention provides therapeutic agents comprising polymer macromolecules, wherein each polymer macromolecule comprises a plurality of linked pattern recognition receptor (PRR) agonists, wherein each of the PRR agonists comprises a nucleic acid molecule capable of activating a specific PRR. In particular, the patterns of the PRR agonists are designed to reproduce different portions of the characteristics of one or more PRR agonists for one or more pathogens. Multiple PRR agonists are formulated together in a manner that allows for combined presentation in mammalian subjects to modulate an immune response.

[0081] Aspects of the present invention relate to compositions comprising one or more polymer macromolecules, wherein each of the polymer macromolecules comprises a plurality of linked PRR agonists, and wherein each of the polymer macromolecules comprises at least two different PRR agonists. In some aspects, the plurality of linked PRR agonists are formulated together for combined presentation upon administration to a mammalian subject. In some aspects, the plurality of linked PRR agonists are arranged to reproduce different portions of the characteristics of one or more PRR agonists in one or more pathogens.

[0082] In some aspects, a particular PRR agonist among the plurality of linked PRR agonists is present two or more times. In some aspects, the presence of two or more times is between 2 and 1,000,000 times. In some aspects, two or more different PRR agonists among the plurality of linked PRR agonists are each present two or more times independently. In some aspects, the presence of two or more times is between 2 and 1,000,000 times.

[0083] In some aspects, at least one of the PRR agonists includes a hairpin loop within the nucleic acid molecule. In some aspects, at least one of the PRR agonists includes single-stranded RNA (ssRNA) and / or single-stranded DNA (ssDNA) within the nucleic acid molecule. In some aspects, the ssRNA and / or ssDNA within the nucleic acid molecule are between 4 and 1000 base pairs. In some aspects, the percentage of guanine / uracil bases in the ssRNA is between 0 and 100%. In some aspects, at least one of the PRR agonists includes double-stranded RNA (dsRNA) and / or double-stranded DNA (dsDNA) within the nucleic acid molecule. In some aspects, the dsRNA and / or dsDNA within the nucleic acid molecule are between 1 and 500 base pairs. In some aspects, at least one of the PRR agonists includes a 5'-triphosphate moiety within the nuclear molecule. In some aspects, at least one of the PRR agonists includes a stem moiety within the nucleic acid molecule.

[0084] In some aspects, multiple connected PRR agonists are arranged in a linear successive manner. In some aspects, each PRR agonist within a linearly connected PRR agonist series is sequentially positioned in a linear successive manner. In some aspects, multiple connected PRR agonists are arranged in a non-linear manner.

[0085] In some respects, multiple PRR agonists are between 2 and 10,000 PRR agonists; or 2 to 1,000 PRR agonists; or 2 to 100 PRR agonists; or 2 to 10 PRR agonists.

[0086] In some respects, the number of different PRR agonists within each polymer macromolecule is between 2 and 10,000; or 2 to 1,000 PRR agonists; or 2 to 100 PRR agonists; or 2 to 10 PRR agonists.

[0087] In some aspects, the plurality of PRR agonists are selected from 3 PRR agonists, 4 PRR agonists, 5 PRR agonists, 6 PRR agonists, 7 PRR agonists, 8 PRR agonists, 9 PRR agonists, 10 PRR agonists, 11 PRR agonists, 12 PRR agonists, 13 PRR agonists, 14 PRR agonists, 15 PRR agonists, 16 PRR agonists, 17 PRR agonists, 18 PRR agonists, 19 PRR agonists, 20 PRR agonists, 25 PRR agonists, and 50 PRR agonists.

[0088] In some respects, the various PRR agonists within each polymer macromolecule are selected from 3 PRR agonists, 4 PRR agonists, 5 PRR agonists, 6 PRR agonists, 7 PRR agonists, 8 PRR agonists, 9 PRR agonists, 10 PRR agonists, 11 PRR agonists, 12 PRR agonists, 13 PRR agonists, 14 PRR agonists, 15 PRR agonists, 16 PRR agonists, 17 PRR agonists, 18 PRR agonists, 19 PRR agonists, 20 PRR agonists, 25 PRR agonists, and 50 PRR agonists.

[0089] In some aspects, at least one or more of the polymer macromolecules or compositions further include a targeting moiety to facilitate targeted delivery of the polymer macromolecule to a desired site. In practice, the polymer macromolecule or composition may also be associated with one or more targeting moieties (e.g., compounding, conjugation, encapsulation, absorption, adsorption, and incorporation). The targeting moiety enables such compositions and polymer macromolecules to be localized to tumors, disease sites, imaging sites, or any other desired site. Targeting molecules include, but are not limited to, antibody molecules, growth receptor ligands, vitamins, peptides, fungal cell wall polysaccharides, haptens, aptamers, and other targeting molecules known to those skilled in the art. Specifically, non-limiting examples of the targeting moiety include: vitamins, ligands, amines, peptide fragments, antibodies, aptamers, transferrin, antibodies or fragments thereof, sialic acid Lewis X antigen, lipids (including cationic, neutral, and steroidal lipids, viral microsomes, and liposomes), hyaluronic acid, mannan, mannose derivatives, glucose derivatives, cell-specific lectins, galactagogues, galactosylceramides, steroidal derivatives, RGD sequences, EGF, EGF-binding peptides, urokinase receptor-binding peptides, thromboretin-derived peptides, albumin derivatives, and / or molecules derived from combinatorial chemistry. In some aspects, the targeting moiety includes antibodies specific to macrophage, dendritic cell, NK cell, NKT, or T cell antigens. In some aspects, the targeting moiety includes scFv, nanobodies, peptides, microbodies, polynucleotide aptamers, heavy chain variable regions, light chain variable regions, or fragments thereof.

[0090] In some respects, the target fraction is selected from mannose, mannose-6-phosphate, mannan, fucose, and n-acetylglucosamine.

[0091] In some aspects, the targeting portion includes antibodies, such as those selected from: intact polyclonal antibodies, intact monoclonal antibodies, antibody fragments, single-chain Fv (scFv) mutants, multispecific antibodies, bispecific antibodies, chimeric antibodies, humanized antibodies, human antibodies, fusion proteins including antigenic determinant portions of antibodies, and modified immunoglobulin molecules including antigen recognition sites. In some aspects, the targeting portion includes antibodies selected from: morotumab-CD3, abciximab, rituximab, dacrolimus, palizumab, infliximab, trastuzumab (Herceptin), etanercept, baliximab, oxagirivitazol, alenzusab, teimozumab, adalimumab, alefacept, omalizumab, efazolin, and tositumomob-I. 131 Cetuximab, Bevacizumab, Natalizumab, Ramizumab, Perlimumab, Iculizumab, Linasip, Pevoxelazumab, Romistastatin, AMG-531, CNTO-148, CNTO-1275, ABT-874, LEA-29Y, Belimumab, TACI-Ig, Second-generation anti-CD 20 ACZ-885, Tocilizumab, Atlizumab, Meperizumab, Pertuzumab, Humax CD 20 Trimelimumab (CP-675 206), Ticilimumab, MDX-010, IDEC-114, Ogaituzumab, HuMax EGFR, Aflibercept, HuMax-CD4, Ala-Ala, ChAglyCD3, TRX4, Caputoxumab, IGN101, MT-201, Pregovomab, CH-14.18, WX-G250, AMG-162, AAB-001, Motavizumab, MEDI-524, Efumgumab, Aurograb, Raxicurumab, Third-generation anti-CD 20 LY2469298, and Vertuzumab.

[0092] In some respects, the target portion binds to receptors selected from the group consisting of: sialic acid adhesion protein receptor, folate receptor, galactose receptor, mannose receptor, β-glucan receptor, scavenger receptor, and prophagocytic peptide receptor.

[0093] In some respects, the target fraction is selected from the group consisting of: sialic acid, 9-N-(4H-thieno[3,2-c]chromene-2-carbamoyl)-Neu5Acα2-3Ga1β-4G1cNAc (TCCNeu5Ac), folic acid, methotrexate, folate, galactose residues, lactose, low-density lipoprotein (LDL), ovalbumin (OVA), lactobionic acid, mannose-rich glycoconjugates, mannose, mannan, mannosylated poly(L-lysine) (MPL), yeast polysaccharides and other β-glucans, glucans, polyguanine and apoB protein fragments.

[0094] In some respects, the target portion includes any nanoparticles, liposomes, adjuvants, antibodies, or antigens described herein.

[0095] In some aspects, at least one of the polymer macromolecules further includes one or more of mannan, mannose, β-glucan, N-acetylgalactosamine, polysaccharide A1, hyaluronic acid, α-galactosylceramide, cholesterol, and α-tocopherol succinate; In some aspects, the composition further comprises one or more of mannan, mannose, β-glucan, N-acetylgalactosamine, polysaccharide A1, hyaluronic acid, α-galactosylceramide, cholesterol, and α-tocopherol succinate.

[0096] In some aspects, the composition is partially associated with liposomes, wherein the association is selected from complexation, conjugation, encapsulation, absorption, adsorption, and incorporation.

[0097] In some respects, polymer macromolecules partially associate with liposomes, wherein the association is selected from complexation, conjugation, encapsulation, absorption, adsorption and doping.

[0098] In some respects, PRR agonists may be commercially available, for example, in formulations of widely available attenuated or killable recombinant bacteria, and may be ligands for, for example, TLR2, TLR4, and TLR5. Compositions of pathogen-associated molecular patterns (PAMPs) may include PAMPs recognized by PRRs, including: Toll-like receptors (TLRs), NOD-like receptors (NLRs), RIG-I-like receptors (RLRs), C-type lectin receptors (CLRs) including Dectin-1, cytoplasmic dsDNA sensors (CDS), and NLRs involved in inflammasome formation.

[0099] Toll-like receptor 2 (TLR2) is involved in recognizing a wide range of microbial molecules representing a broad species group, including Gram-positive and Gram-negative bacteria, as well as mycoplasma. mycoplasmaTLR2 recognizes cell wall components such as peptidoglycan, lipoteichoic acid, and lipoproteins from Gram-positive bacteria, lipoarabinomannan from mycobacteria, and yeast glycans from the yeast cell wall. Toll-like receptor 3 (TLR3) recognizes double-stranded RNA (dsRNA). Bacterial lipopolysaccharide (LPS) is recognized by Toll-like receptor 4 (TLR4), which interacts with at least three different extracellular proteins: LPS-binding protein (LBP), CD14, and myeloid differentiation protein 2 (MD-2) to induce a signaling cascade leading to NF-κB activation and the production of pro-inflammatory cytokines. LPS is typically composed of a polysaccharide region anchored in the bacterial outer membrane via a carbohydrate lipid moiety: lipid A, which is primarily responsible for the immunostimulatory activity of LPS. The particular active form of lipid A contains six fatty acyl groups, for example, that can be found in *Escherichia coli* (…). Escherichia coli ) or Salmonella ( Salmonella Found in pathogenic bacteria of the genus *Bacillus*. Toll-like receptor 5 (TLR5) recognizes flagellin from Gram-positive and Gram-negative bacteria. Toll-like receptor 7 (TLR7) and TLR8 recognize single-stranded RNA and small synthetic molecules such as imidazoline and nucleoside analogs. Toll-like receptor 9 (TLR9) recognizes a specific unmethylated CpG motif that is ubiquitous in microbial genomic DNA but not vertebrate genomic DNA.

[0100] NLRs are a family of at least 22 cytoplasmic innate immune sensors, including NOD1 (CARD4) and NOD2 (CARD15), which are intracellular pattern recognition receptors involved in peptidoglycan (PGN) recognition. These receptors detect specific motifs within the PGN. NOD1 senses diaminopimelic acid (DAP)-containing cell wall peptides (especially the d-Glu-meso-DAP dipeptide “iE-DAP”) found primarily in the PGNs of Gram-negative bacteria and some Gram-positive bacteria. NOD2 recognizes muramyl dipeptide (MDP) structures found in almost all bacterial PGNs.

[0101] RIG-I-like receptors (RLRs), particularly RIG-I and MDA-5, are used to detect viral RNA species.

[0102] CLR ligands include Dectin-1 and Mincle (macrophage-inducible C-type lectin) agonists. Dectin-1 is a specific receptor for β-glucan, a glucose polymer found in the cell walls of fungi. Mincle is a multi-tasking danger signal receptor that recognizes various ligands such as those from damaged cells, fungal components, yeast components, and mycobacteria. mycobacteria ) components.

[0103] Cytoplasmic DNA sensors (CDS) bind to intracellular DNA from pathogens, and multiple CDS exist that can exhibit environmental preferences when recognizing specific DNA.

[0104] Cyclic dinucleotides (CDNs) and xanthonesone derivatives such as DMXAA bind to and activate STING (the stimulator of the interferon gene).

[0105] Inflammasomes are multiprotein complexes involved in the production of mature IL-1β, particularly by cleaving pre-IL-1β and pre-IL-18 into active and secretible forms. Inflammasomes can be isolated into NLRP1, NLRP3, NLRC4, and AIM2 subtypes, which are activated by a variety of microbial molecules, danger signals, and microcrystalline substances.

[0106] In some respects, PRR agonists are STING agonists. CDN cyclic-2-AMP (produced by Listeria monocytogenes) Listeria monocytogenes ) and its analogues cyclo-di-GMP (produced by Legionella pneumophila) Legionella pneumophila The pathogen-associated molecular pattern (PAMP) produced by the host cell is recognized as a PAMP and binds to a PRR called STING. STING is an adaptor protein in the cytoplasm of host mammalian cells that activates the TANK-binding kinase (TBK1)-IRF3 signaling axis, leading to the induction of IFN-β and other IRF-3-dependent gene products that strongly activate innate immunity. It is now recognized that STING is a component of the host cytoplasmic surveillance pathway, which senses intracellular pathogen infection and, in response, induces IFN-β production, leading to the development of an adaptive, protective, pathogen-specific immune response composed of both antigen-specific CD4 and CD8 T cells and pathogen-specific antibodies.

[0107] In some respects, each of the plurality of PRRs and PRR agonists is independently selected from: TLR2 and TLR2 agonists TLR3 and TLR3 agonists TLR4 and TLR4 agonists TLR5 and TLR5 agonists TLR7 / 8 and TLR7 / 8 agonists TLR9 and TLR9 agonists NOD1 and NOD1 agonists NOD2 and NOD2 agonists TLR2 / NOD2 and TLR2 / NOD2 agonists NOD1 / NOD2 and NOD1 / NOD2 agonists RIG1 / MDA5 and RIG1 / MDA5 agonists DAI and DAI agonists LRRFIP1 and LRRFIP1 agonists, AIM2 and AIM2 agonists RIG1 and RIG1 agonists Dectin-1 and Dectin-1 agonists Mincle and Mincle agonists STING and STING agonists MDA5 and MDA5 agonists LGP2 and LGP2 agonists DDX41 and DDX41 agonists DHX9 and DHX9 agonists DDX3 and DDX3 agonists DDX36 and DDX36 agonists DDX-1-DDX-21-DDX36 and DDX-1-DDX-21-DDX36 agonists, DDX60 and DDX60 agonists KU70 and KU70 agonists cGAS and cGAS agonists NLRP3 and NLRP3 agonists IFI16 and IFI16 agonist, LRRFIP1 and LRRFIP1 agonists, DAI and DAI agonists CDS and CDS agonists RLR and RLR agonists, CLR and CLR agonists IFIT1 and IFIT1 agonists IFIT2 and IFIT2 agonists IFIT3 and IFIT3 agonists, and IFIT5 and IFIT5 agonists.

[0108] In some respects, one or more of the polymer macromolecules also include one or more portions of a nucleic acid molecule that are not characterized as a PRR agonist.

[0109] In some aspects, the composition is capable of stimulating and / or modulating an innate immune response in a mammalian subject upon administration. In some aspects, the composition is used to induce an immune response to vaccine application. In some aspects, the composition is capable of stimulating an innate immune response in at least one cancer cell, wherein the mammalian subject has cancer, upon administration. In some aspects, stimulating an innate immune response includes stimulating an innate cytokine response mediated by cytokines, wherein the innate cytokine response is mediated by type I interferon.

[0110] In some aspects, the composition further associates with the antigen, wherein the association is selected from complexing, conjugation, encapsulation, absorption, adsorption, and blending. And / or the polymer macromolecule further associates with the antigen, wherein the association is selected from complexing, conjugation, encapsulation, absorption, adsorption, and blending.

[0111] In some respects, the antigen is selected from the group consisting of: α-actin-4, Bcr-Abl fusion protein, Casp-8, β-linkin, cdc27, cdk4, cdkn2a, coa-1, dek-can fusion protein, EF2, ETV6-AML1 fusion protein, LDLR-fucosyltransferase AS fusion protein, HLA-A2, HLA-A11, hsp70-2, KIAAO205, Mart2, Mum-1, 2 and 3, neo-PAP, myosin class I, OS-9, pml-RARα fusion protein, PTPRK, K-ras, N-ras, triose phosphate isomerase, Bage-1, Gage 3, 4, 5, 6, 7, GnTV, Herv-K-mel, Lage-1, Mage-A1, 2, 3, 4, 6, 10, 12, Mage-C2, NA-88, NY-Eso-1 / Lage-2, SP17, SSX-2, and TRP2-Int2, MelanA (MART-I), gp100 (Pmel17), tyrosinase, TRP-1, TRP-2, MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, p15(58), CEA, RAGE, NY-ESO (LAGS), SCP-1, Hom / Mel-40, PRAME, p53, H-Ras, HER-2 / neu, BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR, Epstein-Barr virus antigen, EBNA, human papillomavirus (HPV) antigens E6 and E7, TSP-180, MAGE-4, MAGE-5, MAGE-6, p185erbB2, p180erbB-3, c-met, nm-23H1, PSA, TAG-72-4, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, β-linkin, CDK4, Mum-1, p16, TAGE, PSMA, PSCA, CT7, telomerase, 43-9F, 5T4, 791Tgp72, α-alpha-fetoprotein, 13HCG, BCA225, BTAA, CA 125, CA 15-3 (CA27.29\BCAA), CA 195, CA 242, CA-50, CAM43, CD68\KP1, CO-029, FGF-5, G250, Ga733 (EpCAM), human EGFR protein or fragments thereof, such as human EGFR residues 306-325 (SCVRACGADSYEMEEDGVRK (SEQ ID NO:1)) and residues 897-915 (VWSYGVTVWELMTFGSKPY (SEQ ID NO:2)).HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB / 70K, NY-CO-1, RCAS1, SDCCAG16, TA-90 (Mac-2 binding protein / cyclic protein C-related protein), TAAL6, TAG72, TLP, TPS, WT1 (and WT1-derived peptide sequences: WT1 126–134 (RMFPNAPYL (SEQ ID NO:3)), WT1 122–140 (SGQARMFPNAPYLPSCLES (SEQ ID NO:4)) and WT1 122–144 (SGQARMFPNAPYLPSCLESQPTI (SEQ ID NO:5)), MUC1 (and MUC1-derived peptides and glycopeptides, such as RPAPGS (SEQ ID NO:6), PPAHGVT (SEQ ID NO:7) and PDTRP (SEQ ID NO:6)). NO:8), LMP2, EGFRvIII, Idiotype, GD2, Ras mutant, p53 mutant, proteinase 3 (PR1), survivin, hTERT, sarcoma translocation breakpoint, EphA2, EphA4, LMW-PTP, PAP, ML-IAP, AFP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, ALK, androgen receptor, cyclin B1, polysialic acid, MYCN, RhoC, TRP-2, GD3, fucose GM1, mesothelin, sLe (animal), CYP1B1, PLAC1, GM3, BORIS, Tn, GloboH, NY-BR-1, RGS5, SART3, STn, carbonic anhydrase IX, PAX5, OY-TES1, spermin 17, LCK, HMWMAA, AKAP-4, XAGE 1. B7H3, podase, Tie2, Page4, VEGFR2, MAD-CT-1, FAP, PDGFR-α, PDGFR-β, MAD-CT-2, Fos-associated antigen 1, ERBB2, folate receptor 1 (FOLR1 or FBP), IDH1, IDO, LY6K, fms-associated tyrosine kinase 1 (FLT1, best known as VEGFR1), KDR, PADRE, TA-CIN (recombinant HPV16 L2E7E6), SOX2, neoantigen, and aldehyde dehydrogenase.

[0112] In some respects, the antigen is derived from its own antigen.

[0113] In some respects, the antigen is conjugated to the outer surface of the composition. And / or the antigen is conjugated to a polymer macromolecule.

[0114] In some aspects, the composition is associated with an adjuvant, wherein the association is selected from compounding, conjugation, encapsulation, absorption, adsorption, and blending; and / or the polymer macromolecule is associated with an adjuvant, wherein the association is selected from compounding, conjugation, encapsulation, absorption, adsorption, and blending.

[0115] In some aspects, the adjuvant is selected from the group consisting of: CPG, polyIC, poly-ICLC, 1018 ISS, aluminum salts (e.g., aluminum hydroxide, aluminum phosphate), Amplivax, BCG, CP-870, CP-893, CpG7909, CyaA, dSLIM, cytokines (such as GM-CSF, IL-2, IFN-α, Flt-3L), IC30, IC31, imiquimod, ImuFact IMP321, ISPatch, ISS, ISCMATRIX, Juvlmmune, LipoVac, MF59, monophospholipid A, Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, Montanide ISA-51, OK-432, OM-174, OM-197-MP-EC, ONTAK, PepTel.RTM, vector system, PLGA microparticles, imiquimod, remiquimod, gademod, 3M-052, SRL172, viral microsomes and other virus-like particles, YF-17D, VEGF trap, β-glucan, Pam3Cys, Aquila's QS21 stimulator, vardemisinin, AsA404 (DMXAA), 3M MEDI9197, glucanyl pyranosyl lipid adjuvants (GLA), GLA-SE, CD1d ligands (such as C20:2, OCH, AH04-2, α-galactosylceramide, α-C-galactosylceramide, α-mannoseceramide, α-fructoseceramide, β-galactosylceramide, β-mannoseceramide), STING agonists (e.g., cyclic dinucleotides, including cyclic [G(3',5')pA(3',5')p], cyclic [G(2',5')pA(3',5')p], cyclic [G(2',5')pA(2',5')p], cyclic diadenosine monophosphate, cyclic diguanosine monophosphate), CL401, CL413, CL429, flagellin, RC529, E6020, imidazoquinone-based small molecule TLR-7 / 8a (including its lipid analogues), viral microsomes, AS01, AS02, AS03, AS04, AS15, IC31, CAF01, ISCOM, cytokines (such as GM-CSF, IL-2, IFN-α, Flt-3L), bacterial toxins (such as CT and LT), any derivatives of adjuvants, and any combination of adjuvants.

[0116] In some aspects, the composition is associated with nanoparticles, wherein the association is selected from composite, conjugation, encapsulation, absorption, adsorption, and doping; and / or the polymer macromolecule is associated with nanoparticles, wherein the association is selected from composite, conjugation, encapsulation, absorption, adsorption, and doping.

[0117] In some aspects, the nanoparticles are selected from the group consisting of: sHDL nanoparticles, metal-polyhistidine-DOPE@liposomes, metal-polyhistidine-PEG, 4-arm-PEG-polyhistidine-metal hydrogels, sHDL-polyhistidine, fullerenes, metal-embedded fullerene briquette spheres, trimetallic nitride-templated metal-embedded fullerenes, single-walled and multi-walled carbon nanotubes, branched and dendritic carbon nanotubes, gold nanorods, silver nanorods, single-walled and multi-walled boron / nitrate nanotubes, carbon nanotube pods, carbon Nanohorns, carbon nanocarob pods, liposomes, nanoshells, dendritic polymers, any nanostructure, microstructure or derivative thereof formed using layer-by-layer processes, self-assembly processes or polyelectrolytes, microparticles, quantum dots, superparamagnetic nanoparticles, nanorods, cellulose nanoparticles, glass and polymer microspheres and nanospheres, biodegradable PLGA microspheres and nanospheres, gold nanoparticles, silver nanoparticles, carbon nanoparticles, iron nanoparticles, modified micelles, and metal-organic framework (MOF) coordination polymers (CP).

[0118] In some aspects, the composition is associated with one or more of the following: nanoparticles, liposomes, dendritic polymers, micelles, nanoemulsions, nanosuspensions, vesicles, nanocapsules, magnetic nanoparticles, lipoprotein-based carriers, and / or lipid complex nanoparticles; wherein the association is selected from complexing, conjugation, encapsulation, absorption, adsorption, and doping; and / or the polymer macromolecule is associated with one or more of the following: nanoparticles, liposomes, dendritic polymers, micelles, nanoemulsions, nanosuspensions, vesicles, nanocapsules, magnetic nanoparticles, lipoprotein-based carriers, and / or lipid complex nanoparticles; wherein the association is selected from complexing, conjugation, encapsulation, absorption, adsorption, and doping.

[0119] In some aspects, at least one of the polymer macromolecules and / or the composition further includes an imaging portion. In some aspects, at least one of the polymer macromolecules is associated with the imaging portion (e.g., composite, conjugation, encapsulation, absorption, adsorption, and doping). In some aspects, the composition is associated with the imaging portion (e.g., composite, conjugation, encapsulation, absorption, adsorption, and doping).

[0120] In some respects, imaging agents are selected from fluorophores, radionuclides, biotin, luciferase, luciferin, rhodamine, GFP, FITC, Alexa Fluor®, Cy3, CyS, BODIPY, anthocyanin dyes, etc.11 C 13 N、 15 O、 18 F, 123 I, 125 I, 131 I, 64 Cu or 32 P, as well as quantum dots or gold nanoparticles.

[0121] Certain aspects of the present invention provide compositions comprising DNA molecules encoding one or more polymer macromolecules as described herein. In some aspects, the DNA molecule is a circular DNA molecule. In some aspects, rolling circle transcription of the circular DNA molecule with an RNA polymerase results in the generation of one or more polymer macromolecules encoded by the circular DNA molecule. In some aspects, the RNA polymerase is a T7 RNA polymerase.

[0122] Certain aspects of the present invention provide a method comprising transcribing a circular DNA molecule encoding one or more polymer macromolecules as described herein, wherein the circular DNA molecule is transcribed using rolling circle transcription with an RNA polymerase, wherein the transcription results in the generation of one or more polymer macromolecules encoded by the circular DNA molecule. In some aspects, the RNA polymerase is a T7 RNA polymerase.

[0123] Some aspects of the present invention provide a method for treating or preventing immune dysregulation in a mammalian subject, comprising administering to the mammalian subject a composition comprising one or more of the polymer macromolecules, wherein the administration results in stimulation and / or modulation of the mammalian subject's innate immune response.

[0124] In some respects, the mammalian subject suffers from a disease or condition characterized by the immune dysregulation. In some respects, the disease or condition is cancer, an infectious disease, an autoimmune disease, and / or an inflammatory disease.

[0125] In some respects, the cancers are selected from the group consisting of: breast cancer, brain cancer, thyroid cancer, prostate cancer, colorectal cancer, pancreatic cancer, cervical cancer, stomach cancer, endometrial cancer, liver cancer, bladder cancer, ovarian cancer, testicular cancer, head and neck cancer, skin cancer, mesothelial lining leukocyte carcinoma, esophageal cancer, muscle cancer, connective tissue cancer, lung cancer, adrenal cancer, kidney cancer, bone cancer, or testicular cancer and their metastases.

[0126] In some respects, the disease or condition is selected from one or more of the following: acne vulgaris; acute disseminated encephalomyelitis; acute hemorrhagic leukoencephalitis; Addison's disease; agammaglobulinemia; allergy; alopecia areata; Alzheimer's disease; amyotrophic lateral sclerosis; autoimmune anemia, hemolytic anemia; pernicious anemia; ankylosing spondylitis; anti-GBM / TBM nephritis; antiphospholipid syndrome; antisynthetic enzyme syndrome; temporal arteritis (also known as "giant cell arteritis"); juvenile arthritis; psoriatic arthritis; reactive arthritis (Rea syndrome); rheumatoid arthritis; asthma; Atherosclerosis; Atopic allergy; Atopic dermatitis; Autoimmune enteropathy; Autoimmune aplastic anemia; Barlow disease / Barlow concentric sclerosis; Bart syndrome; Behçet's syndrome; Berger's disease; Bickerstaff's encephalitis; Blau syndrome; Chronic bronchitis; Bullous pemphigoid; Bursitis; Autoimmune cardiomyopathy; Kassman's disease; Celiac disease; Chronic fatigue syndrome; Chronic inflammatory demyelinating polyneuropathy; Chronic relapsing multifocal osteomyelitis; Churg-Strauss syndrome Cerebral pemphigoid syndrome; primary biliary cirrhosis, Cogan syndrome; cold agglutinin disease; colitis; complement component 2 deficiency; connective tissue disease, mixed type; connective tissue disease, undifferentiated COPD (chronic obstructive pulmonary disease); cranial arteritis; CREST syndrome; cryoglobulinemia; Cushing's syndrome; cutaneous leukocytic vasculitis; interstitial cystitis; dacryoadenitis; Dego's disease; Dercum's disease; dermatitis; herpetic dermatitis; autoimmune progesterone dermatitis; dermatomyositis; diabetes mellitus; nephrotic diabetes insipidus Type 1 diabetes; diffuse systemic sclerosis of the cutaneous region; discoid lupus erythematosus; diverticulitis; Dresler syndrome; dysmenorrhea (menstrual cramps / pain); eczema; endometriosis; enthesitis-associated arthritis; eosinophilic fasciitis; eosinophilic gastroenteritis; acquired epidermolysis bullosa; erythema nodosum, primary mixed cryoglobulinemia; Evan syndrome; progressive ossifying fibrosis; fibromyalgia; fibrotic alveolitis; atrophic gastritis; gastrointestinal pemphigoid; giant cell arteritis; glomerulonephritis; Goodpasture's syndrome Syndrome); Acute gout; Arthritic gout; Graves' disease; Guillain-Barré syndrome (GBS); Hemolytic anemia; Hashimoto's encephalitis; Hashimoto's thyroiditis; Autoimmune hemolytic anemia; Allergic purpura; Autoimmune hepatitis; Viral hepatitis; Herpes gestationis; Hypogammaglobulinemia; Idiopathic inflammatory demyelinating disease; Idiopathic pulmonary fibrosis; Iga nephropathy; Intestinal obstruction (Ileus); Inclusion body myositis; Inflammatory bowel disease, Crohn's disease; Inflammatory bowel disease, ulcerative colitis;Inflammatory demyelinating polyneuropathy; autoimmune inner ear disease; interstitial cystitis; irritable bowel syndrome (IBS); juvenile idiopathic arthritis; juvenile rheumatoid arthritis; Kawasaki disease; kidney stones; Lambert-Eaton myasthenic syndrome; leukocytic vasculitis; lichen planus; sclerosing lichen; linear IgA disease (LAD); Lujarig's disease (also known as amyotrophic lateral sclerosis); lupus-like hepatitis; lupus; systemic lupus erythematosus; autoimmune lymphoproliferative syndrome; Majid syndrome; Meniere's disease; meningitis; microscopic polyangiitis; Miller-Fischer syndrome Symptoms; scleroderma; Muhar-Haberman disease; multiple sclerosis; multiple sclerosis; myasthenia gravis; myositis; inclusion body myositis; nephritis; nephrotic syndrome; neuromyelitis optica (also known as Dweck's disease); neuromuscular rigidity; neutropenia; neutropenia caused by myelosuppressive chemotherapy; ocular cicatricial pemphigoid; ocular inflammation (acute and chronic nonbacterial inflammation of the anterior segment of the eye); oculoclonus-myoclonus syndrome; Od thyroiditis; osteoarthritis; Paget's bone disease; relapsing rheumatoid arthritis; autoimmune pancreatitis; PANDAS (and streptococci); streptococcus Related pediatric autoimmune neuropsychiatric disorders; paraneoplastic cerebellar degeneration; Parkinson's disease; paroxysmal nocturnal hemoglobinuria (PNH); Parry-Ronberg syndrome; pars plana inflammation; Parsonnage-Turner syndrome; pelvic inflammatory disease; pemphigus; pemphigus vulgaris; nonrheumatic pericarditis; autoimmune peripheral neuropathy; perivenous encephalomyelitis; POEMS syndrome; polyarteritis nodosa; relapsing polychondritis; autoimmune polyendocrine syndrome; polymyalgia rheumatica; polymyositis; primary sclerosing cholangitis; progressive inflammatory neuropathy; prostatitis; chronic pseudogout; psoriasis; pure red cell aplasia; pyoderma gangrenosa; Rasmussen's encephalitis; Raynaud's phenomenon; Reiter's syndrome. Syndrome); Restless legs syndrome; Retinopathy of prematurity; Retroperitoneal fibrosis; Rheumatoid fever; Allergic rhinitis; Sarcoidosis; Schmidt syndrome; Schnitzler syndrome; Scleritis; Scleroderma; Systemic sclerosis; Sjögren's syndrome; Spondyloarthritis; Still's disease; Subacute bacterial endocarditis (SBE); Sussac syndrome; Sweet's syndrome; Sydenham's chorea; Sympathetic ophthalmia; Takayasu arteritis; Temporomandibular joint disorder (TMJD or TMD) or TMJ syndrome; Autoimmune thrombocytopenic purpura; Idiopathic thrombocytopenic purpura, Tolosa-Hunter syndrome; Transplant rejection; Transverse myelitis; Undifferentiated spondyloarthritis; Urticaria; Autoimmune uveitis; Nonrheumatic valvular disease; Vasculitis; Vitiligo and Wegener's granulomatosis.

[0127] In some respects, the cancer is selected from one or more of the following: bladder cancer, brain cancer, breast cancer, cervical cancer, ovarian cancer, colorectal cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, nasopharyngeal cancer, pancreatic cancer, prostate cancer, skin cancer, stomach cancer, gastric cancer, head and neck cancer, testicular cancer, melanoma, acute myeloid leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, T-cell lymphocytic leukemia, B-cell lymphoma, and uterine cancer.

[0128] In some respects, the autoimmune disorders are selected from systemic lupus erythematosus, Aicardi-Goutières syndrome, acute pancreatitis, age-dependent macular degeneration, alcoholic liver disease, liver fibrosis, metastasis, myocardial infarction, non-alcoholic steatohepatitis (NASH), Parkinson's disease, polyarthritis / fetal and neonatal anemia, sepsis, inflammatory bowel disease, and multiple sclerosis.

[0129] In some aspects, the composition is administered in an amount that effectively modulates the adaptive immune response in the mammalian subject. In some aspects, the site of administration is the skin or subcutaneous tissue. In some aspects, the site of administration is the intestine. In some aspects, the site of administration is not the intestine. In some aspects, the site of administration is the respiratory tract. In some aspects, the composition is formulated for systemic distribution of the PRR agonist after administration.

[0130] In some respects, the composition is administered intradermally, subcutaneously, intravenously, intraperitoneally, intraarterially, intrasheathically, intracystically, intraorbitally, intracardiacly, intradermally, transcutaneously, transtracheally, subepidermally, intra-articularly, intratumorally, subcystically, subarachnoidly, intraspinally, intrasternally, orally, sublingually, buccally, rectally, vaginally, nasally, or ocularly, or by infusion, inhalation, or nebulization.

[0131] In some aspects, the composition is administered in multiple doses over a duration of administration, and the duration of administration is at least two weeks. In some aspects, the doses are administered subcutaneously daily or every other day.

[0132] In some respects, mammalian subjects are human patients. In some respects, human patients are immunosuppressed or immunocompromised. In some respects, human patients are elderly. In some respects, human patients are pediatric patients.

[0133] The compositions of the present invention (e.g., having one or more polymeric macromolecules) may be provided alone or in combination with other compounds (e.g., nucleic acid molecules, small molecules, peptides, or peptide analogs) in the presence of liposomes, adjuvants, or any pharmaceutically acceptable load, in a form suitable for administration to mammals such as humans (“therapeutic loads”). As used herein, “pharmaceuticalally acceptable loads” or “excipients” include any and all physiologically compatible solvents, dispersion media, coatings, antimicrobial and antifungal agents, isotonic agents, and absorption delay agents. Loads may be suitable for any suitable form of administration, including subcutaneous, intradermal, intravenous, parenteral, intraperitoneal, intramuscular, sublingual, inhalation, intratumoral, or oral administration. Pharmaceutically acceptable loads include sterile aqueous solutions or dispersions and sterile powders for the immediate preparation of sterile injectable solutions or dispersions.

[0134] Treatments using the polymer macromolecules according to the invention can be combined with a wider variety of conventional and existing therapies. For example, for cancer, these may include chemotherapy, radiation therapy, surgery, etc., or therapies that stimulate the immune system, reduce inflammation, or otherwise benefit the subject, such as nutrients, vitamins, and supplements. For example, vitamins A, D, E, and C, B-complex vitamins, selenium, zinc, coenzyme Q10, beta-carotene, fish oil, curcumin, green tea, bromelain, resveratrol, ground flaxseed, garlic, lycopene, milk thistle, melatonin, other antioxidants, cimetidine, indomethacin, or COX-2 inhibitors (e.g., Celebrex™ [celecoxib] or Vioxx™ [rofecoxib]) may also be administered to the subject.

[0135] Suitable formulations or compositions for administering polymeric macromolecules to subjects can be provided using standard pharmaceutical practices. Alternative routes of administration may be used, such as parenteral, intravenous, intradermal, subcutaneous, intramuscular, intracranial, intraorbital, intraocular, intraventricular, intracapsular, intraspinal, intrathecal, intraspinal, intrasheathal, intracisional, intraperitoneal, intranasal, inhalation, aerosol, local, intratumoral, sublingual, or oral administration. Therapeutic formulations may be in the form of liquid solutions or suspensions; for oral administration, formulations may be in the form of tablets or capsules; for intranasal formulations, they may be in the form of powder, nasal drops, or aerosol; and for sublingual formulations, they may be in the form of drops, aerosol, or tablets.

[0136] Methods for preparing formulations well known in the art can be found, for example, in "Remington's Pharmaceutical Sciences" (20th edition), ed. A. Gennaro, 2000, Mack Publishing Company, Easton, Pa. Formulations for parenteral administration may, for example, contain excipients, sterile water or saline, polyalkylene glycols such as polyethylene glycol, plant-derived oils, or hydrogenated naphthalene. Biocompatible, biodegradable lactide polymers, lactide / glycolic acid copolymers, or polyoxyethylene-polyoxypropylene copolymers can be used to control the release of the compound. Other potentially useful parenteral delivery systems include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation may contain excipients such as lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate, and deoxycholate, or may be oily solutions for administration as nasal drops or as a gel. For therapeutic or preventative compositions, a pathogenic bacterial species is administered to an individual in an amount that effectively inhibits or slows the progression or metastasis of cancer, or in an amount that increases the survival rate of the subject (relative to prognosis, for example, from the SEER database).

[0137] Pharmaceutical compositions or formulations can be packaged in various ways depending on the method of administration. For example, an article of manufacture or packaging may include a container in which a pharmaceutical formulation of a suitable form is deposited. Suitable containers may include, for example, materials such as bottles (plastic and glass), pouches, ampoules, plastic bags, metal cylinders, and vials. Containers may have sterile access ports; for example, a container may be an intravenous solution bag or a vial with a stopper that can be punctured by a hypodermic needle. Packaging or containers may also include tamper-evident or reusable mechanisms suitable for controlling access to the contents of the packaging or container, such as multi-dose vial adapters that mate with the vials contained in the packaging. Containers or packaging may include labels, such as labels describing the contents of the container, such as drug labels identifying the pharmaceutical composition therein and / or specifying the mode or route of administration. Labels may also include appropriate warnings, such as specifying storage conditions for the container or packaging, or listing contraindications or side effects for the mode of treatment. Thus, an article of manufacture may correspondingly take the form of a “kit” including a pharmaceutical composition or accessories suitable for facilitating the use of the pharmaceutical composition. The kit may include a label or instruction leaflet, wherein the term "instruction leaflet" is used to refer to an instruction leaflet typically included in the commercial packaging of a therapeutic product, containing information about indications, usage, dosage, administration, contraindications, and / or warnings regarding the use of such therapeutic product. The kit may further include accessories related to the use of the pharmaceutical composition, including buffers, diluents, filters, needles, and syringes. The kit may also be adapted to deliver selected dosage forms of the pharmaceutical composition, such as comprising multiple unit doses. Such a kit may include a memory aid or mechanism in the form of a physical or written instruction of the intended timing of the treatment regimen for the dose to be administered.

[0138] The "effective amount" of the compositions according to the invention includes a therapeutically effective amount or a preventatively effective amount. A "therapeuticly effective amount" refers to the amount that effectively achieves the desired therapeutic outcome, such as a reduction or elimination of immune dysregulation, within the necessary dose and time period. The therapeutically effective amount of the composition can vary depending on factors such as an individual's disease state, age, sex, and weight, as well as the compound's ability to elicit the desired response in the individual. Dosing regimens can be adjusted to provide an optimal therapeutic response. A therapeutically effective amount can also be the amount in which any toxic or harmful effects of the composition are offset by the beneficial therapeutic effects. A "preventatively effective amount" refers to the effective amount that achieves the desired preventative outcome, such as improvement of immune dysregulation, within the necessary dose and time period. Generally, a preventative dose is used on the subject before or at an early stage of cancer development, such that the preventatively effective amount can be less than the therapeutically effective amount.

[0139] For any particular subject, the timing and dosage of treatment may be adjusted over time (e.g., the timing may be daily, every other day, weekly, or monthly) based on individual needs and the professional judgment of the person administering or supervising the administration of the composition. For example, in the case of subcutaneous or intradermal administration, the composition may be administered every other day. An initial dose of approximately 0.05 ml may be administered subcutaneously, followed by increases of 0.01–0.02 ml every other day until a sufficient skin response is achieved at the injection site (e.g., the appearance of a delayed visible erythema with a diameter of 1 to 2 inches at the injection site). Once this sufficient immune response is achieved, the administration continues as a maintenance dose. The maintenance dose may be adjusted from time to time to achieve the desired visible skin response (inflammation) at the injection site. Administration may be for a duration of at least 1 week, 2 weeks, 2 months, 6 months, 1, 2, 3, 4, or 5 years or longer.

[0140] Oral dosages may range, for example, from four times daily, once daily, or once weekly. Administration may be for a duration of at least one week, two weeks, two months, six months, one, two, three, four, or five years or longer. In some aspects, the invention may comprise compositions administered sublingually or by inhalation, or simultaneously or sequentially, to one or more types of epithelial tissue (i.e., skin via intradermal or subcutaneous injection; lung epithelium via inhalation; gastrointestinal mucosa via oral ingestion; oral mucosa via sublingual administration). Therefore, in some aspects, the compositions of the invention are administered to elicit an immune response in epithelial tissue. In some aspects, one or more epithelial administration routes may be combined with one or more additional administration routes, such as intratumoral, intramuscular, or intravenous administration.

[0141] In the case of immunogenic preparations, the composition of the present invention can be provided alone in an immunogenically effective amount, or in combination with other compounds, such as in combination with an immune adjuvant. The composition may, for example, include a polymeric macromolecule linked to a carrier molecule, such as bovine serum albumin or keyhole limpet hemocyanin, to enhance immunogenicity. An immunogenic composition is a composition comprising a substance that elicits a desired immune response. The immunogenic composition may selectively, activate, or amplify, but is not limited to, memory B cells, T cells, neutrophils, monocytes, or macrophages of the immune system.

[0142] On the other hand, a method is provided for monitoring the efficacy of a treatment regimen in an individual receiving treatment for immune dysfunction in a specific organ or tissue. This method involves measuring the characteristics of the immune response in post-treatment immune samples obtained from the specific organ or tissue some time after the individual has received the treatment regimen.

[0143] In some aspects, compositions comprising polymeric macromolecules capable of stimulating an innate immune response in a subject upon administration to the subject are associated with modified micelle moieties (e.g., compounding, conjugation, encapsulation, absorption, adsorption, incorporation). In these aspects, modified micelles comprise polyol polymers modified to include hydrophobic polymer blocks. As used herein, the term "hydrophobic polymer block" refers to a polymer fragment that is itself hydrophobic. As used herein, the term "micelle" refers to a molecular aggregate dispersed in a liquid. Typical micelles in aqueous solutions form aggregates having a hydrophilic "head" region in contact with the surrounding solvent, thereby isolating a hydrophobic single-tail region at the center of the micelle. In some aspects, the head region may be, for example, a surface region of a polyol polymer, while the tail region may be, for example, a hydrophobic polymer block region of a polyol polymer.

[0144] In some respects, this includes compositions of polymeric macromolecules that, upon administration to a subject, can stimulate an innate immune response in the subject and are associated with liposomes (e.g., compounding, conjugation, encapsulation, absorption, adsorption, incorporation).

[0145] Amphiphilic lipids include, for example, any lipid molecule having both a hydrophobic and a hydrophilic portion. Examples include phospholipids or glycolipids. Examples of phospholipids that can be used include, but are not limited to: dipalmitoylphosphatidylcholine (DPPC), dioleoyl-sn-glycerol-3-phosphoethanolamine-N-[3-(2-pyridyldithio)propionate] (DOPE-PDP), 1,2-dipalmitoyl- sn -glycerol-3-phosphate thioethanol, 1,2-bis-(9Z-octadecenoyl)- sn -glycerol-3-phosphate ethanolamine-N-[4-(p-maleimidephenyl)butyramide], 1,2-bishexadecanoyl- sn -glycerol-3-phosphate ethanolamine-N-[4-(p-maleimidephenyl)butyramide], 1,2-bishexadecanoyl- sn -Glycerol-3-phosphate ethanolamine-N-[4-(p-maleimidemethyl)cyclohexane-formamide], 1,2-bis-(9Z-octadecenoyl)- sn -glycerol-3-phosphate ethanolamine-N-[4-(p-maleimide methyl)cyclohexane-formamide], phosphatidylcholine, phosphatidylinositol, phosphatidylserine, phosphatidylethanolamine, and combinations thereof. In some aspects, phospholipids are complexed with imaging agents (e.g., DOPE labeled with rhodamine (DOPE-Rhod)). In some aspects, phospholipids are thiol-reactive phospholipids, such as, for example, dioleoyl-sn-glycerol-3-phosphate ethanolamine-N-[3-(2-pyridyl dithio)propionate] (DOPE-PDP), 1,2-bishexadecanoyl- sn-Glyceryl-3-phosphate thioethanol or N-4-(p-maleimide-phenyl)butyryl)dipalmitoylphosphatidylethanolamine (MPB-DPPE)).

[0146] In some aspects, exemplary phospholipids include, but are not limited to, small alkyl chain phospholipids, egg yolk phosphatidylcholine, soybean phosphatidylcholine, dipalmitoyl phosphatidylcholine, dimyristoyl phosphatidylcholine, distearoyl phosphatidylcholine, 1-myristoyl-2-palmitoyl phosphatidylcholine, 1-palmitoyl-2-myristoyl phosphatidylcholine, 1-palmitoyl-2-stearoyl phosphatidylcholine, 1-stearoyl-2-palmitoyl phosphatidylcholine, dioleoyl phosphatidylcholine, dioleoyl phosphatidylethanolamine, dilauroyl phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, phosphatidylinositol, phosphatidylglycerol, diphosphatidylglycerol such as dimyristoyl phosphatidylglycerol, dipalmitoyl phosphatidylglycerol, distearoyl phosphatidylglycerol, di Oleoylphosphatidylglycerol, dimyristoylphosphatidyl acid, dipalmitoylphosphatidyl acid, dimyristoylphosphatidylethanolamine, dipalmitoylphosphatidylethanolamine, dimyristoylphosphatidylserine, dipalmitoylphosphatidylserine, cephalothoraxylserine, cerebrosphingomyelin, lecithin, lactosesphingomyelin, palmitoylsphingomyelin, phytosphingomyelin, dipalmitoylsphingomyelin, distearate sphingomyelin, dipalmitoylphosphatidylglycerol salt, phosphatidic acid, galactocerebroside, ganglioside, cerebroside, dilauryl phosphatidylcholine, (1,3)-D-mannosyl-(1,3)glycerol diester, aminophenyl glycoside, 3-cholesterolyl-6'-(glycosylthio)hexyl ether glycolipid, and cholesterol and its derivatives. The phospholipid portion, including SM and palmitoylsphingomyelin, may optionally include small amounts of any type of lipid, including but not limited to lysophospholipids, sphingomyelins other than palmitoylsphingomyelin, galactocerebrosides, gangliosides, cerebrosides, glycerides, triglycerides, and cholesterol and its derivatives.

[0147] In some respects, lipid molecules are film-forming lipid molecules. In other respects, lipid molecules are non-film-forming lipid molecules.

[0148] Examples of lipid molecules suitable for aspects of this invention include, but are not limited to: phospholipids such as lecithin, phosphatidylethanolamine, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, lecithin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebroside, dicetylphosphate, distearate phosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dioleoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoyl-phosphatidylcholine (POPC), palmitoyl oil Acyl-phosphatidylethanolamine (POPE), palmitoyloleoyl-phosphatidylglycerol (POPG), dioleoylphosphatidylethanolamine 4-(N-maleiminomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphatidylethanolamine (DMPE), distearate-phosphatidylethanolamine (DSPE), monomethylphosphatidylethanolamine, dimethylphosphatidylethanolamine, dielaidoylphosphatidylethanolamine (DEPE), stearoyloleoylphosphatidylethanolamine (SOPE), lysophosphatidylcholine, dilinoleoylphosphatidylcholine, and mixtures thereof. Other diacylphosphatidylcholine and diacylphosphatidylethanolamine phospholipids may also be used. The acyl groups in these lipids are preferably derived from those having a C 10 -C 24 Acyl groups of fatty acids in carbon chains, such as lauroyl, myristoyl, palmitoyl, stearoyl, or oleoyl.

[0149] Other non-limiting examples of lipid molecules include sterols, such as cholesterol and its derivatives, such as cholesterol, cholesterol, cholesterol, cholesterol-2'-hydroxyethyl ether, cholesterol-4'-hydroxybutyl ether and mixtures thereof.

[0150] Other examples of lipid molecules suitable for use in this invention include phosphorus-free lipids, such as stearamine, dodecylamine, hexadecylamine, acetyl palmitate, glyceryl ricinoleate, hexadecyl stearate, isopropyl myristate, amphoteric acrylic polymers, triethanolamine lauryl sulfate, alkyl aryl sulfate polyethoxylated fatty acid amides, dioctadecyl dimethyl ammonium bromide, ceramides, sphingomyelin, etc.

[0151] Other examples of lipid molecules suitable for use in this invention include fatty acids and their derivatives or analogues. These include oleic acid, lauric acid, decanoic acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, didecanoate, tridecanoate, glyceryl monooleate (1-monoleoyl-rac-glycerol), dilaurate, caprylic acid, arachidonic acid, 1-monodecanoate, 1-dodecylazine-2-one, acylcarnitine, acylcholine, and its C 1-10 Alkyl esters (e.g., methyl, isopropyl, and tert-butyl) and their monoglycerides and diglycerides (i.e., oleate, laurate, decanoate, myristate, palmitate, stearate, linoleate, etc.) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).

[0152] Other examples of lipid molecules suitable for use in this invention include lipid molecules modified with PEG (PEG-lipids). Examples of PEG-lipids include, but are not limited to, PEG coupled to a dialkyloxypropyl group as described, for example, in PCT Publication WO 05 / 026372 (PEG-DAA), PEG coupled to a diacylglycerol as described, for example, in U.S. Patent Publications 20030077829 and 2005008689 (PEG-DAG), PEG coupled to phospholipids such as phosphatidylethanolamine (PEG-PE), PEG conjugated to a ceramide as described, for example, in U.S. Patent No. 5,885,613, PEG conjugated to cholesterol or a derivative thereof, and mixtures thereof. For all purposes, the disclosures of these patent documents are incorporated herein by reference in their entirety. Further PEG-lipids include, but are not limited to, PEG-C-DOMG, 2KPEG-DMG, and mixtures thereof.

[0153] PEG is a linear, water-soluble polymer of ethylene PEG repeating units having two terminal hydroxyl groups. PEG is classified according to its molecular weight; for example, PEG 2000 has an average molecular weight of about 2,000 Daltons, while PEG 5000 has an average molecular weight of about 5,000 Daltons. PEG is commercially available from Sigma Chemical Co. and other companies, and includes, for example, the following: monomethoxy polyethylene glycol (MePEG-OH), monomethoxy polyethylene glycol-succinate (MePEG-S), monomethoxy polyethylene glycol-succinimide succinate (MePEG-S-NHS), monomethoxy polyethylene glycol-amine (MePEG-NH2), monomethoxy polyethylene glycol-trifluoroethanesulfonate (MePEG-TRES), and monomethoxy polyethylene glycol-imidazolyl-carbonyl (MePEG-IM). Other PEGs, such as those described in U.S. Patent Nos. 6,774,180 and 7,053,150 (e.g., mPEG (20 kDa)amine), are also used to prepare the PEG-lipid conjugates of the present invention. For all purposes, the disclosures of these patents are incorporated herein by reference in their entirety. Furthermore, monomethoxy polyethylene glycol acetic acid (MePEG-CH2COOH) is particularly useful for preparing PEG-lipid conjugates, including, for example, PEG-DAA conjugates.

[0154] The PEG moiety of the PEG-lipid conjugates described herein may include an average molecular weight ranging from about 550 Daltons to about 10,000 Daltons. In some cases, the PEG moiety has an average molecular weight of about 750 Daltons to about 5,000 Daltons (e.g., about 1,000 Daltons to about 5,000 Daltons, about 1,500 Daltons to about 3,000 Daltons, about 750 Daltons to about 3,000 Daltons, about 750 Daltons to about 2,000 Daltons, etc.). In a preferred aspect, the PEG moiety has an average molecular weight of about 2,000 Daltons or about 750 Daltons.

[0155] In some cases, PEG may optionally be substituted with alkyl, alkoxy, acyl, or aryl groups. PEG may be directly conjugated to the lipid or linked to the lipid via a linker motif. Any linker motif suitable for linking PEG to the lipid can be used, including, for example, ester-free and ester-containing linker motifs. In a preferred aspect, the linker motif is ester-free. As used herein, the term "ester-free linker motif" refers to a linker motif that does not contain a carboxylic acid ester bond (—OC(O)—). Suitable ester-free linker motifs include, but are not limited to, amide (—C(O)NH—), amino (—NR—), carbonyl (—C(O)—), urethane (—NHC(O)O—), urea (—NHC(O)NH—), disulfide (—S—S—), ether (—O—), succinyl (—(O)CCH2CH2C(O)—), succinimide (—NHC(O)CH2CH2C(O)NH—), ethers, disulfides, and combinations thereof (such as linkers comprising both urethane and amide linker motifs). In a preferred aspect, urethane linkers are used to attach PEG to lipids.

[0156] In other respects, ester-containing linker moieties are used to attach PEG to lipids. Suitable ester-containing linker moieties include, for example, carbonates (—OC(O)O—), succinyl groups, phosphate esters (—O—(O)POH—O—), sulfonates, and combinations thereof.

[0157] Phosphatidylethanolamines with various acyl chain groups of different chain lengths and saturations can be conjugated to PEG to form lipid conjugates. Such phosphatidylethanolamines are commercially available or can be isolated or synthesized using conventional techniques known to those skilled in the art.

[0158] Preferably, it has C 10 To C 20 Phosphatidylethanolamines with carbon chain lengths within the range that contain saturated or unsaturated fatty acids. Phosphatidylethanolamines containing monounsaturated or diunsaturated fatty acids, as well as mixtures of saturated and unsaturated fatty acids, can also be used. Suitable phosphatidylethanolamines include, but are not limited to, dimyristoyl-phosphatidylethanolamine (DMPE), dipalmitoyl-phosphatidylethanolamine (DPPE), dioleoyl-phosphatidylethanolamine (DOPE), and distearate-phosphatidylethanolamine (DSPE).

[0159] Certain aspects of the present invention provide compositions comprising DNA molecules encoding one or more polymer macromolecules as described herein. In some aspects, the DNA molecule is a circular DNA molecule. In some aspects, rolling circle transcription of the circular DNA molecule with an RNA polymerase results in the generation of one or more polymer macromolecules encoded by the circular DNA molecule. In some aspects, the RNA polymerase is a T7 RNA polymerase.

[0160] Certain aspects of the present invention provide a method comprising transcribing a circular DNA molecule encoding one or more polymer macromolecules as described herein, wherein the circular DNA molecule is transcribed using rolling circle transcription with an RNA polymerase, wherein the transcription results in the generation of one or more polymer macromolecules encoded by the circular DNA molecule. In some aspects, the RNA polymerase is a T7 RNA polymerase.

[0161] The present invention further provides a method for inducing a tumor-specific immune response in a subject, immunizing against tumor formation / tumor, treating a subject's cancer, and / or alleviating a subject's cancer symptoms, by administering to the subject a composition comprising a polymer macromolecule as described herein.

[0162] According to the present invention, the cancer vaccine described above can be used in patients who have been diagnosed with cancer or are at risk of developing cancer. In one aspect, the patient may have solid tumors such as breast cancer, ovarian cancer, prostate cancer, lung cancer, kidney cancer, stomach cancer, colon cancer, testicular cancer, head and neck cancer, pancreatic cancer, brain cancer, melanoma, and other tumors of tissues and organs, as well as hematologic malignancies such as lymphoma and leukemia, including acute myeloid leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, T-cell lymphocytic leukemia, and B-cell lymphoma.

[0163] This disclosure further provides kits comprising compositions including polymeric macromolecules as described herein or components necessary for synthesizing such compositions. In some aspects, the kits include all components necessary, sufficient, or useful for administering such compositions to mammalian subjects.

[0164] experiment The following embodiments are provided to demonstrate and further illustrate certain preferred aspects and aspects of the invention, and should not be construed as limiting its scope.

[0165] Example 1. The polymeric form of siRNA was investigated, demonstrating the immunostimulatory and therapeutic potential of large RNA polynucleotides. Polymeric RNAs (polyRNAs) of up to approximately 3000 base pairs were synthesized using an isothermal RCT method with dumbbell DNA templates. These polyRNAs consisted of hairpin repeats with 25-base-pair (bp) stems linked by spacer sequences (Fig. 2A). When complexed with a biodegradable polymer, the polyRNA enhanced TLR3 activation in vitro compared to the clinically tested TLR3 agonist poly(I:C), and exhibited additional TLR7 activation (Fig. 2B). Notably, the polyRNA significantly improved survival in an endogenetic ID8Trp53- / - mouse model of ovarian cancer compared to poly(I:C) (Fig. 2C). Enzymatic removal of the hairpin loops reduced innate immune activation and therapeutic efficacy.

[0166] Example 2. An engineered, modular polymeric RNA scaffold platform for spatially confined combinatorial control of innate immune signaling.

[0167] Theoretical basis. Despite extensive exploration of vaccine adjuvants, few adjuvants, particularly PRR agonists, have been approved for clinical use in vaccines, partly because (1) they rely primarily on single-agonist systems, making it difficult to mimic the recognition of natural pathogens by the innate immune system; (2) the mechanisms by which combinations of agonists mediate synergistic or inhibitory immune responses are poorly understood; and (3) tools for precise spatial modulation and agonist combination are limited. To address these challenges, we will engineer a modular molecular scaffold for the controlled combination and spatial patterning of PRR agonists. By encoding and enzymatically synthesizing repetitive RNA sequences via rolling circle transcription, we will use polyRNA repetitive sequences as building blocks to design a variety of agonists, while providing structural flexibility to optimize multivalent PRR engagement. We will adopt a bottom-up approach, first exploring the polyRNA backbone and then extending the RNA as a scaffold ( Figure 3 Modular platforms will enable the exploration of structure-function relationships and ultimately the rational design of multi-PRR agonists to modulate innate immune activation.

[0168] PolyRNA backbone libraries were synthesized in combination with RIG-I, TLR3 and TLR7 / 8 agonists.We will first explore the combinatorial design space of the polyRNA backbone, which can integrate three structural motifs as PRR agonists: (1) a double-stranded RNA (dsRNA) for TLR3 and melanoma differentiation-associated protein-5 (MDA5) activation; (2) a single-stranded RNA (ssRNA) for TLR7 / 8 activation; and (3) a 5' triphosphate dsRNA for RIG-I activation. To synthesize a library of polyRNA backbones, we will design a series of circular DNA templates encoding polyRNA repetitive sequences. The circular templates will be generated by linking linear DNA, followed by RCT at 37°C for 24–48 hours using T7 RNA polymerase to generate large RNA polymers. The template library will be designed with different structural features across the polyRNA backbone: (1) dsRNA motif length (0–40 bp); (2) ssRNA motif length (6–30 bases); (3) the percentage of G / U bases in the ssRNA motif (50–100%), as TLR7 / 8 can exhibit increased specificity for G / U-rich ssRNA25. Since TLR3 activation occurs largely in a sequence-independent manner, randomized dsRNA sequences will be used throughout the library. Additionally, all polyRNAs will contain 5' triphosphate, introducing the possibility of RIG-I activation. Systematic variations in ds- and ssRNA lengths can modulate innate immune activation via length-dependent TLR activation and spatial separation of TLR agonists, as each component acts as a spacer between other agonists.

[0169] Structural characterization. We will analyze the size distribution of polyRNAs using agarose gel electrophoresis and the folding of probe RNAs using sequence-specific enzymatic digestion. We will also use (1) atomic force microscopy (AFM) and (2) negative staining single-particle electron microscopy (EM) to screen the polyRNA genome. Both techniques will provide initial images of the folding, structural homogeneity, and any self-assembled or aggregated structures of polyRNAs, varying with the repeat regions of ds- and ssRNAs. These results, combined with the evaluation of innate immune activation and efficacy in this and subsequent objectives, will pave the way for future in-depth studies using frozen single-particle EM to elucidate the mechanisms by which polyRNAs bind to various PRRs and to inform the rational design of polyRNAs.

[0170] In vitro studies.We will evaluate PRR signaling induced by polyRNA libraries using reporter cell lines (InvivoGen), including HEK-Blue™ human and mouse TLR3, TLR7, and TLR8 cells, as well as HEK-LuciaTMRIG-I cells, each of which co-expresses a specific PRR and secretes a downstream reporter. As a validation of principle, we will use the transfection reagent Lipofectamine™ 3000 for screening. EC50 values ​​will be determined via dose-response mapping (0.1–10,000 ng / mL). Because modular polyRNA design allows for independent variation of each component, we will use a single PRR reporter cell line to determine the effects of RNA motif length and spatial segregation. As positive controls, we will use known PRR agonists: high molecular weight poly(I:C) (TLR3), remiquimod (TLR7 / 8), and 19-bp dsRNA (RIG-I). Next, to evaluate the overall impact of polyRNA-linked PRR synergies on downstream signaling, we will use RAW264.7 mouse macrophages and THP-1 human monocyte reporter cells to measure (1) NF-κB transcription factor activity and interferon-stimulated gene (ISG) expression; and (2) activation (CD40, CD80, CD86 markers) and secreted cytokine profiles (IFN-β, TNF-α, IL-6, IL-12p70) of mouse bone marrow-derived dendritic cells (BMDCs). In addition to the known PRR agonists mentioned above, we will include physical mixtures of these agonists to assess whether multivalent combinations of PRR agonists in individual molecules enhance activation. We will identify structure-function relationships and determine how the combination and spatial arrangement of agonist motifs along polyRNAs synergistically or inhibitorily affect immune activation. Due to the linking nature of polyRNAs, rigorous analysis of each component is difficult. The following polyRNA structures will be used as alternatives to single PRR agonist polyRNA controls: (1) TLR3: mainly dsRNA repeat sequences with minimal (<6 bases) ssRNA spacers to achieve template circularization, wherein the 5' triphosphate is removed by RNA 5' pyrophosphate hydrolase; (2) TLR7 / 8: complete ssRNA repeat sequences with the 5' triphosphate removed; (3) RIG-I and TLR3: same as (1), but without the 5' triphosphate removed.

[0171] A patterned TLR9 agonist was introduced onto a polyRNA scaffold, and the agonist ratio and spatial density were adjusted to limit... Define a series of immune response profiles. Next, we will use polyRNA as a scaffold to attach TLR9 agonists in a spatially controlled manner. Figure 3Each repeating, with its defined sequence, allows the complementary DNA strand to hybridize with the extended CpG-rich sequence, much like a comb along the RNA backbone. We will design a polyRNA library with the following parameters: (1) hybridization sequence length (10–20 bases); (2) CpG DNA comb length (20–40 bases); and (3) dsRNA (10–30 bp) and ssRNA (12–42 bases) spacer lengths. We will begin with a portion of the backbone identified in Target 1.1 that has co-innate immune activation and add a backbone with an extended ssRNA region for longer hybridization and / or spacer sequences. The polyRNA backbone will be heated to 95°C with a CpG comb and slowly cooled to room temperature for hybridization. Hybridization will be verified by gel electrophoresis and enzymatic digestion with ribonuclease H and deoxyribonuclease I. We will characterize the structure by AFM and negative staining EM screening.

[0172] In vitro evaluation of innate immune activation will be performed using Lipofectamine™: (1) activation of specific PRRs, including TLR9, in reporter cell lines; (2) NF-κB activation and ISG expression in RAW264.7 and THP-1 reporter cells; and (3) cytokine profiles of BMDC activation and secretion. The ratio of TLR9 to TLR3 and TLR7 / 8 agonists will be modulated by titrating the molar amount of hybridized CpG DNA combs. In vitro immune response profiles will be compared between polyRNA scaffolds, RNA backbones without CpG combs, individual CpG combs, and known PRR agonists (including CpG oligodeoxynucleotides for TLR9) and their physical mixtures to determine the synergistic or inhibitory effects of agonist combinations in polyRNA scaffolds.

[0173] Success criteria and statistical analysis: PolyRNA structural characterization will be optimized based on successful PRR activation of each agonist incorporated into the polyRNA and the synergistic combination of PRR agonist components, as determined by dose-response profiles and BMDC activation. The combined effects in the polyRNA will be assessed by evaluating dose-response profiles using the aforementioned single PRR agonist polyRNA alternatives and known PRR agonists, via EC50 values ​​and the Bliss / Loewe synergistic score. Significant differences in immune activation profiles will be assessed using ANOVA and Tukey post-hoc tests.

[0174] Expected outcomes and alternative strategies. We anticipate that the integration of multiple PRR agonists along a polyRNA scaffold will promote synergistic innate immune activation more effectively than single agonists or mixtures of physical agonists, due to the spatial control, structural flexibility, and co-location of agonists within the same molecule for cellular co-activation. We also expect the defined repeatability of polyRNAs to enable the control of a range of immune response profiles by modulating the spatial arrangement and ratio of agonists.

[0175] Example 3. Develop a strategy for synthesizing mannan-modified polyRNAs.

[0176] To create the synthetic glycopolyRNA, we will conjugate mannan to polyRNA via reductive amination. The mannan will be oxidized with sodium periodate to obtain aldehyde groups, and then incubated with a polyRNA scaffold containing a hybridized amine-modified CpG DNA strand in the presence of sodium cyanoborohydride. The conjugate will be characterized by polyacrylamide gel electrophoresis (PAGE) to determine migration changes. AFM and negative staining transmission electron microscopy will be used to characterize the glycopolyRNA conjugate structure. To further assess whether the glycopolyRNA forms a self-assembled nanostructure, we will perform dynamic light scattering measurements. Importantly, we will evaluate the stability of the glycopolyRNA against nuclease degradation by incubating the glycopolyRNA in human serum at 37°C and assessing RNA degradation by PAGE. The amount of mannan used for conjugation will be titrated to optimize the serum stability of the glycopolyRNA.

[0177] To evaluate the cellular uptake and innate immune activation capabilities of glycopolyRNAs.We will use flow cytometry and confocal microscopy to evaluate the uptake of Cy5-labeled glycopolyRNAs generated by Cy5-UTP during RCT in mouse BMDCs after one and four hours of incubation. GlycopolyRNAs conjugated with different amounts of mannan will be tested. Mannan alone and unmodified polyRNAs will be included as comparisons. To verify the immune cell targeting specificity and uptake mechanism of mannan-modified polyRNAs, we will (1) measure uptake in the presence of antibodies against different receptors (Dectin-1, Dectin-2, CD206, CD209, TLR2, and TLR4) capable of recognizing mannan, or in the presence of inhibitors of scavenger receptor class A-mediated and clathrin-mediated endocytosis; and (2) compare the uptake of glycopolyRNAs in various non-immune cell lines. Next, as in Objective 1, we will measure the activation of specific PRRs by glycopolyRNA, unmodified polyRNA, and mannan-only in HEK-Blue™ reporter cell lines only, with the addition of TLR2, TLR4, Dectin-1, and Dectin-2 reporter cell lines, to test whether glycopolyRNA additionally activates these PRRs. Yeast polysaccharide and lipopolysaccharide will be used as positive controls for Dectin-1 / 2 and TLR2 / 4 activation, respectively. Activation of BMDCs by glycopolyRNA will be assessed by: (1) staining for CD40 and CD86 activation markers; and (2) measuring secreted cytokines, including IFN-β, IL-6, TNF-α, and IL-12p70. As a baseline, we will use the clinically approved lipid nanoparticle packaging system (DLin-MC3-DMA)27 for the polyRNA.

[0178] Success criteria: The optimization of glycopolyRNA design will be guided by the following: (1) no nuclease degradation of glycopolyRNA in serum within 24 hours; (2) RNA uptake levels of glycopolyRNA by BMDC comparable to those of BMDC encapsulated by lipid nanoparticles; and (3) BMDC activation levels equal to or greater than those induced by unmodified BMDC. We will evaluate the synergistic effects of mannan and the BMDC agonist components and perform statistical comparisons of BMDC activation.

[0179] Expected outcomes and alternative strategies. Since reductive amination has been used to conjugate polysaccharides to proteins, we anticipate that hybridization of amine-modified DNA with polyRNA will allow for successful conjugation of mannan. We expect that conjugation of mannan to polyRNA will enable multivalent interactions with the target PRR on BMDCs, which, together with the structural flexibility of polyRNA, will promote robust cellular uptake and immune activation.

[0180] Example 3. Validate the therapeutic efficacy of the RNA platform in a syngeneic mouse model of melanoma.

[0181] Theoretical basis. Cancer vaccines hold great promise for training the immune system to recognize and attack tumor cells, but have so far shown limited clinical benefit. Developing effective adjuvants that can promote robust antitumor immune responses, as well as identifying suitable tumor antigens, remains a major gap. In situ vaccines can initiate and amplify antitumor immune responses via tumor antigens released from immunogenic cell death, followed by APC recruitment and activation, offering the advantages of (1) presenting a complete tumor antigen profile; and (2) a simple, ready-to-use protocol that does not require resource-intensive ex vivo procedures or personalized neoantigen prediction. To evaluate the translational potential of “integrated” RNA, we will test its therapeutic efficacy as an in situ vaccine in an established melanoma B16F10 mouse model. The poor immunogenicity and high invasiveness of the B16F10 model provide a rigorous test for the efficacy of polyRNAs. Several TLR agonists have been used as in situ vaccines in clinical trials (e.g., NCT04544007, NCT03865082), and we expect multi-pathway glycopolyRNAs to induce more robust antitumor immunity. Since the primary feasibility objective is to evaluate antitumor immune responses induced by glycopolyRNAs, we will employ local treatment to differentiate the potential effects and toxicities of systemic delivery from the immune function of RNA.36 We will utilize the rich tumor antigen library within the tumor as a training camp to initiate and amplify antitumor responses in situ, thereby potentially triggering systemic immunity while minimizing the risk of systemic toxicity. As demonstrated by many others, achieving high local bioavailability via local application while limiting initial exposure to the tumor can safely and effectively enhance antitumor immunity.

[0182] To evaluate the antitumor immune response induced by glycopolyRNA.We subcutaneously inoculated B16F10 cells into the right flank of 6–8 week old C57BL / 6 mice. When the mean tumor volume reached 150 mm³, we administered glycopolyRNA (10 µg) intratumorally every three days, along with a control treatment, for a total of three doses (Table 1). The clinically tested agonist corresponding to the agonist component in the polyRNA was used as the baseline, using the formulation currently in clinical trials (NCT04570332, nanocomposite poly(I:C)BO112)41. PolyRNA encapsulated with lipid nanoparticles (DLin-MC3-DMA) was used as the delivery baseline for the glycopolyRNA. Although further possible co-controls exist, we prioritized these treatment groups for practical reasons. Tumor size and survival were monitored daily to evaluate therapeutic efficacy. Body weight was also monitored to assess systemic toxicity. Mice with completely regressed tumors were re-challenged with B16F10 tumors in the contralateral flank to determine systemic long-acting antitumor immunity.

[0183] Analysis of in vivo immune response profile. We will perform profiling of the in vivo immune response to glycopolyRNA in other cohorts of mice (n=5-6 per treatment group). Following three treatments, key effector cells in the tumor will be measured by flow cytometry: CD8+ T cell frequency, CD8+ T cell / CD4+ Treg cell ratio, activated CD8+ T cells (IFN-γ, granzyme B expression), activated natural killer cell (CD69+, CD107a+) frequency, and M1-like and M2-like macrophages (CD206 and CD86 expression, respectively). Activated dendritic cells (CD86 expression) in tumor-draining lymph nodes will be assessed. In a separate cohort (n=5-6 per group), we will use ELISA to measure intratumoral and serum cytokine levels (including IFN-β, TNF-α, CXCL-9, and CXCL-10, key mediators of anti-tumor T cell activation and recruitment) four hours after two doses.

[0184] Success criteria and statistical analysis: We will use the Mantel-Cox log-rank test to compare overall survival, with success defined as a significant increase in survival relative to the baseline agonist and lipid nanoparticle-polyRNA. We will use a Cox proportional hazards model to estimate hazard ratios. Based on our power analysis using the Mantel-Cox log-rank test at a 5% significance level and 80% power, we estimate that 10 mice are needed per group for the survival study. Each treatment group will include an equal number of male and female mice to account for sex as a biological variable. We will use ANOVA and Tukey post-hoc tests to assess differences in tumor volume, cytokine levels, and flow cytometry quantification of immune cell populations.

[0185] Expected outcomes and alternative strategies.Because the glycopolyRNA integrates multiple spatially controlled PRR agonists and mannan components targeting APCs, we anticipate it can achieve multi-pathway innate immune activation and improve therapeutic efficacy compared to benchmark single PRR agonists. Furthermore, since multivalent mannan displayed on nanoparticles has been shown to induce anti-tumor immunity, we expect that mannan conjugated along a polyRNA scaffold will enhance therapeutic efficacy compared to mannan alone and lipid nanoparticle-encapsulated polyRNA.

[0186] Example 4. This example describes the synthesis and characterization of polyRNA and its hybridization with a DNA comb.

[0187] Reagents: • DNA template T52 (ordered from IDT, purified by ribonuclease-free HPLC). DNA template sequence (T52): 5'phos-CACGAACTTGCTGAT TGATAAGGAGGTGTGGTGTGATGGAAAGTT ATCAGCAAGTTCGTGTTCTTTCAGCCAACAA GCTGAAAGAA (SEQ ID NO: 9) • DNA comb (ordered from IDT, purified by ribonuclease-free HPLC) • T4 DNA ligase - 20,000 units (NEB, catalog number M0202S) • UltraPure™ Deoxyribonuclease / ribonuclease-free distilled water (Invitrogen, catalog number 10977015) • NxGen T7 RNA polymerase (Biosearch, catalog number 30223-1) • Ribonucleotide (NTP) solution mixture (NEB, catalog number N0466) • Deoxyribonuclease I (without ribonuclease) - 5000 units (NEB, catalog number M0303L) RNA Cleaner and Concentrator-25 (Zymo Research, catalog number R1017) • Agarose (Low EEO / Multi-purpose / Molecular Biology Grade) (Fisher BioReagents™, Catalog No. BP160-500) • NaCl (5 M), without ribonuclease (Invitrogen, catalog number AM9759) • EDTA, 0.5 M (pH 8.0), molecular grade (Promega™, catalog number V4233) • UltraPure™ 1 M Tris-HCl buffer, pH 7.5 (Invitrogen, catalog number 15567027) program: Part 1, DNA template ligation 1. Before starting work, spray the workbench, empty test tube rack, and pipettes with ribonuclease-away spray, but ensure they are completely dry before use, especially the pipettes. (Optional) 2. Prepare the heating block: set it to 95℃.

[0188] 3. Thaw the DNA template and place it on ice for later use.

[0189] 4. Thaw the ligation buffer (T4 DNA ligase buffer (10x)) and place it on ice. Mix with a pipette before use.

[0190] 5. Set up the ligation reaction according to the table below (add all components except T4 DNA ligase). Use Eppendorf 0.5 mL test tubes. Remove the tubes from the container and place them on a clean Kimwipe to avoid ribonuclease contamination. First add water, then add the template and ligation buffer. Mix the mixture up and down with a pipette as you add small amounts of liquid.

[0191]

[0192] * Do not add ligase in this step; add ligase after the denaturation / cooling step.

[0193] 6. Heat in the heating block at 95°C for 2 minutes. Turn off the heating block and allow it to cool slowly to room temperature within ~1.5 hours.

[0194] 7. Whenever you take it out of the refrigerator, keep the T4 DNA ligase on ice.

[0195] 8. After the reaction has cooled to room temperature, briefly centrifuge the condensate off the cap, and then add T4 DNA ligase to the reaction. Mix using a pipette tip, or gently mix thoroughly with a larger pipette tip.

[0196] 9. Incubate at room temperature for 2 hours for the ligation reaction.

[0197] Part 2, Rolling Circular Transcription (RCT) 1. Add the components of the RCT reaction to the ligation reaction. Thaw the mixture of T7 reaction buffer and NTP solution, briefly vortex, and centrifuge before adding. Keep the T7 RNA polymerase on ice whenever it is removed from the freezer. Finally, add the T7 RNA polymerase and mix with a pipette.

[0198] RCT reaction (300 μL)

[0199] 2. Centrifuge to remove any air bubbles and incubate at 37°C for 24 hours with shaking at 1000 rpm for RCT reaction.

[0200] 3. After the RCT reaction, you will be able to observe some white precipitate near the bottom / wall of the test tube.

[0201] Part 3, Deoxyribonuclease I treatment 1. Establish the following reaction on ice and mix thoroughly by inverting the test tube 10 times. Note: Do not centrifuge or drop the mixture.

[0202]

[0203] Incubate at 2.37℃ for 15 minutes.

[0204] 3. Add 37 μL of 0.5 M EDTA to dissolve the RNA-Mg 2+ A white precipitate / cloudiness composed of microsponges. Invert the test tube 10 times to mix thoroughly. Incubate at room temperature for about 10 minutes, until the solution becomes clear, and centrifuge off any liquid adhering to the cap and tube walls.

[0205] 4. Heat inactivate at 75°C for 10 minutes and cool on ice. Equilibrate the mixture to room temperature before starting the column purification procedure in step 5.

[0206] 5. Purify the product using RNA Clean & Concentrator-25 (Zymo Research). Follow the manufacturer’s instructions to “purify small and large RNAs into separate fractions” to obtain large RNA (>200 nt) as the final product. Note: (1) Number of centrifuge columns used: Use one centrifuge column for T52, 900 μL RCT. (2) Use approximately 80 μL of ribonuclease-free free water per column to elute the purified RNA.

[0207] Part 4, Characterization of PolyRNAs 1. Measure the concentration using Nanodrop, calculate the “corrected” concentration, prepare aliquots, and store at -80°C.

[0208] 1.) Obtain the molecular weight (in grams per mol) of a repeating nucleotide sequence of the desired polyRNA. a. Using this website ( www.bugaco.com / calculators / dna_reverse_complement.php), input the nucleotide sequence of the DNA template for transcribing polyRNA to obtain the reverse complementary repeat polyRNA sequence.

[0209] b. Using this website ( www.biosearchtech.com / oligospec-calculator-6628 ), input the reverse complementary repeat polyRNA sequence to obtain the main chain MW of the desired polyRNA.

[0210] 2.) Calculate the “corrected” concentration of the polyRNA (in ng / uL). a. First, the original concentration of polyRNA (in ng / uL) was obtained by NanoDrop UV-Vis spectrophotometry.

[0211] b. Using this website ( www.biosearchtech.com / oligospec-calculator-6628 ), input a repeating nucleotide sequence of the desired polyRNA to obtain the extinction coefficient (ε) at 260 nm.

[0212] c. Calculate the custom coefficients of the desired polyRNA using the following equation:

[0213] d. Identify the default coefficient for Nanodrop to quantify RNA (typically 40 ngcm / μL). e. Obtain the ratio between the custom coefficient and the default coefficient (custom / default), and multiply this ratio by the original polyRNA concentration obtained via Nanodrop to calculate the "corrected" polyRNA concentration. 2. Perform 1.5% agarose gel electrophoresis to determine the molecular weight distribution of the polyRNA synthesized using T52 as the DNA template. The expected average molecular weight of the heat-denatured polyRNA should be approximately 1000 nt. Running conditions: 80V, 1.5 h, 90 ml gel (1.5%). Loading conditions: Approximately ~400 ng of polyRNA per lane. Denaturation conditions: Heat the prepared sample at 70°C for 4-5 min.

[0214] Part 5, PolyRNA:DNA Hybridization 1. Based on the desired amount (in μg) of the polyRNA that the user wishes to hybridize with DNA, calculate the nanomolar amount corresponding to a repeating nucleotide sequence of the polyRNA using the following equation:

[0215] 2. Determine the desired DNA:RNA ratio (the DNA:RNA ratio is based on the nanomoles # of each polyRNA repeat, and the polyRNA value will always be equal to 1, while the nanomoles # of each DNA repeat will vary depending on the desired ratio). Note: For example, if you plan to prepare a 0.25:1 DNA:RNA hybrid, multiply the nanomoles # of each repeat obtained in step 3 by 0.25 to obtain the nanomoles of DNA needed to mix with the RNA.

[0216] 3. Calculate the volume (in μL) of DNA comb required to achieve the desired DNA:RNA ratio by mixing with the desired amount of polyRNA using the following equation:

[0217] 4. Calculate the volume (in μL) of the desired amount of polyRNA required to mix with the desired amount of DNA comb.

[0218] 5. Prepare a 10x concentrated hybridization buffer with a final concentration of 150 mM NaCl, 1 mM EDTA pH 8.0 and 10 mM Tris pH 7.5.

[0219] 6. Calculate the final hybridization solution volume (containing DNA and polyRNA) by dividing the total amount of RNA and DNA in the solution (in ng) by the value 148.2. In a 200 μL PCR tube, mix the polyRNA and DNA comb with 10x hybridization buffer and ribonuclease-free water to the final volume calculated in step 8, where the 10x hybridization buffer becomes a 10-fold dilution (1x final concentration). Note: The final concentration of the hybrid is 148.2 ng / μL.

[0220] 7. Place the PCR tubes into the thermal cycler and set the lid of the thermal cycler to 80°C for constant heating.

[0221] 8. Set up a thermal cycler scheme in which the test tube is heated at 75°C for 5 minutes, and then the temperature is gradually reduced at 1°C / min until it reaches 22°C.

[0222] 9. Store the hybrid at -80°C until used again.

[0223] Figure 3 A schematic diagram of polymer macromolecules with RIG-1 PRR agonists, TLR7 / 8 PRR agonists, TLR9 PRR agonists, and TLR3 PRR agonists is presented. Activation data for hTLR3, hTLR7, hTLR8, and hRIG-1 are also provided.

[0224] Figure 4The formation of hybrids (polyRNA, DNA comb, polyRNA-DNA comb) is shown; mTLR9 activation via T19:D12-CpG; RAW-Dual NF-kB activation via T19:D12-CpG; and RAW-dual IRF activation via T19:D12-CpG.

[0225] Figure 5 The distribution of ionizable lipids (DLin-MC3-DMA(MC3))(OF-C4-Deg-Lin(C4)) is shown; the molecular weight distribution of polyRNAs (T19 polyRNA, T51 polyRNA and T52 polyRNA); MC3 LNP (IRF activation); and MC3 versus C4 (activation).

[0226] Example 5. This example demonstrates the in vivo therapeutic efficacy of a polymeric RNA scaffold. CT26 colorectal tumor-bearing mice were treated with intratumoral injection of polyRNA (T52), polyRNA:CpG DNA hybrid (T52:D15-CpG), and a baseline control (see [link to relevant documentation]). Figure 6A T52:D15-CpG and T51:D15ctl-CpG represent polyRNAs hybridized to CpG combs and mismatched CpG DNA controls (see Figure BD). Tumor growth curves (BC) and overall survival are shown (see Figure BD). Figures 6B-6D ). *p<0.05; **p<0.01; ****p<0.0001.

[0227] Citing Join For all purposes, the full disclosure of each patent document and scientific article mentioned in this article is incorporated herein by reference.

[0228] Equivalent scheme This invention may be embodied in other specific forms without departing from its spirit or essential characteristics. Therefore, the foregoing embodiments are to be considered illustrative in all respects and not limiting of the invention described herein. Consequently, the scope of the invention is defined by the appended claims rather than the foregoing description, and all modifications within the equivalent meaning and scope of the claims should be included therein.

Claims

1. A composition comprising one or more polymer macromolecules, in, Each of the polymer macromolecules comprises multiple linked pattern recognition receptor (PRR) agonists. Each of the polymer macromolecules comprises at least two different PRR agonists. Each of the PRR agonists comprises a nucleic acid molecule capable of activating a specific PRR.

2. The composition according to claim 1, wherein, The multiple linked PRR agonists are formulated together for combined presentation after administration to mammalian subjects.

3. The composition according to claim 1, wherein, The plurality of connected PRR agonists are arranged to reproduce different portions of one or more PRR agonist characteristics of one or more pathogens.

4. The composition according to claim 1, wherein, A particular PRR agonist exists twice or more among the multiple connected PRR agonists.

5. The composition according to claim 4, wherein, The occurrence of two or more times is between 2 and 1,000,000 times.

6. The composition according to claim 1, wherein, Two or more different PRR agonists in the plurality of connected PRR agonists each exist independently two or more times.

7. The composition according to claim 5, wherein, The occurrence of two or more times is between 2 and 1,000,000 times.

8. The composition according to claim 1, wherein, At least one of the PRR agonists includes a hairpin loop within the nucleic acid molecule.

9. The composition according to claim 1, wherein, At least one of the PRR agonists includes single-stranded RNA (ssRNA) and / or single-stranded DNA (ssDNA) within the nucleic acid molecule.

10. The composition according to claim 9, wherein, The ssRNA and / or ssDNA within the nucleic acid molecule are between 4 and 1000 base pairs.

11. The composition according to claim 9, wherein, The percentage of guanine / uracil bases in the ssRNA is between 0% and 100%.

12. The composition according to claim 1, wherein, At least one of the PRR agonists includes double-stranded RNA (dsRNA) and / or double-stranded DNA (dsDNA) within the nucleic acid molecule.

13. The composition according to claim 12, wherein, The dsRNA and / or dsDNA within the nucleic acid molecule are between 1 and 500 base pairs.

14. The composition according to claim 1, wherein, At least one of the PRR agonists includes a 5'-triphosphate moiety within the nucleic acid molecule.

15. The composition according to claim 1, wherein, At least one of the PRR agonists includes a stem portion within the nucleic acid molecule.

16. The composition according to claim 1, wherein, The multiple connected PRR agonists are arranged in a linear, one-to-one manner.

17. The composition according to claim 16, wherein, Each PRR agonist in the linearly linked PRR agonist series is sequentially positioned in a linear, one-to-one manner.

18. The composition according to claim 1, wherein, The multiple connected PRR agonists are arranged in a non-linear manner.

19. The composition according to claim 1, in, The plurality of PRR agonists is between 2 and 10,000 PRR agonists; or Wherein, the plurality of PRR agonists is between 2 and 1,000 PRR agonists; or Wherein, the plurality of PRR agonists is between 2 and 100 PRR agonists; or The plurality of PRR agonists is between 2 and 10.

20. The composition according to claim 1, in, The number of different PRR agonists within each polymer macromolecule ranges from 2 to 10,000; or The number of different PRR agonists within each polymer macromolecule is between 2 and 1,000; or The number of different PRR agonists within each polymer macromolecule is between 2 and 100; or The number of different PRR agonists within each polymer macromolecule ranges from 2 to 10.

21. The composition according to claim 1, wherein, The plurality of PRR agonists are selected from 3 PRR agonists, 4 PRR agonists, 5 PRR agonists, 6 PRR agonists, 7 PRR agonists, 8 PRR agonists, 9 PRR agonists, 10 PRR agonists, 11 PRR agonists, 12 PRR agonists, 13 PRR agonists, 14 PRR agonists, 15 PRR agonists, 16 PRR agonists, 17 PRR agonists, 18 PRR agonists, 19 PRR agonists, 20 PRR agonists, 25 PRR agonists, and 50 PRR agonists.

22. The composition according to claim 1, wherein, The various PRR agonists within each polymer macromolecule were selected from 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, and 50 PRR agonists.

23. The composition according to claim 1, in, At least one of the polymer macromolecules and / or the composition further includes a targeting portion. The targeted portion is selected from: vitamins, ligands, amines, peptide fragments, antibodies, aptamers, transferrin, antibodies or fragments thereof, sialic acid Lewis X antigen, lipids, lipids (including cationic, neutral and steroidal lipids, viral microsomes and liposomes), fungal cell wall polysaccharides, hyaluronic acid, mannan, mannose derivatives, glucose derivatives, cell-specific lectins, galactagogues, galactose lectins, lactose ceramides, steroidal derivatives, RGD sequences, EGF, EGF-binding peptides, urokinase receptor-binding peptides, platelet-reactive protein-derived peptides, albumin derivatives and / or molecules derived from combinatorial chemistry.

24. The composition according to claim 1, in, The targeted fraction is selected from: sialic acid, 9-N-(4H-thieno[3,2-c]chromene-2-carbamoyl)-Neu5Acα2-3Ga1β-4G1cNAc (TCCNeu5Ac), folic acid, methotrexate, folate, galactose residues, lactose, low-density lipoprotein (LDL), ovalbumin (OVA), lactobionic acid, mannan, mannose, mannose-rich glycoconjugates, mannosylated poly(L-lysine) (MPL), yeast polysaccharides, and other β-glucan, glucan, polyguanine, and apoB protein fragments.

25. The composition according to claim 1, in, The composition is partially associated with liposomes, wherein the association is selected from complexation, conjugation, encapsulation, absorption, adsorption, and incorporation; and / or The polymer macromolecules are partially associated with liposomes, wherein the association is selected from compounding, conjugation, encapsulation, absorption, adsorption and doping.

26. The composition according to claim 1, wherein, Each of the multiple PRRs and PRR agonists is independently selected from: TLR2 and TLR2 agonists TLR3 and TLR3 agonists TLR4 and TLR4 agonists TLR5 and TLR5 agonists TLR7 / 8 and TLR7 / 8 agonists TLR9 and TLR9 agonists NOD1 and NOD1 agonists NOD2 and NOD2 agonists TLR2 / NOD2 and TLR2 / NOD2 agonists NOD1 / NOD2 and NOD1 / NOD2 agonists RIG1 / MDA5 and RIG1 / MDA5 agonists DAI and DAI agonists LRRFIP1 and LRRFIP1 agonists, AIM2 and AIM2 agonists RIG1 and RIG1 agonists Dectin-1 and Dectin-1 agonists Mincle and Mincle agonists STING and STING agonists MDA5 and MDA5 agonists LGP2 and LGP2 agonists DDX41 and DDX41 agonists DHX9 and DHX9 agonist, DDX3 and DDX3 agonists DDX36 and DDX36 agonists DDX-1-DDX-21-DDX36 and DDX-1-DDX-21-DDX36 agonists, DDX60 and DDX60 agonists KU70 and KU70 agonists cGAS and cGAS agonists NLRP3 and NLRP3 agonists IFI16 and IFI16 agonist, LRRFIP1 and LRRFIP1 agonists, DAI and DAI agonists CDS and CDS agonists RLR and RLR agonists, CLR and CLR agonists IFIT1 and IFIT1 agonists IFIT2 and IFIT2 agonists IFIT3 and IFIT3 agonists, and IFIT5 and IFIT5 agonists.

27. The composition according to claim 1, wherein, The plurality of PRR agonists within at least one of the polymer macromolecules include: One or more RIG-1 agonists, One or more TLR7 / 8 agonists, One or more TLR9 agonists, and One or more TLR3 agonists.

28. The composition according to claim 27, wherein, One or more of the PRR agonists include hairpin rings.

29. The composition according to claim 27, wherein, One or more of the RIG-1 agonists include a 5'-triphosphate moiety.

30. The composition according to claim 27, wherein, One or more of the TLR7 / 8 agonists include ssRNA.

31. The composition according to claim 27, wherein, One or more of the TLR7 / 8 agonists include ssRNAs having a guanine / uracil percentage between 0 and 100.

32. The composition according to claim 27, wherein, One or more of the TLR3 agonists include dsRNA.

33. The composition according to claim 27, wherein, One or more of the TLR9 agonists include ssDNA.

34. The composition according to claim 27, wherein, One or more of the RIG1 agonists include dsRNA or ssRNA.

35. The composition according to claim 1, wherein, The composition, when administered to mammalian subjects, can stimulate and / or modulate the innate immune response in the mammalian subjects.

36. The composition according to claim 1, wherein, One or more of the polymer macromolecules also include one or more portions of a nucleic acid molecule that are not characterized as a PRR agonist.

37. The composition according to claim 1, wherein, The composition is used to induce an immune response to vaccine application.

38. The composition according to claim 1, wherein, The composition, when administered to the subject, is able to stimulate an innate immune response in at least one cancer cell, wherein the mammalian subject has cancer.

39. The composition according to claim 1, wherein, Stimulating an innate immune response includes stimulating an innate cytokine response mediated by cytokines, wherein the innate cytokine response is mediated by type I interferon.

40. The composition according to claim 1, in, The composition further associates with an antigen, wherein the association is selected from complexation, conjugation, encapsulation, absorption, adsorption, and incorporation; and / or The polymer macromolecules are further associated with the antigen, wherein the association is selected from compounding, conjugation, encapsulation, absorption, adsorption and doping.

41. The composition according to claim 40, wherein, The antigens are selected from the group consisting of: α-actin-4, Bcr-Abl fusion protein, Casp-8, β-linkin, cdc27, cdk4, cdkn2a, coa-1, dek-can fusion protein, EF2, ETV6-AML1 fusion protein, LDLR-fucosyltransferase AS fusion protein, HLA-A2, HLA-A11, hsp70-2, KIAAO205, Mart2, Mum-1, 2 and 3, neo-PAP, myosin class I, OS-9, pml-RARα fusion protein, PTPRK, K-ras, N-ras, triose phosphate isomerase, Bage-1, Gage 3, 4, 5, 6, 7, GnTV, Herv-K-mel, Lage-1, Mage-A1, 2, 3, 4, 6, 10, 12, Mage-C2, NA-88, NY-Eso-1 / Lage-2, SP17, SSX-2, and TRP2-Int2, MelanA (MART-I), gp100 (Pmel 17), tyrosinase, TRP-1, TRP-2, MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, p15(58), CEA, RAGE, NY-ESO (LAGS), SCP-1, Hom / Mel-40, PRAME, p53, H-Ras, HER-2 / neu, BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR, Epstein-Barr virus antigen, EBNA, human papillomavirus (HPV) antigens E6 and E7, TSP-180, MAGE-4, MAGE-5, MAGE-6, p185erbB2, p180erbB-3, c-met, nm-23H1, PSA, TAG-72-4, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, β-linkin, CDK4, Mum-1, p16, TAGE, PSMA, PSCA, CT7, telomerase, 43-9F, 5T4, 791Tgp72, α-alpha-fetoprotein, 13HCG, BCA225, BTAA, CA 125, CA 15-3 (CA 27.29\BCAA), CA 195, CA 242, CA-50, CAM43, CD68\KP1, CO-029, FGF-5, G250, Ga733 (EpCAM), human EGFR protein or fragments thereof, such as human EGFR residues 306-325 (SCVRACGADSYEMEEDGVRK (SEQ ID NO:1)) and residues 897-915 (VWSYGVTVWELMTFGSKPY (SEQ ID NO:2)), HTgp-175,M344, MA-50, MG7-Ag, MOV18, NB / 70K, NY-CO-1, RCAS1, SDCCAG16, TA-90 (Mac-2 binding protein / cyclophilic C-related protein), TAAL6, TAG72, TLP, TPS, WT1 (and WT1-derived peptide sequences: WT1 126-134 (RMFP NAPYL (SEQ ID NO:3)), WT1 122-140 (SGQARMFPNAPYLPSCLES (SEQ ID NO:4)) and WT1 122-144 (SGQARMFPNAPYLPSCLESQPTI (SEQ ID NO:5)), MUC1 (and MUC1-derived peptides and glycopeptides, such as RPAPGS (SEQ ID NO:6), PPAHGVT (SEQ ID NO:7) and PDTRP (SEQ ID NO:6)). NO:8), LMP2, EGFRvIII, Idiotype, GD2, Ras mutant, p53 mutant, Protease 3 (PR1), Survival protein, hTERT, Sarcoma translocation breakpoint, EphA2, EphA4, LMW-PTP, PAP, ML-IAP, AFP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, ALK, Androgen receptor, Cyclin B1, Polysialic acid, MYCN, RhoC, TRP-2, GD3, Fucosyl GM1, Mesothelin, sLe (animal), CYP1B1, PLAC1, GM3, BORIS, Tn, GloboH, NY-BR-1, RGS5, SART3, STn, Carbonic anhydrase IX, PAX5, OY-TES1, Sperminin 17, LCK, HMWMAA, AKAP-4, XAGE 1, B7H3, Bean podase, Tie 2, Page 4, VEGFR2, MAD-CT-1, FAP, PDGFR-α, PDGFR-β, MAD-CT-2, Fos-associated antigen 1, ERBB2, folate receptor 1 (FOLR1 or FBP), IDH1, IDO, LY6K, fms-associated tyrosine kinase 1 (FLT1, best known as VEGFR1), KDR, PADRE, TA-CIN (recombinant HPV16 L2E7E6), SOX2, neoantigen, and aldehyde dehydrogenase.

42. The composition according to claim 40, wherein, The antigen is derived from its own antigen.

43. The composition according to claim 40, in, The antigen is conjugated to the outer surface of the composition; and / or The antigen is conjugated to the polymer macromolecule.

44. The composition according to claim 1, in, The composition is associated with an adjuvant, wherein the association is selected from complexation, conjugation, encapsulation, absorption, adsorption, and blending; and / or The polymer macromolecules are associated with the adjuvant, wherein the association is selected from compounding, conjugation, encapsulation, absorption, adsorption and doping.

45. The composition according to claim 44, wherein, The adjuvant is selected from the group consisting of: CPG, polyIC, poly-ICLC, 1018 ISS, aluminum salts (e.g., aluminum hydroxide, aluminum phosphate), Amplivax, BCG, CP-870, CP-893, CpG7909, CyaA, dSLIM, cytokines (such as GM-CSF, IL-2, IFN-α, Flt-3L), IC30, IC31, imiquimod, ImuFact IMP321, IS Patch, ISS, ISCMATRIX, Juvlmmune, LipoVac, MF59, monophospholipid A, Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, Montanide ISA-51, OK-432, OM-174, OM-197-MP-EC, ONTAK, PepTel.RTM, vector system, PLGA microparticles, imiquimod, remiquimod, gademod, 3M-052, SRL172, viral microsomes and other virus-like particles, YF-17D, VEGF trap, β-glucan, Pam3Cys, Aquila's QS21 stimulator, vardemisinin, AsA404 (DMXAA), 3M MEDI9197, glucanyl pyranosyl lipid adjuvants (GLA), GLA-SE, CD1d ligands (such as C20:2, OCH, AH04-2, α-galactosylceramide, α-C-galactosylceramide, α-mannoseceramide, α-fructoseceramide, β-galactosylceramide, β-mannoseceramide), STING agonists (e.g., cyclic dinucleotides, including cyclic [G(3',5')pA(3',5')p], cyclic [G(2',5')pA(3',5')p], cyclic [G(2',5')pA(2',5')p], cyclic diadenosine monophosphate, cyclic diguanosine monophosphate), CL401, CL413, CL429, flagellin, RC529, E6020, imidazoquinone-based small molecule TLR-7 / 8a (including its lipid analogues), viral microsomes, AS01, AS02, AS03, AS04, AS15, IC31, CAF01, ISCOM, cytokines (such as GM-CSF, IL-2, IFN-α, Flt-3L), bacterial toxins (such as CT and LT), any derivatives of adjuvants, and any combination of adjuvants.

46. ​​The composition according to claim 1, in, The composition is associated with nanoparticles, wherein the association is selected from composite, adjuvant, encapsulation, absorption, adsorption, and doping; and / or The polymer macromolecules are associated with the nanoparticles, wherein the association is selected from compounding, adsorption, encapsulation, absorption, adsorption and doping.

47. The composition according to claim 46, wherein, The nanoparticles are selected from the group consisting of: sHDL nanoparticles, metal-polyhistidine-DOPE@liposomes, metal-polyhistidine-PEG, 4-arm-PEG-polyhistidine-metal hydrogels, sHDL-polyhistidine, fullerenes, endohedral metal-fullerene briquette spheres, trimetallic nitride-templated endohedral metal-fullerenes, single-walled and multi-walled carbon nanotubes, branched and dendritic carbon nanotubes, gold nanorods, silver nanorods, single-walled and multi-walled boron / nitrate nanotubes, carbon nanotube pods, carbon nanohorns, carbon nanohorn pods, liposomes, nanoshells, dendritic polymers, any nanostructure, microstructure or derivative thereof formed using layer-by-layer processes, self-assembly processes or polyelectrolytes, microparticles, quantum dots, superparamagnetic nanoparticles, nanorods, cellulose nanoparticles, glass and polymer microspheres and nanospheres, biodegradable PLGA microspheres and nanospheres, gold nanoparticles, silver nanoparticles, carbon nanoparticles, iron nanoparticles, modified micelles, and metal-organic framework (MOF) coordination polymers (CP).

48. The method according to claim 1, in, The composition is associated with one or more of the following: nanoparticles, liposomes, dendritic polymers, micelles, nanoemulsions, nanosuspensions, vesicles, nanocapsules, magnetic nanoparticles, lipoprotein-based carriers, and / or lipid complex nanoparticles; wherein the association is selected from complexation, conjugation, encapsulation, absorption, adsorption, and doping; and / or The polymer macromolecule is associated with one or more of the following: nanoparticles, liposomes, dendritic polymers, micelles, nanoemulsions, nanosuspensions, vesicles, nanocapsules, magnetic nanoparticles, lipoprotein-based loads and / or lipid complex nanoparticles; wherein the association is selected from compounding, conjugation, encapsulation, absorption, adsorption and doping.

49. A method for treating or preventing immune dysregulation in a mammalian subject, comprising administering the composition of claim 1 to the mammalian subject, wherein, The administration resulted in stimulation and / or modulation of the innate immune response of the mammalian subject.

50. The method according to claim 49, wherein, The mammalian subject suffers from a disease or condition characterized by the aforementioned immune dysregulation.

51. The method according to claim 50, wherein, The disease or condition mentioned is cancer, infectious disease, autoimmune disease, and / or inflammatory disease.

52. The method according to claim 50, wherein, The cancers are selected from the group consisting of: breast cancer, brain cancer, thyroid cancer, prostate cancer, colorectal cancer, pancreatic cancer, cervical cancer, stomach cancer, endometrial cancer, liver cancer, bladder cancer, ovarian cancer, testicular cancer, head and neck cancer, skin cancer, mesothelial lining leukocyte carcinoma, esophageal cancer, muscle cancer, connective tissue cancer, lung cancer, adrenal cancer, kidney cancer, bone cancer, or testicular cancer and their metastases.

53. The method according to claim 50, wherein, The disease or condition described is selected from one or more of the following: acne vulgaris; acute disseminated encephalomyelitis; acute hemorrhagic leukoencephalitis; Addison's disease; agammaglobulinemia; allergy; alopecia areata; Alzheimer's disease; amyotrophic lateral sclerosis; autoimmune anemia, hemolytic anemia; pernicious anemia; ankylosing spondylitis; anti-GBM / TBM nephritis; antiphospholipid syndrome; antisynthetic enzyme syndrome; temporal arteritis (also known as "giant cell arteritis"); juvenile arthritis; psoriatic arthritis; reactive arthritis (Rea syndrome); rheumatoid arthritis; asthma; atherosclerosis. Chemotherapy; Atopic allergy; Atopic dermatitis; Autoimmune enteropathy; Autoimmune aplastic anemia; Barlow disease / Barlow concentric sclerosis; Bart syndrome; Behçet's syndrome; Berger's disease; Bickerstaff encephalitis; Blau syndrome; Chronic bronchitis; Bullous pemphigoid; Bursitis; Autoimmune cardiomyopathy; Kassman disease; Celiac diarrhea; Chronic fatigue syndrome; Chronic inflammatory demyelinating polyneuropathy; Chronic relapsing multifocal osteomyelitis; Chag-Strauss syndrome; Cicatricial pemphigoid; Primary biliary cirrhosis; Cogan syndrome; Cold agglutinin disease; Colitis; Complement component 2 deficiency; Connective tissue disease, mixed type; connective tissue disease, undifferentiated COPD (chronic obstructive pulmonary disease); cranial arteritis; CREST syndrome; cryoglobulinemia; Cushing's syndrome; cutaneous leukocytic vasculitis; interstitial cystitis; dacryoadenitis; Dego's disease; Delcomo's disease; dermatitis; herpetic dermatitis; autoimmune progesterone dermatitis; dermatomyositis; diabetes mellitus; nephrogenic diabetes insipidus; type 1 diabetes mellitus; diffuse systemic sclerosis of the cutaneous system; discoid lupus erythematosus; Diverticulitis; Dresler syndrome; Dysmenorrhea (menstrual cramps / pain); Eczema; Endometriosis; Enthesitis-associated arthritis; eosinophilic fasciitis; eosinophilic gastroenteritis; acquired bullous epidermolysis; erythema nodosum, primary mixed cryoglobulinemia; Evans syndrome; progressive ossifying fibrosis; fibromyalgia; fibrotic alveolitis; atrophic gastritis; gastrointestinal pemphigoid. Giant cell arteritis; glomerulonephritis; Goodpasser syndrome; acute gout; Arthritis-related gout; Graves' disease; Guillain-Barré syndrome (GBS); hemolytic anemia; Hashimoto's encephalitis; Hashimoto's thyroiditis; autoimmune hemolytic anemia; allergic purpura; autoimmune hepatitis; viral hepatitis; herpes gestationis; hypogammaglobulinemia; idiopathic inflammatory demyelinating disease; idiopathic pulmonary fibrosis; Iga nephropathy; intestinal obstruction (bowel obstruction); inclusion body myositis; inflammatory bowel disease, Crohn's disease; inflammatory bowel disease, ulcerative colitis; Inflammatory demyelinating polyneuropathy; autoimmune inner ear disease; interstitial cystitis; irritable bowel syndrome (IBS); juvenile idiopathic arthritis; juvenile rheumatoid arthritis; Kawasaki disease; kidney stones; Lambert-Eaton myasthenic syndrome; leukocytic vasculitis; lichen planus; sclerosing lichen; linear IgA disease (LAD); Lujarig's disease (also known as amyotrophic lateral sclerosis); lupus-like hepatitis; lupus; systemic lupus erythematosus; autoimmune lymphoproliferative syndrome; Majid syndrome; Meniere's disease; meningitis; microscopic polyangiitis; Miller-Fischer syndrome Combination syndrome; scleroderma; Muhar-Haberman disease; multiple sclerosis; multiple sclerosis; myasthenia gravis; myositis; inclusion body myositis; nephritis; nephrotic syndrome; neuromyelitis optica (also known as Dweck's disease); neuromuscular rigidity; neutropenia; neutropenia caused by myelosuppressive chemotherapy; ocular cicatricial pemphigoid; ocular inflammation (acute and chronic nonbacterial inflammation of the anterior segment of the eye); oculoclonus-myoclonus syndrome; Od thyroiditis; osteoarthritis; Paget's bone disease; relapsing rheumatoid arthritis; autoimmune pancreatitis; PANDAS (and streptococci) streptococcus Related pediatric autoimmune neuropsychiatric disorders; paraneoplastic cerebellar degeneration; Parkinson's disease; paroxysmal nocturnal hemoglobinuria (PNH); Parry-Ronberg syndrome; pars plana inflammation; Parsony-Turner syndrome; pelvic inflammatory disease; pemphigus; pemphigus vulgaris; nonrheumatic pericarditis; autoimmune peripheral neuropathy; perivenous encephalomyelitis; POEMS syndrome; polyarteritis nodosa. Recurrent polychondritis, autoimmune polyendocrine syndrome; polymyalgia rheumatica; Polymyalgia rheumatica; polymyositis; Primary sclerosing cholangitis; Progressive inflammatory neuropathy; Prostatitis, chronic pseudogout; psoriasis, pure red cell aplasia; pyoderma gangrenosa; Rasmussen's encephalitis; Raynaud's phenomenon; Reiter's syndrome; restless legs syndrome; retinopathy of prematurity; retroperitoneal fibrosis; Rheumatoid fever; Allergic rhinitis; sarcoidosis; Schmidt syndrome; Schnitzler syndrome; scleritis; scleroderma; systemic sclerosis; Sjögren's syndrome; spondyloarthritis; Still's disease; subacute bacterial endocarditis (SBE); Sussac syndrome; Sweet's syndrome; Sydenham's chorea; sympathetic ophthalmia; Takayasu arteritis; temporomandibular joint disorder (TMJD or TMD) or TMJ syndrome; autoimmune thrombocytopenic purpura; idiopathic thrombocytopenic purpura; Tolosa-Hunter syndrome; transplant rejection; transverse myelitis; undifferentiated spondyloarthritis; urticaria; autoimmune uveitis; nonrheumatic valvular disease; vasculitis; vitiligo and Wegener's granulomatosis.

54. The method according to claim 50, in, The cancer is selected from one or more of the following: bladder cancer, brain cancer, breast cancer, cervical cancer, ovarian cancer, colorectal cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, nasopharyngeal cancer, pancreatic cancer, prostate cancer, skin cancer, stomach cancer, gastric cancer, head and neck cancer, testicular cancer, melanoma, acute myeloid leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, T-cell lymphocytic leukemia, B-cell lymphoma, and uterine cancer; The autoimmune diseases mentioned are selected from systemic lupus erythematosus, Aicardi-Goutières syndrome, acute pancreatitis, age-dependent macular degeneration, alcoholic liver disease, liver fibrosis, metastasis, myocardial infarction, non-alcoholic steatohepatitis (NASH), Parkinson's disease, polyarthritis / fetal and neonatal anemia, sepsis, inflammatory bowel disease, and multiple sclerosis.

55. The method according to claim 49, wherein, The composition is administered in an amount that effectively modulates the adaptive immune response in the mammalian subject.

56. The method according to claim 49, wherein, The composition is administered intradermally, subcutaneously, intravenously, intraperitoneally, intraarterially, intrasheathically, intracystically, intraorbitally, intracardiacly, intradermally, transcutaneously, transtracheally, subepidermally, intra-articularly, intratumorally, subcystically, subarachnoidly, intraspinally, intrasternally, orally, sublingually, buccally, rectally, vaginally, nasally, or ocularly, or by infusion, inhalation, or nebulization.

57. The method according to claim 49, wherein, The application site is the skin or subcutaneous tissue.

58. The method according to claim 49, wherein, The application site is the intestine.

59. The method according to claim 49, wherein, The application site is not in the intestine.

60. The method according to claim 49, wherein, The application site is the respiratory tract.

61. The method according to claim 49, wherein, The composition is formulated to allow the PRR agonist to be distributed systemically after administration.

62. The method according to claim 49, wherein, The composition is administered in multiple doses over a duration of administration, wherein the duration of administration is at least two weeks.

63. The method according to claim 62, wherein, The dosage is administered subcutaneously daily or every other day.

64. The method according to claim 49, wherein, The mammalian subjects were human patients.

65. The method according to claim 64, wherein, The patient was immunosuppressed or immunocompromised.

66. The method according to claim 64, wherein, The patient in question is an elderly patient.

67. The method according to claim 64, wherein, The patient in question is a pediatric patient.

68. The method of claim 49, further comprising co-administering one or more additional therapeutic agents.

69. The method according to claim 68, wherein, The additional therapeutic agent is selected from the group consisting of: disease-modifying antirheumatic drugs (e.g., leflunomide, methotrexate, sulfasalazine, hydroxychloroquine), biologics (e.g., rituximab, infliximab, etanercept, adalimumab, golimumab), nonsteroidal anti-inflammatory drugs (e.g., ibuprofen, celecoxib, ketoprofen, naproxen, piroxicam, diclofenac), analgesics (e.g., acetaminophen, tramadol), immunomodulators (e.g., anaproxil, abatacept), glucocorticoids (e.g., prednisone, methylprednisone), TNF-α inhibitors (e.g., adalimumab, pegylated cetuzumab, etanercept, golimumab, infliximab), IL-1 inhibitors, and metalloproteinase inhibitors. In some aspects, the therapeutic agent includes, but is not limited to, infliximab, adalimumab, etanercept, parenteral gold, or oral gold.

70. The method according to claim 68, wherein, The additional therapeutic agents are selected from the group consisting of: interleukin, hexamethylmelamine, amifostine, asparaginase, bleomycin, capecitabine, carboplatin, carmustine, clavibine, cisapride, cisplatin, cyclophosphamide, cytarabine, dacarbazine (DTIC), actinomycin D, docetaxel, doxorubicin, dronabinol, epoisetin α, etoposide, filgrastim, fludarabine, fluorouracil, gemcitabine, granisetron, and hydroxyurea. Idarubicin, ifosfamide, interferon-alpha, irinotecan, lansoprazole, levamisole, leucovorin, megestrol acetate, mesna, methotrexate, metoclopramide, mitomycin, mitotane, mitoxantrone, omeprazole, ondansetron, paclitaxel (TAXOL), pilocarpine, prochlorperazine, rituximab, tamoxifen, paclitaxel, topotecan hydrochloride, trastuzumab, vincristine, vinorelbine, and vinorelbine tartrate.

71. A composition comprising a DNA molecule encoding one or more polymer macromolecules as described in claim 1.

72. The composition according to claim 71, wherein, The DNA molecule in question is a circular DNA molecule.

73. The composition according to claim 72, wherein, Rolling circle transcription of the circular DNA molecule using RNA polymerase results in the generation of one or more polymer macromolecules encoded by the circular DNA molecule.

74. The composition according to claim 73, wherein, The RNA polymerase is T7 RNA polymerase.

75. A method comprising: Transcription encodes a circular DNA molecule containing one or more polymer macromolecules as described in claim 1. The circular DNA molecule is transcribed using RNA polymerase via rolling circle transcription. The transcription results in the generation of one or more polymer macromolecules encoded by the circular DNA molecule.

76. The method according to claim 75, wherein, The RNA polymerase is T7 RNA polymerase.

Images