An engineered nanovesicle, a preparation method thereof and application of the engineered nanovesicle in clearing neutralizing antibodies

Abstract

The present application relates to the technical field of biological medicine, in particular to an engineered nanovesicle, a preparation method thereof and application of the engineered nanovesicle in clearing and neutralizing antibodies. The present application provides an engineered nanovesicle, wherein the engineered nanovesicle comprises a red blood cell membrane loaded with a cholester-modified protein. The engineered nanovesicle provided by the present application can be used for in vivo infusion, and by being systemically infused in vivo, the cholester-coupled VP protein on the surface of the engineered nanovesicle can be combined with a large amount of free AAV neutralizing antibodies in plasma, so that the AAV neutralizing antibodies can be effectively adsorbed following blood circulation, the free neutralizing antibodies in blood are reduced, and beneficial conditions are created for subsequent AAV vector infusion and effective delivery into cells.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to an engineered nanovesicle, its preparation method, and its application in clearing and neutralizing antibodies. Background Technology

[0002] Adeno-associated virus (AAV) is a non-pathogenic single-stranded DNA virus that can efficiently infect both dividing and non-dividing cells. Due to its high safety, broad host range, and low immunogenicity, it is one of the most mature and widely used gene therapy delivery vectors. With continuous optimization of viral packaging, capsid engineering, manufacturing processes, and clinical dosing strategies, AAV gene therapy has made significant progress. More than six AAV vector-related therapeutic products have been approved for marketing and are used in the clinical treatment of rare genetic diseases, metabolic diseases, and ophthalmic diseases. The widespread favor of AAV in scientific research and clinical practice is mainly attributed to its excellent safety profile, efficient and durable gene delivery and expression capabilities, and relatively low immunogenicity. These characteristics collectively give it unparalleled advantages in various in vivo and in vitro gene delivery scenarios.

[0003] However, AAV gene therapy has a significant limitation: due to widespread natural exposure, more than half of the population carries AAV antibodies. AAV is a common virus in nature; although it is not pathogenic itself, humans can be naturally infected with different serotypes of AAV during childhood through respiratory or digestive routes. Therefore, a large proportion of the adult population carries AAV neutralizing antibodies (NAbs). In some studies, even extremely low titers of NAbs can significantly reduce or even completely eliminate AAV delivery efficiency in the body. Therefore, addressing these antibodies and eliminating their neutralizing effects is a crucial issue that needs to be addressed in AAV gene therapy. In some clinical studies, patients have experienced elevated liver enzymes and inflammatory markers after AAV administration, often indicating the involvement of cellular immune responses. These immune responses not only affect efficacy but may also increase safety risks; therefore, the development of AAV gene therapy typically requires monitoring the patient's immune status and developing appropriate immunosuppressive regimens.

[0004] Currently, studies have attempted to reduce AAV antibody levels in patients using plasmapheresis or immunoadsorption techniques. These methods can significantly reduce antibodies in the short term, thereby improving the in vivo delivery efficiency of AAV carriers. However, B cells can re-secrete IgG within days, resulting in a short duration of action and limited effectiveness in individuals with high antibody titers. Furthermore, plasmapheresis removes all IgG, IgM, clotting factors, cytokines, etc., and the large volume of blood circulation can lead to electrolyte changes, hypotension, and increased risk of infection. Therefore, it is necessary to find a method for clearing neutralizing antibodies. Summary of the Invention

[0005] The purpose of this invention is to provide an engineered nanovesicle, its preparation method, and its application in clearing neutralizing antibodies, thereby addressing the problems existing in the prior art. The engineered nanovesicles provided by this invention can effectively adsorb AAV neutralizing antibodies via systemic infusion into the body, following the bloodstream, reducing free neutralizing antibodies in the blood and creating favorable conditions for subsequent AAV carrier infusion and effective delivery into cells. The engineered nanovesicles prepared by this invention can selectively adsorb a specific type of neutralizing antibody without affecting the patient's resistance to other pathogens, resulting in lower infection risk, less invasiveness, and the ability to be administered repeatedly.

[0006] To achieve the above objectives, the present invention provides the following solution: The present invention provides an engineered nanovesicle comprising a red blood cell membrane loaded with three cholesterol-modifying proteins; The method for constructing the cholesterol-modified protein includes the following steps: Recombinant vectors containing the VP1, VP2, and VP3 protein-coding genes were constructed, and after expression and purification, three recombinant proteins were obtained. The nucleotide sequence of the VP1 protein-coding gene is shown in SEQ ID NO.1; the nucleotide sequence of the VP2 protein-coding gene is shown in SEQ ID NO.2; and the nucleotide sequence of the VP3 protein-coding gene is shown in SEQ ID NO.3. The three recombinant proteins were subjected to desalting, cysteine ​​activation, coupling, and purification processes in sequence to obtain the three cholesterol-modified proteins.

[0007] More preferably, the molar ratio of cholesterol-modified VP1 protein, cholesterol-modified VP2 protein and cholesterol-modified VP3 protein among the three cholesterol-modified proteins is 1:1:10.

[0008] Optionally, the desalting process includes the step of treating the recombinant protein using a chromatographic column; The chromatographic column is a gel filtration chromatography desalting column.

[0009] More preferably, the gel filtration chromatography desalting column is a HiTrap Desalting column.

[0010] Optionally, the cysteine ​​activation treatment includes the steps of mixing the desalted VP protein obtained from the desalting treatment with a dithiothreitol solution, allowing it to stand, and then desalting it again.

[0011] Optionally, in the mixture obtained by mixing, the final concentration of dithiothreitol is 5 mM, and the final concentration of desalted VP protein is 1 mg / mL; The settling temperature is 25°C, and the settling time is 15 minutes; The chromatographic column used for the secondary desalting is a gel filtration chromatography desalting column.

[0012] More preferably, the gel filtration chromatography desalting column is a HiTrap Desalting column.

[0013] Optionally, the coupling treatment includes the steps of mixing a cholesterol-polyethylene glycol-maleimide solution and the protein solution obtained from the cysteine ​​activation treatment, performing a light-protected reaction, and then adding an L-cysteine ​​solution to perform a quenching reaction.

[0014] Optionally, the concentration of cholesterol-polyethylene glycol-maleimide in the cholesterol-polyethylene glycol-maleimide solution is 50 mM; the concentration of protein in the protein solution is 1 mg / mL; and the molar ratio of maleimide groups in the cholesterol-polyethylene glycol-maleimide solution to thiol groups in the protein solution obtained by cysteine ​​activation treatment is 8:1. The light-protected reaction takes 2 hours and is carried out at a temperature of 4°C. The concentration of L-cysteine ​​in the L-cysteine ​​solution was 50 mM. The quenching reaction takes 15 minutes and is carried out at a temperature of 4°C.

[0015] The present invention provides a method for preparing the above-mentioned engineered nanovesicles, the method comprising the steps of mixing and incubating a red blood cell membrane solution and a cholesterol-modified protein solution, performing extrusion and density gradient centrifugation to obtain the engineered nanovesicles.

[0016] Optionally, the protein concentration in the erythrocyte membrane solution is 2-4 mg / mL; the protein concentration in the cholesterol-modified protein solution is 0.5-1 mg / mL; the volume ratio of the cholesterol-modified protein to the erythrocyte membrane is 9:1; the cholesterol-modified protein includes cholesterol-modified VP1 protein, cholesterol-modified VP2 protein, and cholesterol-modified VP3 protein; and the molar ratio of the cholesterol-modified VP1 protein, the cholesterol-modified VP2 protein, and the cholesterol-modified VP3 protein is 1:1:10. The incubation time is 30-60 minutes, and the temperature is 37°C. The density gradient centrifugation includes the steps of sequentially adding a 40% volume percentage solution of iodixanol and a 25% volume percentage solution of iodixanol.

[0017] This invention provides the application of the above-described engineered nanovesicles in the preparation of drugs that clear neutralizing antibodies.

[0018] The present invention provides a drug for clearing neutralizing antibodies, the drug comprising the above-described engineered nanovesicles.

[0019] The present invention discloses the following technical effects: This invention provides an engineered nanovesicle comprising a red blood cell membrane loaded with cholesterol-modified proteins. The engineered nanovesicles provided by this invention can be used for in vivo infusion. Through systemic infusion, the cholesterol-coupled VP protein on the surface of the engineered nanovesicles can bind to a large number of freely existing AAV neutralizing antibodies in plasma. This allows for effective adsorption of AAV neutralizing antibodies during blood circulation, reducing free neutralizing antibodies in the blood and creating favorable conditions for subsequent AAV carrier infusion and effective delivery into cells. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 This diagram illustrates engineered nanovesicles, their preparation methods, and the principle of neutralizing antibody clearance. A and B represent the preparation methods of engineered nanovesicles, while C illustrates the principle of neutralizing antibody clearance by engineered nanovesicles. Figure 2 This experiment is for VP protein coupling verification; where A is polyacrylamide gel electrophoresis with silver staining, and the marker is the protein molecular weight standard (25-180kDa); B is for cholesterol content detection. Figure 3 These are representative TEM images of engineered nanovesicles; the scale bar is 100 nm.

[0022] Figure 4 These are the results of a safety experiment; where A represents cell viability; B represents mouse interleukin-6; C represents mouse tumor necrosis factor-α; D represents creatinine; E represents alanine aminotransferase; and F represents body weight. Figure 5 Results of cell antibody clearance experiment; Figure 6 This is an animal antibody clearance experiment; where A is animal imaging and B is luciferase expression level. Detailed Implementation Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0023] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0024] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0025] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0026] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0027] The sequences of the genes encoding the VP1, VP2, and VP3 proteins of AAV9 involved in this invention are shown below: The nucleotide sequence of the gene encoding the VP1 protein of AAV9 is shown in SEQ ID NO.1, specifically: The nucleotide sequence of the gene encoding the VP2 protein of AAV9 is shown in SEQ ID NO.2, specifically: The nucleotide sequence of the gene encoding the VP3 protein of AAV9 is shown in SEQ ID NO.3, specifically:

[0028] The sequences of the primers used in this invention are shown in Table 1.

[0029] Table 1. Specific sequences of primers The raw materials for preparing the engineered nanovesicles provided by this invention are: pretreated red blood cell membranes and three cholesterol-modifying proteins (VP1-cholesterol, VP2-cholesterol and VP3-cholesterol).

[0030] The engineered nanovesicles, their preparation method, and the schematic diagram of the principle of clearing neutralizing antibodies provided by this invention are shown below. Figure 1 As shown, the preparation method is described in the following examples. The principle of clearing neutralizing antibodies follows the conventional neutralization pathway: the neutralizing antibody directly binds to the AAV vector, neutralizing the AAV and preventing the vector from entering the cell to complete gene delivery. However, the engineered nanovesicles provided by this invention act as "decoys," effectively adsorbing free neutralizing antibodies in vivo through surface modification, thereby competitively consuming the antibodies. The AAV vector, "unbound" by the antibody, can then successfully enter the cell and complete gene delivery, achieving the goal of effectively clearing neutralizing antibodies and restoring AAV vector function. In short, the engineered nanovesicles provided by this invention, through the competitive mechanism of "adsorbing neutralizing antibodies," relieve the neutralizing effect of antibodies on the AAV vector, ensuring that the vector can normally enter the cell to perform its gene delivery function.

[0031] Example 1: Preparation of cholesterol-modified protein The preparation methods for three cholesterol-modified proteins include expression in *E. coli*, column chromatography purification, and chemical bonding with cholesterol. The steps are as follows: 1. Plasmid construction and expression in Escherichia coli 1.1 The experimental materials are as follows: Template: In this embodiment, as an optional template preparation method, a PDG9 plasmid (as a plasmid template from which the target gene is derived, with clear map information from which the target gene fragment for subsequent experiments can be obtained) is pre-constructed. The construction method is as follows: The commercially available AAV9 helper packaging plasmid pAAV2 / 9n (purchased from Addgene, Cat number: 112865) was used as the initial template for the target gene, as detailed below: Step 1: Primer Design and Full Plasmid Amplification: The AAV9 helper packaging plasmid pAAV2 / 9n, purchased above, was used as the initial template. Two pairs of specific primers (SEQ ID NO. 10-13) containing SwaI and ClaI mutation sites, respectively, were designed for the VP1 gene sequence. Full plasmid site-directed mutagenesis PCR amplification was performed using high-fidelity DNA polymerase to obtain the full-length linearized mutant plasmid fragment. In this embodiment, SEQ ID NO. 10 and SEQ ID NO. 11 were used for the first round of PCR amplification, and SEQ ID NO. 12 and SEQ ID NO. 13 were used for the second round of amplification.

[0032] The PCR reaction system (50 μL) is prepared as follows: 25 μL of 2× high-fidelity DNA polymerase premix (Master Mix), 2 μL of forward primer (10 μM), 2 μL of reverse primer (10 μM), 1 μL of pAAV2 / 9n plasmid or first-round PCR amplification product (approximately 10-50 ng / μL), and nuclease-free water (ddH2O) to bring the total volume to 50 μL.

[0033] The PCR amplification program was set as follows: pre-denaturation at 95℃ for 3 minutes; followed by 35 cycles (denaturation at 95℃ for 15 seconds, annealing at 60℃ for 15 seconds, extension at 72℃ for 2 minutes); and finally, complete extension at 72℃ for 5 minutes, followed by storage at 4℃.

[0034] Step 2: Original Template Digestion and Plasmid Circularization: Add 1-2 μL of DpnI restriction endonuclease (10 U / μL) to a 50 μL PCR reaction system containing the obtained full-length linearized mutant plasmid fragment. Gently mix and briefly centrifuge, then incubate at 37°C for 1-2 hours to specifically degrade the methylated, unmutated AAV9 helper packaging plasmid template (i.e., unmutated pAAV2 / 9n). The circular plasmid produced after DpnI restriction endonuclease digestion can be directly used for the next transformation step.

[0035] Step 3: Transformation, Screening, and Double Enzyme Digestion Identification: The product digested with DpnI restriction endonuclease was transformed into *E. coli* DH5α competent cells and plated on LB agar plates containing 100 μg / mL ampicillin, then incubated overnight. Single colonies were picked, plasmids were extracted, and double enzyme digestion with SwaI and ClaI was performed for identification. After sequencing verification, positive single colonies containing the PDG9 plasmid were successfully obtained. The extracted PDG9 plasmid can be used as a template for amplifying the VP target gene fragment in subsequent experiments.

[0036] It should be noted that the above-described process of introducing SwaI and ClaI restriction sites into the full plasmid is only one specific operational path for obtaining the template in this embodiment, and is not a necessary step for obtaining the target gene in this invention. Since specific primers are used for subsequent amplification, the original pAAV2 / 9n plasmid can be directly used as the amplification template.

[0037] Expression vector (pET): Any pET series expression vector with a clear map is selected as the vector template (pET series vectors have efficient expression regulation ability in Escherichia coli and can meet the needs of target gene expression). The expression vector used in this invention is pET-28a(+).

[0038] Primers: Primers VP1-F / R, VP2-F / R and VP3-F / R were designed based on the PDG9 plasmid. The specific primers are shown in Table 1.

[0039] Enzyme: Novizan high-fidelity enzyme (high-fidelity enzymes have high fidelity, which can reduce the occurrence of base mismatches during PCR amplification, ensure the accuracy and integrity of amplification products, and provide reliable DNA fragments for subsequent experiments).

[0040] 1.2 Plasmid transformation and extraction: Add 1-2 μL of pET-28a(+) plasmid to 100 μL of thawed E. coli DH5α competent cells. Incubate on ice for 30 minutes, then heat shock at 42°C for 90 seconds, followed by rapid transfer to ice for 2 minutes. Add 500 μL of antibiotic-free LB liquid medium and incubate at 37°C with shaking at 200 rpm for 1 hour. Spread the culture onto LB agar plates containing 50 μg / mL kanamycin and incubate overnight at 37°C with inverted incubation. Pick successfully grown pET-28a(+) single colonies and positive single colonies containing PDG9 plasmid successfully constructed and identified in step 1.1 above, and inoculate them into LB liquid medium containing 50 μg / mL kanamycin or 100 μg / mL ampicillin, respectively. Incubate at 37°C with shaking at 200 rpm for 12-16 hours (or overnight) to allow the bacteria to expand to the logarithmic growth phase. The bacterial pellet was then collected by centrifugation (4000 rpm, 10 minutes). Following the instructions in the Tiangen plasmid extraction kit, PDG9 plasmid and pET-28a(+) plasmid were extracted and purified. The plasmid concentration and purity were measured using an ultra-micro spectrophotometer and then stored at -20℃ for later use.

[0041] 1.3 Target gene amplification and vector linearization: First, using the PDG9 plasmid (or the original pAAV2 / 9n plasmid) as a template, PCR amplification was performed using the three primer pairs VP1-F / R, VP2-F / R and VP3-F / R in Table 1, respectively, with Novizan high-fidelity DNA polymerase to obtain nucleotide fragments of the target gene VP1, VP2 and VP3 with homologous sequences at both ends.

[0042] The PCR reaction system (50 μL) was prepared as follows: 25 μL of 2× high-fidelity DNA polymerase premix (Master Mix), 2 μL of forward primer (10 μM), 2 μL of reverse primer (10 μM), 1 μL of PDG9 plasmid template (approximately 10-50 ng / μL), and nuclease-free water (ddH2O) to a final volume of 50 μL.

[0043] The PCR amplification program was set as follows: pre-denaturation at 95℃ for 3 minutes; followed by 35 cycles (denaturation at 95℃ for 15 seconds, annealing at 60℃ for 15 seconds, extension at 72℃ for 2 minutes); and finally, complete extension at 72℃ for 5 minutes, followed by storage at 4℃.

[0044] After the PCR reaction, 5 μL of the amplification product was taken for agarose gel electrophoresis to confirm the size of the target band. Then, the VP1, VP2, and VP3 target gene fragments with homologous arms at both ends were purified and recovered using a gel extraction kit (e.g., Novizan DC301-01). Based on the multiple cloning site (MCS) information of the pET-28a(+) vector, two restriction endonucleases, NdeI and SalI, were selected for double digestion of the pET-28a(+) blank vector. The enzyme digestion reaction system (prepared as a 50 μL double enzyme digestion reaction system, with the following component concentrations and volumes: pET-28a(+) plasmid template: 2 μg; 10× enzyme digestion reaction buffer: 5 μL (final concentration 1×); restriction endonuclease NdeI (10 U / μL or 20 U / μL): 1 μL; restriction endonuclease SalI (10 U / μL or 20 U / μL): 1 μL; nuclease-free water (ddH2O): to bring the volume to 50 μL) was incubated at 37℃ for 1-2 hours. After enzyme digestion, the pET-28a(+) vector backbone was separated by agarose gel electrophoresis and recovered as a fully linearized vector for subsequent homologous recombination.

[0045] 1.4. Glue recovery: Glue recovery was performed using the Novizan Glue Recovery Kit (Catalog No.: DC301-01).

[0046] 1.5 Homologous Recombination: Prepare a homologous recombination reaction system. Perform homologous recombination between the target gene (PCR products encoding genes VP1, VP2, and VP3, with nucleotide sequences as shown in SEQ ID NO.1-SEQ ID NO.3) and the linearized pET-28a(+) vector fragment. Gently mix the homologous recombination reaction system, centrifuge, and incubate at 37°C for 30 minutes. After the reaction, immediately place the centrifuge tube on ice to cool (or store at 4°C) to allow homologous recombination between the target gene and the linearized pET-28a(+) vector fragment to form a recombinant plasmid. The homologous recombination enzyme used in this step was purchased from Novizan, catalog number C117.

[0047] Three homologous recombination reaction systems, VP1, VP2, and VP3, were prepared separately. The specific contents of each tube were as follows: 100 ng of linearized pET-28a(+) vector, the corresponding target gene fragments (the amount added was calculated based on the molar ratio of vector to insert fragment 1:2, and the amounts of VP1 target gene (concentration of 40 ng / μL), VP2 target gene (concentration of 40 ng / μL), and VP3 target gene (concentration of 40 ng / μL) were 2.1 μL, 1.7 μL, and 1.5 μL, respectively), 4 μL of 5× CE II Buffer, 2 μL of Exnase II homologous recombination enzyme, and nuclease-free water (ddH2O) was added to make up to 20 μL. Finally, recombinant plasmids containing VP1 target gene (pET-28a(+)-VP1), VP2 target gene (pET-28a(+)-VP2), and VP3 target gene (pET-28a(+)-VP3) were obtained. Because the pET-28a(+) vector used in this invention has a sequence encoding a 6×His tag upstream of the multiple cloning site, the N-terminus of the recombinant VP gene will be fused with a His-tag when expressed, which allows the target protein to be specifically captured and purified by Ni-NTA nickel column affinity chromatography.

[0048] 1.6 Transformation of Escherichia coli Place *E. coli* DH5α competent cells on ice until completely thawed. Add 5-10 μL of recombinant plasmids to the cells, specifically pET-28a(+)-VP1, pET-28a(+)-VP2, and pET-28a(+)-VP3, respectively. Incubate the mixture on ice for 30 minutes. Immediately afterward, perform heat shock at 42°C for 45-90 seconds, then quickly transfer to ice and incubate for another 2-3 minutes. Next, add 500 μL of antibiotic-free LB broth, mix gently, and incubate at 37°C and 200 rpm for 1 hour to allow the bacteria to recover and express the resistance gene.

[0049] After incubation, centrifuge at 5000 rpm for 10 minutes. After centrifugation, carefully remove most of the supernatant and resuspend the precipitate in the remaining liquid. Spread 200 μL of the revived bacterial culture evenly onto LB agar plates containing 50 μg / mL kanamycin, with each recombinant plasmid spread on 2-3 plates.

[0050] Place the plates upside down in a 37°C incubator and incubate for 12-16 hours until clear single colonies appear on the plates.

[0051] 1.7 Bacterial PCR Several single colonies were picked and inoculated into LB liquid medium (3-5 mL) containing 50 μg / mL kanamycin. The inoculated tubes were then placed in a shaker at 37°C and 200 rpm for incubation until the bacteria reached the late logarithmic growth phase, at which point the bacterial culture became noticeably turbid. The cultured bacterial culture was then used as a template for PCR using universal primers compatible with the pET-28a(+) vector (forward primer: T7 Promoter (TAATACGACTCACTATAGGG, SEQ ID NO.14), reverse primer: T7 Terminator (GCTAGTTATTGCTCAGCGG, SEQ ID NO.15)).

[0052] The PCR reaction system (50 μL) is prepared as follows: 25 μL of 2×PCR premix (Master Mix), 2 μL of forward primer T7 Promoter (10 μM), 2 μL of reverse primer T7 Terminator (10 μM), 1-2 μL of cultured bacterial template, and nuclease-free water (ddH2O) to make up to 50 μL.

[0053] The PCR amplification program was set as follows: pre-denaturation at 95℃ for 3 minutes; followed by 35 cycles (denaturation at 95℃ for 15 seconds, annealing at 60℃ for 15 seconds, extension at 72℃ for 2 minutes); and finally, complete extension at 72℃ for 5 minutes, followed by storage at 4℃.

[0054] 1.8. Shaking Using a sterile inoculation loop or pipette tip, select 2-3 single colonies and inoculate them into 2 mL of LB liquid medium containing 50 μg / mL kanamycin.

[0055] Place the inoculated culture tubes in a constant temperature shaker and culture them at 37°C and 200 rpm for 6-8 hours to allow the bacteria to grow to a suitable density (generally in the logarithmic growth phase).

[0056] After the culture is completed, take 1 mL of bacterial culture and mix it thoroughly with 1 mL of 50% glycerol in a sterile centrifuge tube. After labeling, place it in an ultra-low temperature freezer at -80℃ for long-term preservation of the bacterial strain.

[0057] The remaining bacterial culture was transferred to sterile centrifuge tubes for sequencing analysis to determine the accuracy of the target gene sequence in the recombinant plasmid.

[0058] 2. Protein expression experimental procedures: 2.1 Transformation and Expression Host Bacteria and Shaking Bacteria The correctly sequenced recombinant plasmids pET-28a(+)-VP1, pET-28a(+)-VP2, and pET-28a(+)-VP3 were transformed into *E. coli* expression host cells (BL21(DE3) competent cells). The cells were plated on LB agar plates containing 50 μg / mL kanamycin and incubated overnight. Successfully grown single colonies were picked and inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C with shaking at 200 rpm for 10 h (100 μL bacterial culture + 10 mL LB medium containing 50 μg / mL kanamycin). The three bacterial cultures containing recombinant plasmids pET-28a(+)-VP1, pET-28a(+)-VP2, and pET-28a(+)-VP3 were then subjected to the following steps to obtain VP1, VP2, and VP3 protein solutions.

[0059] 2.2. Inoculate the bacterial culture into 1L of LB medium containing 50μg / mL kanamycin (inoculate at a volume ratio of 1:100, with the medium volume not exceeding 1 / 3), and incubate at 37℃ with shaking at 200rpm for 6-10h (OD). 600 The value reaches 0.4-0.8).

[0060] 2.3. Transfer the bacterial culture to a constant temperature shaker at 25℃ and 200rpm and incubate for 20 minutes (to prevent protein expression from being too rapid and causing misfolding). Add an appropriate amount of IPTG (final IPTG concentration 0.5mM) to induce the expression of the target gene. The induction conditions are 16-25℃ for 10-18 hours or 37℃ for 3-4 hours.

[0061] 2.4 After induction, collect the bacterial culture separately, centrifuge at 4℃ and 6000rpm for 10-20 minutes, discard the supernatant, and collect the bacterial precipitate separately.

[0062] 2.5 Add 30-50 mL of lysis buffer (low concentration imidazole 20 mM (PBS) buffer) to the bacterial cell pellet to resuspend the cells, and then perform ultrasonic or high pressure disruption to lyse the cells, release the expressed protein, and obtain soluble protein.

[0063] 2.6 Centrifuge the lysate separately at 10,000-12,000 rpm and 4°C for 1 hour, and collect the supernatant and precipitate. The supernatant contains soluble expressed proteins, and the precipitate contains proteins in the form of inclusion bodies, i.e., inclusion body proteins.

[0064] 3. Protein purification experimental steps: 3.1 Nickel column equilibration: The nickel column (Ni-NTA resin) was equilibrated using binding buffer (1×PBS, 500mM NaCl, 20mM Imidazole, pH 7.4) (containing 20mM Imidazole) at a volume of 5 column volumes (5 mL each, for a total of 25 mL). The flow rate of the chromatography system was set to 5 mL / min.

[0065] 3.2 Sample loading: (1) Soluble protein: Take the supernatant containing the target VP protein out of the refrigerator and place it on ice to thaw. After thawing, centrifuge the sample at 4℃ and 12000rpm for 15-20 minutes to collect the supernatant and remove any possible cell debris and insoluble impurities. (2) Inclusion body protein: Resuspend the precipitate in buffer containing 8M urea and dissolve it completely. Centrifuge at 4℃ and 12000rpm for 15-20 minutes to collect the dissolved supernatant. (3) Slowly add the above supernatant to the nickel column (be careful not to generate bubbles). At this time, the flow rate of the chromatography system is set to 3.5mL / min.

[0066] 3.3 Washing away non-specifically bound proteins: After sample loading, replace the elution buffer with a higher concentration of imidazole (e.g., 20mM or 50mM Imidazole; in this example, it is 1×PBS, 500mM NaCl, 50mM Imidazole, pH 7.4) to wash away non-specifically bound proteins, maintaining a flow rate of 3.5 mL / min. When washing the nickel column with a higher concentration of elution buffer, generally wash 3-5 column volumes (15-25 mL) to thoroughly remove non-specifically bound proteins. Note: For inclusion body proteins, an additional 8M urea should be added to the above buffer to maintain the protein's solubility.

[0067] 3.4 Elution of the target protein: Replace the buffer in the chromatography system with a high-concentration elution buffer (usually 250mM-500mM ilmidazole; in this example, it is 1×PBS, 500mM NaCl, 250mM-500mM ilmidazole, pH 7.4). Maintain a flow rate of 3.5 mL / min to elute the target VP protein and collect the eluent. Note: For inclusion body proteins, the above elution buffer should maintain 8M urea.

[0068] 3.5 Removal of high-concentration salt components: High-concentration salt components are removed by dialysis or desalting column. In this embodiment, dialysis is used to replace the protein in the final storage buffer (such as PBS or Tris-HCl; in this embodiment, 1×PBS is used as the final storage buffer).

[0069] Method 1: Dialysis Prepare dialysis bags: Select dialysis bags with a suitable molecular weight cutoff (generally, select dialysis bags with a molecular weight cutoff 3-5 times smaller than the target protein molecular weight; in this example, the molecular weight of the dialysis bag is 30 kDa). Boil the dialysis bags in distilled water for 10-15 minutes, and then rinse them clean with distilled water.

[0070] Sample loading: Carefully load the collected eluent containing the target VP protein into the dialysis bag, being careful not to overfill it and leaving some space. Clamp both ends of the dialysis bag tightly to ensure there is no leakage.

[0071] Dialysis: Place the dialysis bag containing the protein sample into a large amount (at least 100 times the volume, in this example the final storage buffer volume is 500-1000 mL) of final storage buffer and dialyze overnight at 4°C (generally dialysis for 12-16 hours). The dialysis buffer can be changed 2-3 times during this period to fully remove high concentrations of salt components.

[0072] Method 2: Using a desalination column Equilibrate the desalting column: Equilibrate the desalting column with the final storage buffer at a volume of 3-5 column volumes and a flow rate of 3.5-5 mL / min.

[0073] Desalting by loading: Slowly load the collected eluent containing the target VP protein onto the desalting column at a flow rate of 3.5 mL / min. After loading, elute the desalting column with the final storage buffer and collect the eluent, which is the target protein solution with high salt concentration removed.

[0074] After obtaining the target protein solution with high concentrations of salt removed using Method 1 or Method 2, the protein concentration is determined. In this example, the protein concentration is determined using a BCA kit.

[0075] Protein preservation: Add 30% glycerol to the protein solution (to prevent protein aggregation, DTT (dithiothreitol, generally with a final concentration of 1-5 mM) can be added), and store in aliquots at -20℃.

[0076] 3.6 Protein Refolding (for Inclusion Body Proteins Only): For VP proteins eluted under denaturing conditions, gradient dialysis or on-column refolding is required to gradually remove the denaturing agent (such as urea) from the eluent, allowing the protein to refold. This example uses gradient dialysis. The VP protein eluted under denaturing conditions (containing 8M urea) is placed in a dialysis bag with a molecular weight cutoff of 30kDa and subjected to gradient dialysis refolding at 4°C. The refolding buffer system consists of 20mM Tris-HCl, 150mM NaCl, pH 8.0, with 10% (v / v) glycerol and 1-5mM L-arginine added as folding promoters. Slow protein refolding is achieved by sequentially dialysis in a series of gradient refolding buffers containing 6M, 4M, 2M, 1M, and 0.5M urea for 6-8 hours each, followed by dialysis overnight in a urea-free refolding buffer with the buffer changed once. In this embodiment, the purification route (soluble or inclusion body) for the VP protein can be flexibly selected according to the actual expression situation.

[0077] If high protein purity is required, molecular sieve chromatography (SEC) can be used to purify the protein. The specific steps are as follows: Column chromatography: Prepare 1×SEC buffer (1×PBS, 20mM Tris-HCl, 150mM NaCl, pH 7.4), filter through a 0.22μm filter membrane, degas under vacuum, and pre-cool at 4℃. Centrifuge 1-5mg / mL protein samples at 4℃, 10000g for 10 minutes, filter through a 0.22μm filter membrane, and place on ice. Load onto the column within 2 hours to avoid depolymerization. Backwash the Superdex 200 Increase 10 / 300 GL column with 1×SEC buffer at a flow rate of 0.5mL / min for 1 column volume (CV) to remove ethanol preservative. Equilibrate the column with 2 column volumes of 1×SEC buffer at a flow rate of 0.75mL / min until the UV baseline is stable and the conductivity is constant. Load the protein solution into the loading loop and record the first absorption peak elution volume (Vo), i.e., empty column volume ≈ 8.5mL. The earliest absorption peaks eluted near this volume are mainly large molecular complexes with abnormal aggregation or misassembled particulate impurities and should be discarded.

[0078] The extracted target proteins VP1, VP2, and VP3 are all in monomeric form (theoretical molecular weights of approximately 82 kDa, 67 kDa, and 60 kDa, respectively). Based on the size exclusion characteristics of the column, these monomeric proteins will enter the gel pores and be subject to size exclusion, resulting in a clear and symmetrical main absorption peak within an elution volume range of 13.5 mL to 15.5 mL. During elution, the collector was set to automatically collect at a volume of 0.5 mL per tube, precisely collecting all components within this elution range that cover the UV 280 nm main peak.

[0079] 5. Three cholesterol-modified proteins were obtained using column chromatography and chemical modification methods. 5.1 Pretreatment: Buffer replacement (desalting) Equilibrate a 5 mL HiTrap Desalting column with RB buffer (20 mM HEPES, 150 mM NaCl, 1 mM EDTA, pH 7.2) to a volume three times the column volume to remove residual impurities and buffer (use pre-chilled RB buffer at 4°C, ensuring it is free of Tris, glycine (Gly), and reducing agents to avoid interference with subsequent reactions). Load 1 mL of VP protein onto the HiTrap Desalting column and elute at a flow rate of 3 mL / min. Collect the eluent at 1 mL / tube and combine the 280 nm main peak (1-1.5 mL). The entire procedure should be completed within 30 minutes to prevent the re-oxidation of free cysteine ​​(Cys) and maintain its reduced state.

[0080] 5.2 Cysteine ​​activation (reduction) Immediately add 0.5M dithiothreitol (DTT) stock solution to the desalted VP1, VP2, and VP3 proteins at a concentration of 1 mg / mL, respectively, to achieve a final DTT concentration of 5 mM. Incubate at 25°C for 15 minutes, gently inverting the container 1-2 times to ensure thorough mixing of DTT with the VP proteins. Subsequently, perform a second desalting process on the same 5 mL HiTrap Desalting column (pre-equilibrate with 3 column volumes of RB buffer, load ≤1.5 mL, collect 1 mL of the 280 nm main peak). The entire process, from DTT addition to collection, should be completed within 25 minutes to ensure that the thiol groups remain in a reduced state and that DTT is rapidly removed, yielding VP1, VP2, and VP3 protein solutions obtained through cysteine ​​activation treatment.

[0081] Note: After cysteine ​​activation, thiol group quantification can also be performed (thiol group quantification was performed in this example). The specific steps are as follows: 10 µL of desalted VP protein was mixed with 190 µL of DTNB (0.1 mg / mL, pH 8.0, phosphate-EDTA buffer) and reacted at 25 °C for 5 minutes to allow DTNB to react with thiol groups to form yellow 5-mercapto-2-nitrobenzoic acid (TNB: this substance has maximum absorption at 412 nm). A was then measured. 412nmMeasure the absorbance and calculate the thiol content of the reagent by comparing it with the cysteine ​​standard curve; the measured thiol content should be ≥ 80% of the theoretical value of 47.6 nmol (VP1), 80% of 59.6 nmol (VP2), and 80% of 66.8 nmol (VP3). If < 60%, immediately return to the "cysteine ​​activation (reduction)" step and increase the DTT concentration to 10 mM or extend the reduction time to 30 minutes.

[0082] 5.3 Site-directed coupling reaction Accurately measure the VP1, VP2, and VP3 protein solutions (all 1 mg / mL, 1 mL each) obtained from cysteine ​​activation treatment and place them in separate reaction vessels. Prepare a 50 mM cholesterol-PEG-Maleimide (molecular weight approximately 2500, DMSO stock solution; this reagent contains maleimide groups, which can specifically react with reduced cysteine ​​thiol groups to achieve site-directed coupling).

[0083] Following a 1:8 molar ratio of thiol groups in the protein to maleimide reagent, and with continuous stirring at 300 rpm in an ice bath, the corresponding volumes of coupling reagent were slowly added dropwise along the container wall to the three protein solutions. The specific addition system is as follows: VP1 coupling system: Add 7.6 µL of coupling reagent to 1 mL of VP1 protein solution; VP2 coupling system: Add 9.5 µL of coupling reagent to 1 mL of VP2 protein solution; VP3 coupling system: Add 10.7 µL of coupling reagent to 1 mL of VP3 protein solution; The molar ratio of maleimide groups in the cholesterol-polyethylene glycol-maleimide solution to thiol groups in the protein solution obtained by cysteine ​​activation treatment is 8:1.

[0084] After the addition was complete (the final concentration of DMSO in the system did not exceed 1%), the three independent reaction systems were placed in a light-protected environment at 4°C for 2 hours, gently shaken every 30 minutes to ensure complete reaction. After 2 hours of reaction, 20 µL of a 50 mM L-cysteine ​​solution (final concentration approximately 1 mM, ensuring an excess of cysteine) was added to each reaction system. The reaction was then quenched at 4°C for 15 minutes to immediately terminate the coupling, yielding the reaction solutions of the three proteins. The added L-Cysteine ​​rapidly binds to all unreacted free maleimide groups, effectively preventing non-specific cross-linking during subsequent purification and ensuring the purity and specificity of the product.

[0085] 5.4 Product Purification First, the reaction solution was concentrated using an ultrafiltration tube with a molecular weight cutoff of 10 kDa at 4°C and 3000 g until the volume was reduced to no more than 0.3 mL. Next, the concentrated reaction solution was loaded onto a Superdex 200 Increase 10 / 300 GL column (a size exclusion column, whose separation principle is based on molecular size; in this column, VP-Cholesterol conjugates, as large molecules, are preferentially eluted, while small molecules of free cholesterol (even if hydrophobic) and quenchers are retained by the column and separated in subsequent elutions due to their smaller molecular weight) at a flow rate of 0.5 mL / min. The eluent was collected in 0.5 mL tubes, and the eluent with the main peak at 280 nm (estimated volume approximately 11-13 mL) was combined. Subsequently, using an ultrafiltration tube with a molecular weight cutoff of 10 kDa, the combined eluent was changed again at 4°C and 4000g (the ultrafiltration tube volume was 5 mL; after ultrafiltration, 200 μL remained, and buffer was added to the ultrafiltration tube to bring it to 5 mL, and ultrafiltration was performed again, and so on), for a total of 3 changes. Each time the medium was changed, RB buffer (containing 10% (v / v) glycerol) was added to the ultrafiltration tube, and finally the final protein concentration was adjusted to 0.5-1 mg / mL to obtain the purified VP-Chol conjugate (VP-Chol), i.e., the cholesterol-modified protein solution.

[0086] 6. Verification and Storage SDS-PAGE verification: Take 2µg of sample and mix it with 5×SDS (sodium dodecyl sulfate-polyacrylamide gel electrophoresis loading buffer). Boil the sample at 100℃ for 5 minutes to denature the protein before loading it for electrophoresis. If the electrophoretic band of the VP-Chol protein shifts upward by approximately 3-10 kDa compared to the original VP protein (VP protein obtained in step 3.5, before coupling), the coupling is considered successful (a slight tailing is acceptable). Figure 2 If a dimer band of approximately 90 kDa appears in the A sample, it indicates an oxidation reaction during coupling. In this case, 1 mM of tris(2-carboxyethyl)phosphine (TCEP) should be added to a fresh loading buffer, and then electrophoresis analysis should be performed again. Simultaneously, the total cholesterol content was investigated, and it was found that the total cholesterol content in the cholesterol-modified protein solution obtained after coupling was significantly increased compared to before coupling. Figure 2 (B in the middle).

[0087] Storage: After purification, VP-Chol is replenished with a final concentration of 20% (v / v) glycerol, sterilized by passing through a 0.22µm Millex-GV filter membrane with low protein adsorption, dispensed in 50µL / tube, flash-frozen in liquid nitrogen for 1 minute, and then transferred to -80℃. Only one tube is used for each experiment. It is thawed slowly at 4℃. Water bath at 37℃ is strictly prohibited to prevent loss of activity and aggregation caused by repeated freeze-thaw cycles.

[0088] Example 2: Preparation of engineered nanovesicles 1. Extraction and pretreatment of red blood cell membranes Dissolve 100 μL of red blood cells (RBCs) in 4 mL of 0.25×PBS and swell at 4°C for 2 hours to rupture the RBCs. Centrifuge at 12000g for 20 minutes and collect the precipitate. Wash twice with 0.25×PBS, and then gently pipette the precipitate with 12 mL of 1×PBS to obtain the red blood cell membrane (RBCM).

[0089] The obtained RBCMs were subjected to permeabilization using a 400 nm nanoporous membrane to obtain uniform erythrocyte membrane vesicles. Each sample was extruded 13 times to ensure uniform particle size distribution and structural integrity.

[0090] 2. Preparation of a mixture of nanovesicles embedded with cholesterol-modified proteins The obtained cholesterol-modified protein with a concentration of 1 mg / mL was mixed with erythrocyte membrane with a protein concentration of 4 mg / mL at a volume ratio of 9:1 and incubated at 37°C for 30-60 minutes to promote the fusion of the modified protein with the erythrocyte membrane. The molar ratio, molecular weight, and concentration of VP1-cholesterol, VP2-cholesterol, and VP3-cholesterol in the cholesterol-modified protein are shown in Table 2.

[0091] Table 2. Molar ratio, molecular weight, and concentration of the three proteins in cholesterol-modified proteins. After incubation, the mixture was passed through polycarbonate membranes with pore sizes of 400 nm and 200 nm for extrusion. Each milliliter of sample was extruded 13 times on each type of membrane to finally obtain a mixture of nanovesicles embedded with cholesterol-modified proteins, cholesterol-modified proteins and red blood cell membranes.

[0092] Subsequently, density gradient centrifugation was used to obtain nanovesicles embedded with cholesterol-modified proteins, forming a nanovesicle formulation with a certain concentration.

[0093] Step 1: Add 1 mL of 40% (v / v) iodixanol solution and 3 mL of 25% (v / v) iodixanol solution sequentially to a centrifuge tube (add the samples gently along the tube wall to create stratification at different densities). Add 7 mL of the squeezed mixture to the top layer and balance with 1×PBS. Centrifuge at 150,000 g for 3 hours, with the ramp rate set to max and the drop rate set to 9, at 4°C. After centrifugation, aliquot the sample from each centrifuge tube into 1.5 mL EP tubes, 1 mL per tube (numbered, e.g., Fr1-Fr11), carefully aspirating from the top layer to avoid mixing the solution. Collect fractions Fr7 and Fr8.

[0094] Step 2: In a biosafety cabinet, dilute the Fr7 and Fr8 fractions (2 mL total) to 11 mL with 1×PBS and perform a second ultracentrifugation: centrifuge at 150,000 g, 4 °C for 3 h, with the acceleration and deceleration rates set to max. After centrifugation, a precipitate will be observed at the bottom of the centrifuge tube (i.e., density gradient centrifugation yields nanovesicles embedded with cholesterol-modified proteins, forming a nanovesicle formulation with a certain concentration). Remove and discard the supernatant in the biosafety cabinet, and resuspend the bottom precipitate with 50-100 μL of 1×PBS. This is the engineered nanovesicle-cholesterol-VP sample, which should be stored at -80 °C.

[0095] The above-mentioned formulation can be used for in vivo infusion. The engineered nanovesicles can bind to a large number of free AAV neutralizing antibodies in the plasma through cholesterol-coupled VP protein on their surface, thereby reducing the number of neutralizing antibodies in the plasma.

[0096] Example 3 Characterization of the engineered nanovesicles prepared in Example 2 10 μL of the engineered nanovesicles prepared in Example 2 was added to the surface of a 200-mesh carbon-supported copper mesh and allowed to stand for 10 minutes to allow for full adsorption. Excess liquid was then gently absorbed from the side with filter paper. The mesh was washed twice with ddH2O for 30 seconds each time, and excess liquid was gently absorbed with filter paper. A drop of 2.5% glutaraldehyde was added to the membrane and allowed to stand for 10 minutes for fixation. Excess liquid was quickly absorbed, and the mesh was washed twice with ddH2O. 10 μL of 2% phosphotungstic acid (or uranium acetate) aqueous solution was added for negative staining for 1-2 minutes. After absorbing excess staining solution and allowing the mesh to air dry at room temperature, the copper mesh was placed under a transmission electron microscope (TEM) to observe its microstructure and photograph the results. Figure 3 As shown in the figure. The results show that the engineered nanovesicles prepared in Example 2 exhibit a typical "coffee saucer" shape under transmission electron microscopy, with their particle size mainly concentrated in the range of 100-150 nm. This indicates that the engineered nanovesicles were successfully prepared.

[0097] Example 4 In vitro safety experiment In in vitro cell experiments, MTT assays verified the effect of the engineered nanovesicles prepared in Example 2 on cell viability at three concentrations: high, medium, and low.

[0098] HEK-293T cells (human embryonic kidney cells 293) were seeded into 96-well plates, with 10,000 cells per well and a volume of 100 μL. The cells were incubated overnight at 37°C in a 5% CO2 incubator. After complete cell attachment, the old culture medium was discarded, and cultured for 24 hours and 48 hours in medium containing engineered nanovesicles at concentrations of 30 μg / mL, 3 μg / mL, and 0.3 μg / mL, respectively. These concentrations were designated as engineered nanovesicle group (30 μg / mL), engineered nanovesicle group (3 μg / mL), and engineered nanovesicle group (0.3 μg / mL). A blank control group and a control group were also set up simultaneously; the blank control group contained only culture medium, and the control group contained only cells.

[0099] After the culture time is reached, add 10 μL of 5 mg / mL MTT solution to each well and continue culturing for 2-4 hours. Then, remove the solution from the wells, add 150 μL of DMSO, and shake in the dark for 10 minutes. Detect the OD value using a microplate reader at 570 nm. Results are as follows: Figure 4 As shown in A in the figure. The results show that the engineered nanovesicles prepared in this invention do not affect the survival rate of HEK-293T cells, which is comparable to that of the control group, indicating that the engineered nanovesicles provided by this invention have extremely high safety at the cellular level.

[0100] Example 5: In vivo safety experiment Healthy C57BL / 6J wild-type mice, aged 6-8 weeks and weighing approximately 20g, were randomly divided into a control group, an engineered nanovesicle group (0.025 mg / kg), an engineered nanovesicle group (0.25 mg / kg), and an engineered nanovesicle group (2.5 mg / kg). Each group contained 6 mice. The engineered nanovesicle groups (0.025 mg / kg, 0.25 mg / kg, and 2.5 mg / kg) were administered the engineered nanovesicles prepared in Example 2 via tail vein injection, with specific dosages detailed in Table 3.

[0101] Table 3 Doses for different treatments The experiment lasted for 14 days. Starting from day 0 (the day of injection was recorded as day 0), all mice were weighed and their weight was recorded every other day to plot the weight gain curve and assess the effects of the sample on the mice's overall metabolism and growth and development.

[0102] Meanwhile, the acute reaction period is 48 hours after injection. The focus is on observing whether the mice exhibit lethargy, curling up, rough fur, rapid breathing, or a significant decrease in food and water intake, in order to rule out possible acute allergic reactions or endotoxin contamination of the samples.

[0103] After the experiment, the mice were weighed and euthanized. Whole blood was collected by enucleation, centrifuged at room temperature, and the serum was obtained for testing. The experimental results are as follows: Figure 4 As shown in Figure BF. Results showed that, compared with the control group, the levels of interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) in mice of each experimental group were not significantly increased, indicating that the engineered nanovesicles provided by this invention did not induce a significant inflammatory response. Compared with the control group, there were no significant differences in creatinine (CRE, a renal function indicator) and alanine aminotransferase (ALT, a liver function indicator) among the experimental groups, indicating that the engineered nanovesicles provided by this invention did not cause liver and kidney damage. The weight gain trend of all groups was basically consistent, with no weight loss or growth retardation, further demonstrating the safety of the engineered nanovesicles provided by this invention in vivo.

[0104] Example 6 Antibody Clearance Experiment 1. Cellular antibody clearance experiment To evaluate the ability of engineered nanovesicles to clear antibodies from serum, a cell-based experimental verification-luciferase assay was performed. The specific steps are as follows: C57BL / 6 mice were randomly divided into control and experimental groups. All mice were injected with 100 μL of 5 × 10⁶ mg / L solution via the tail vein. 6 Avg / μL AAV9-CMV-GFP virus (AAV9.EGFP, purchased from Heyuan Biotechnology Co., Ltd., catalog number: Cat: GL3047) was used to induce antibody production. Two weeks later, blood was collected from the submandibular vein. After collection, the centrifuge tubes were placed at room temperature (20-25℃) for 30-120 minutes, and then centrifuged at 4000 rpm for 15 minutes at 4℃. The upper pale yellow serum layer was then collected. These were designated as control group 1 and experimental group 1 serum samples, respectively.

[0105] After blood collection, experimental mice were injected via tail vein with engineered nanovesicles prepared in Example 2 at a concentration of 2.5 mg / kg, while control mice were injected via tail vein with an equal volume of PBS. Three days after injection of either PBS or engineered nanovesicles, a second blood sample was collected and recorded as serum samples from the control group 2 and experimental group 2, respectively, for subsequent antibody clearance assays.

[0106] Serum samples from control group 1, experimental group 1, control group 2, and experimental group 2 were respectively mixed with 10 μL and 1×10⁻⁶ ml of water. 8Av9.LUC viral vector (purchased from Heyuan Biotechnology, cat#H15584) was incubated at 37℃ for 60 minutes to obtain a mixture of four substances. The serum samples from control group 1 (before treatment) and control group 2 (after treatment) were both designated as control groups; the serum samples from experimental group 1 (before treatment) and experimental group 2 (after treatment) were both designated as engineered nanovesicle groups.

[0107] 20 μL of the incubated virus mixture was added to pre-seeded, well-grown cells (10,000 cells per well). After 48 hours, the intracellular luciferase (RLU) expression level was detected using a multi-functional microplate reader. The results are as follows: Figure 5 As shown in the figure. The results showed that the luciferase expression levels of cells treated with serum samples from control group 1, experimental group 1, and control group 2 were all close to 0, indicating that the pre-generated AAV neutralizing antibody significantly inhibited the transduction and luciferase expression of the subsequently injected AAV9.LUC virus, meaning that a large number of neutralizing antibodies were present in these three serum samples. In contrast, the luciferase expression level of cells treated with serum samples from experimental group 2 was as high as 460, indicating that the injected engineered nanovesicles could effectively adsorb and neutralize free neutralizing antibodies.

[0108] 2. Animal antibody clearance experiment To evaluate the antibody clearance capacity of engineered nanovesicles in animals, a mouse experiment combined with in vivo luciferase assay was used for verification. The specific steps are as follows: C57BL / 6 mice were randomly divided into a control group and an engineered nanovesicle group (n=3 mice in each group). All mice were injected intravenously with 100 μL of a nanovesicle containing 5 × 10⁻⁶ N·m³. 6 Two weeks after the initial injection, mice were injected intravenously with 2.5 mg / kg of the engineered nanovesicles prepared in Example 2, while control mice were injected intravenously with an equal volume of PBS. Three days later, all mice were injected intravenously with 100 μL of a 1×10⁻⁶ PBS solution. 8 vg / μL AAV9.LUC virus, IVIS in vivo imaging was performed two weeks after virus injection, the specific procedure is as follows: 1) Prepare D-Luciferin potassium salt and prepare a working solution of 15 mg / mL. 2) Mice were intraperitoneally injected with D-fluorescein potassium salt substrate at a dose of 150 mg / kg. 3) After injecting the substrate, the mice were placed in an isoflurane anesthesia chamber for gas anesthesia.

[0109] 4) Five minutes after injecting the substrate, transfer the anesthetized mice to the dark chamber of an in vivo imaging system (such as IVIS Spectrum). Set appropriate exposure time and binding value to complete image acquisition, and count the expression level of luciferase (RLU). The results are as follows: Figure 6 As shown.

[0110] The results showed that the control group mice exhibited only weak fluorescence signals throughout their bodies, indicating that the pre-induced AAV neutralizing antibodies significantly inhibited the transduction and luciferase expression of the subsequently injected AAV9.LUC virus. In contrast, mice treated with engineered nanovesicles showed strong fluorescence signals in the liver, demonstrating that the engineered nanovesicles effectively cleared the neutralizing antibodies in vivo, relieving their inhibitory effect on AAV9.LUC virus and allowing for efficient luciferase expression. Furthermore, the luciferase expression level in the engineered nanovesicle group was significantly higher than that in the control group (P<0.01), further quantitatively confirming that engineered nanovesicles can efficiently clear AAV neutralizing antibodies in vivo and restore the transduction capacity of AAV virus.

[0111] The results clearly demonstrate that the engineered nanovesicles provided by this invention can effectively break through the existing AAV neutralizing antibody barrier in vivo, providing a key solution for improving the efficiency of AAV-based gene therapy.

[0112] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. An engineered nanovesicle, characterized in that, The engineered nanovesicles include red blood cell membranes loaded with three cholesterol-modifying proteins; The method for constructing the cholesterol-modified protein includes the following steps: Recombinant vectors containing the VP1, VP2, and VP3 protein-coding genes were constructed, and the vectors were expressed and purified to obtain three recombinant proteins. The nucleotide sequence of the VP1 protein-coding gene is shown in SEQ ID NO.1; the nucleotide sequence of the VP2 protein-coding gene is shown in SEQ ID NO.2; and the nucleotide sequence of the VP3 protein-coding gene is shown in SEQ ID NO.

3. The three recombinant proteins were subjected to desalting, cysteine ​​activation, coupling, and purification processes in sequence to obtain the three cholesterol-modified proteins.

2. The engineered nanovesicles according to claim 1, characterized in that, The desalting process includes the step of treating the recombinant protein using a chromatographic column; The chromatographic column is a gel filtration chromatography desalting column.

3. The engineered nanovesicles according to claim 1, characterized in that, The cysteine ​​activation treatment includes the steps of mixing the desalted VP protein obtained from the desalting treatment with a dithiothreitol solution, allowing it to stand, and then desalting it again.

4. The engineered nanovesicles according to claim 3, characterized in that, In the mixture obtained by mixing, the final concentration of dithiothreitol is 5 mM, and the final concentration of desalted VP protein is 1 mg / mL. The settling temperature is 25°C, and the settling time is 15 minutes; The chromatographic column used for the secondary desalting is a gel filtration chromatography desalting column.

5. The engineered nanovesicles according to claim 1, characterized in that, The coupling treatment includes the steps of mixing a cholesterol-polyethylene glycol-maleimide solution and a protein solution obtained from the cysteine ​​activation treatment, performing a light-protected reaction, and then adding an L-cysteine ​​solution to perform a quenching reaction.

6. The engineered nanovesicles according to claim 5, characterized in that, The concentration of cholesterol-polyethylene glycol-maleimide in the cholesterol-polyethylene glycol-maleimide solution is 50 mM; the concentration of protein in the protein solution is 1 mg / mL; the molar ratio of maleimide groups in the cholesterol-polyethylene glycol-maleimide solution to thiol groups in the protein solution obtained by cysteine ​​activation treatment is 8:

1. The light-protected reaction takes 2 hours and is carried out at a temperature of 4°C. The concentration of L-cysteine ​​in the L-cysteine ​​solution was 50 mM. The quenching reaction takes 15 minutes and is carried out at a temperature of 4°C.

7. A method for preparing the engineered nanovesicles according to any one of claims 1-6, characterized in that, The preparation method includes the steps of mixing and incubating a red blood cell membrane solution and a cholesterol-modified protein solution, followed by extrusion and density gradient centrifugation to obtain the engineered nanovesicles.

8. The preparation method according to claim 7, characterized in that, The protein concentration in the erythrocyte membrane solution is 2-4 mg / mL; the protein concentration in the cholesterol-modified protein solution is 0.5-1 mg / mL; the volume ratio of the cholesterol-modified protein to the erythrocyte membrane is 9:1; the cholesterol-modified protein includes cholesterol-modified VP1 protein, cholesterol-modified VP2 protein, and cholesterol-modified VP3 protein; the molar ratio of the cholesterol-modified VP1 protein, the cholesterol-modified VP2 protein, and the cholesterol-modified VP3 protein is 1:1:

10. The incubation time is 30-60 minutes, and the temperature is 37°C. The density gradient centrifugation includes the steps of sequentially adding a 40% volume percentage solution of iodixanol and a 25% volume percentage solution of iodixanol.

9. The use of the engineered nanovesicles according to any one of claims 1-6 in the preparation of a scavenging neutralizing antibody drug.

10. A drug for eliminating neutralizing antibodies, characterized in that, The drug comprises the engineered nanovesicles according to any one of claims 1-6.

Images