Use of a benzamide compound in muscular dystrophy

Abstract

The present application relates to a kind of benzamide compounds in the application of muscular dystrophy, especially Duchenne muscular dystrophy (DMD). The benzamide compound described in the present application has unexpected effect advantage in up-regulating Utrophin A gene expression, improving muscle strength degradation, increasing collagen deposition, increasing fibrosis, improving muscle inflammation and other degenerative changes, and increasing fat ratio compared with other compounds of the same target, has excellent effect for treating Duchenne muscular dystrophy (DMD), and good safety.

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical chemistry, and specifically relates to the application of a benzamide compound in muscular dystrophy, particularly Duchenne muscular dystrophy. Background Technology

[0002] Muscular dystrophy (MD), also known as muscular atrophy, is a group of inherited diseases that primarily affect skeletal muscles, causing chronic, progressive weakness and atrophy of these muscles. Approximately 30 gene mutations cause various forms of MD, differing in age of onset, severity, and the muscle groups affected. MD is characterized by progressive skeletal muscle atrophy, loss of muscle protein, and death of muscle cells or tissues. Signs and symptoms of MD include progressive muscle atrophy, poor balance, scoliosis (curved spine and back), progressive weakness in walking, unsteady gait, lower leg deformities, limited range of motion, difficulty breathing, cardiomyopathy, muscle spasms, and the Gowers sign.

[0003] The most common type of muscular dystrophy is Duchenne muscular dystrophy (DMD), an X-linked recessive genetic disorder caused by a mutation in the dystrophin gene on the X chromosome. It primarily affects males, with females often being carriers. The incidence of DMD in live male infants is approximately 1 in 3500. In DMD patients, muscle cells lack the support of dystrophin, leading to muscle membrane collapse, leakage of creatine kinase (CK) from damaged cells, and calcium ions entering the cells, ultimately causing cell death. While muscle regeneration is possible in the short term, the resulting muscle fibers are of uneven size. In the long term, muscle atrophy and the proliferation and infiltration of adipose and connective fibrous tissue lead to muscle weakness.

[0004] Despite extensive research into the molecular mechanisms of muscular dystrophy, a complete cure for the disease remains elusive, and currently available treatments primarily offer supportive care. Attempts to replace or correct mutated genes using gene or cell therapy may yield a final solution for muscular dystrophy; however, this is not easily achieved. Alternative strategies to prevent or delay muscle degeneration, reduce inflammation, or promote muscle metabolism or regeneration may benefit all patients and synergistically enhance gene or cell therapy in the future. Anti-inflammatory steroids are currently the only treatment tool available for most DMD patients; for example, the corticosteroid prednisone has been used to treat DMD for over 50 years. It is not a specific treatment for DMD, but rather extends patient lifespan and carries a wide range of side effects and toxicities, such as immunosuppression, osteoporosis, and weight gain.

[0005] In recent years, the upregulation of utrophin protein has been recognized as one of the most promising alternative therapeutic strategies for treating dystrophinosis. Utrophin is a myotrophin-associated protein and an autosomal homolog of myotrophin. It can also bind to proteins in DAPC and functionally substitute for myotrophin. In MDX mice, increasing the level of utrophin bound to the myofiber membrane and increasing the level of utrophin in myotrophin-deficient myofiber resulted in partial recovery of affected muscle function. Furthermore, due to its endogenous expression, utrophin overexpression does not induce any immune response in patients with dystrophinosis.

[0006] Chidamide is the first subtype-selective histone deacetylase inhibitor (HDACi) independently developed and synthesized by Shenzhen Chipscreen Biosciences Co., Ltd. It is a Class 1.1 new drug and has been approved for multiple indications, including peripheral T-cell lymphoma (PTCL) and breast cancer. Summary of the Invention

[0007] The first aspect of the present invention provides the use of chidamide or a derivative thereof in the preparation of medicaments for the treatment and / or prevention of muscular dystrophy.

[0008] In some preferred embodiments, the derivatives of chidamide are selected from its pharmaceutically acceptable salts, its solvates, its enantiomers, crystal form A, and crystal form B. CN201210489178.8 discloses crystal form A and crystal form B of chidamide, and CN201410136761.X discloses the enantiomers of chidamide, the entire contents of which are incorporated herein by reference.

[0009] In some preferred embodiments, the muscle atrophy is Duchenne muscular dystrophy (DMD).

[0010] In some preferred embodiments, the unit dose of the chidamide or its derivative is 5-30 mg.

[0011] In some more preferred embodiments, the unit dose of the chidamide or its derivative is 5 mg, 10 mg, 15 mg, 20 mg, 25 mg or 30 mg.

[0012] In some preferred embodiments, the patient receiving the drug treatment is a child. More preferably, the child refers to a child aged 6 years or older.

[0013] In some preferred embodiments, the drug is administered orally.

[0014] A second aspect of the present invention provides the use of a pharmaceutical composition comprising chidamide or a derivative thereof and at least one pharmaceutically acceptable excipient in the preparation of a medicament for treating and / or preventing muscular dystrophy.

[0015] In some preferred embodiments, the derivatives of chidamide are selected from its pharmaceutically acceptable salts, its solvates, its enantiomers, crystal form A, and crystal form B. CN201210489178.8 discloses crystal form A and crystal form B of chidamide, and CN201410136761.X discloses the enantiomers of chidamide, the entire contents of which are incorporated herein by reference.

[0016] In some preferred embodiments, the muscle atrophy is Duchenne muscular dystrophy (DMD).

[0017] In some preferred embodiments, the unit dose of chidamide or its derivative in the composition is 5-30 mg.

[0018] In some more preferred embodiments, the unit dose of chidamide or its derivative in the composition is 5 mg, 10 mg, 15 mg, 20 mg, 25 mg or 30 mg.

[0019] In some preferred embodiments, the patient receiving the drug treatment is a child. More preferably, the child refers to a child aged 6 years or older.

[0020] In some preferred embodiments, the drug is administered orally.

[0021] Technical terms of this invention:

[0022] In the following description, certain specific details are set forth to provide a thorough understanding of the various embodiments. However, those skilled in the art will understand that the invention can be practiced without these details. In other instances, well-known structures have not been shown or described in detail to avoid unnecessarily obscuring the description of the embodiments. Unless the context otherwise requires, throughout the specification and claims, the word “comprising” and its variations, such as “including” and “containing,” should be interpreted in an open-ended sense, meaning “including but not limited to.” Furthermore, the headings provided herein are for convenience only and are not intended to define the scope or meaning of the claimed invention.

[0023] Throughout this specification, the phrase "some embodiments" or "in embodiments" means that a particular feature, structure, or characteristic described with respect to that embodiment is included in at least one embodiment. Therefore, the phrases "in some embodiments" or "in embodiments" appearing in different places throughout this specification do not necessarily all refer to the same embodiment. Furthermore, specific features, structures, or characteristics may be combined in any suitable manner in one or more embodiments. Moreover, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural indicators unless the context clearly specifies otherwise. It should also be noted that, unless the context clearly specifies otherwise, the term "or" is generally used to include the meaning of "and / or."

[0024] The term "pharmaceutically acceptable salt" refers to the salt of the compounds of this invention, prepared by reacting a compound having specific substituents discovered in this invention with a relatively non-toxic acid or base. When the compounds of this invention contain relatively acidic functional groups, base addition salts can be obtained by contacting such compounds with a sufficient amount of base in a pure solution or a suitable inert solvent. When the compounds of this invention contain relatively basic functional groups, acid addition salts can be obtained by contacting such compounds with a sufficient amount of acid in a pure solution or a suitable inert solvent.

[0025] The beneficial effects of this invention are:

[0026] Existing technologies have yielded some research on the use of histone deacetylase inhibitors (HDACs) for the treatment of Duchenne muscular dystrophy (DMD). For example, Givinostat has been approved for the treatment of DMD, and Trichostatin A has also been extensively studied and is known to have an ameliorative effect on DMD. However, this invention unexpectedly reveals that due to the numerous subtypes of HDAC inhibitors, not all HDAC inhibitors can be used to treat DMD. Even those that can treat DMD have varying therapeutic effects due to differences in selectivity and / or activity among different subtypes. For instance, Mocetinostat, also an HDAC inhibitor, has no therapeutic activity against DMD. Furthermore, because DMD requires long-term administration, drug safety is of paramount importance. For example, Trichostatin A, which has an ameliorative effect on DMD, as a broad-spectrum HDAC inhibitor, may have systemic effects on proliferating cells, the immune system, the liver, and bone marrow, posing unacceptable risks. Therefore, the efficacy of HDAC inhibitors in treating DMD is entirely unpredictable, and their safety is uncontrollable.

[0027] Specifically, although Trichostatin A, Chidamide, Givinostat, and Mocetinostat all belong to histone deacetylase inhibitors (HDACi), the effects of different compounds on the expression of homologous dystrophin A gene in the mouse myoblast cell line C2C12 vary considerably. Among them, Mocetinostat had almost no promoting effect on Utrophin A gene expression; Trichostatin A and Givinostat had some promoting effect on Utrophin A gene expression; Chidamide had a more prominent upregulation effect on Utrophin A mRNA at all concentrations, and showed a clear concentration-dependent effect. Compared with Givinostat, a drug already on the market for the treatment of Duchenne muscular dystrophy, and Trichostatin A, a drug known to improve Duchenne muscular dystrophy, it had an unexpected advantage in the effect of upregulating Utrophin A gene expression. The upregulation of Utrophin A gene expression is closely related to the improvement and treatment of Duchenne muscular dystrophy, which fully demonstrates that Chidamide has great potential in the treatment of Duchenne muscular dystrophy.

[0028] On the other hand, in the pharmacodynamic experiments of DMD model mice, behavioral tests showed that DMD model mice exhibited typical muscle degeneration characteristics, namely decreased grip strength (p < 0.01). Different administration times and different doses of chidamide improved muscle degeneration to varying degrees, demonstrating statistically significant advantages (p < 0.05 or even p < 0.01). Pathological examination revealed significant staining of Sirius Red, Masson's Tricolor, MPO, and Oil Red O in the diaphragm and tibialis anterior muscles of DMD model mice, and significant staining of Sirius Red, Masson's Tricolor, and MPO in the myocardium. This indicates increased collagen deposition, aggravated fibrosis, and significant muscle inflammation in DMD mice, with degenerative lesions and an increased proportion of fat. Chidamide showed statistically significant advantages in alleviating these lesions (p < 0.05 or even p < 0.01). Furthermore, no abnormalities were found in the mice's response and weight after administration, indicating that chidamide was safe and no adverse reactions occurred. The above fully demonstrates that chidamide is both effective and safe in the treatment of DMD.

[0029] Meanwhile, clinical trials of chidamide for the treatment of DMD have further confirmed that chidamide is both effective and safe for treating DMD patients.

[0030] This invention demonstrates that a benzamide compound, chidamide, has a good effect on upregulating Utrophin A gene expression, exhibiting a significant concentration-dependent effect, and showing unexpected advantages compared to other HDAC inhibitors targeting the same target. Furthermore, it confirms that chidamide has unexpected advantages in improving degenerative diseases such as muscle weakness, increased collagen deposition, aggravated fibrosis, and muscle inflammation, as well as increased fat percentage. Genetic, animal behavioral, and pathological analyses fully demonstrate that chidamide can be considered a potential drug for treating Duchenne muscular dystrophy (DMD), while also possessing good safety. Finally, the efficacy and safety of chidamide in treating DMD have been clinically validated, providing a more effective treatment method for this currently difficult-to-cure disease and achieving unexpected technical results. Attached Figure Description

[0031] Figure 1 This represents the effect of different HDAC inhibitors on the transcriptional expression level of Utrophin A in mouse myoblasts.

[0032] Figure 2 This represents the curve showing the change in the weight of the experimental animals after the start of the experiment.

[0033] Figure 3 A statistical graph representing the grip strength of mice after different treatment times.

[0034] Figure 4 A schematic diagram and statistical chart representing the results of Sirius red (PSR) staining.

[0035] Figure 5 A schematic diagram and statistical chart representing the results of Masson trichrome staining.

[0036] Figure 6 A schematic diagram and statistics representing myeloperoxidase (MPO) staining results.

[0037] Figure 7 A schematic diagram and statistical chart representing the results of Oil Red O (ORO) staining. Detailed Implementation Plan

[0038] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Various other modifications, substitutions, or alterations can be made based on ordinary technical knowledge and common practice in the art, without departing from the basic technical concept of this invention.

[0039] The present invention will be described in detail below with reference to examples, but this does not imply any adverse limitation on the invention. The compounds of the present invention can be prepared by various synthetic methods well known to those skilled in the art, including the specific embodiments listed below, embodiments formed by combining them with other chemical synthetic methods, and equivalent substitutions well known to those skilled in the art. Preferred embodiments include, but are not limited to, the embodiments of the present invention. It will be apparent to those skilled in the art that various changes and modifications can be made to the specific embodiments of the present invention without departing from the spirit and scope of the invention, and these should also be considered within the scope of protection of the present invention.

[0040] Example 1: Effects of different HDAC inhibitors on the transcriptional expression level of Utrophin A in mouse myoblasts

[0041] Material

[0042] Cell line: The mouse myoblast cell line C2C12, derived from the American Type Culture Collection (ATCC), was used. Cells were cultured in high-glucose DMEM medium supplemented with 20% fetal bovine serum (FBS), 100 U / mL penicillin, and 100 μg / mL streptomycin, and maintained for growth in a cell culture incubator at 37°C and 5% CO2.

[0043] Compounds: Trichostatin A, Givinostat, and Mocetinostat were purchased from Selleck, and Chidamide was synthesized by Shenzhen Chipscreen Biosciences Co., Ltd. All the above compounds were prepared into 20 mM stock solutions using DMSO (BBI, catalog number A600163-0250) and stored at -20°C. Before use, they were diluted with culture medium to the required concentration.

[0044] Main reagents: Trizol reagent (catalog number 15596-026) was purchased from Invitrogen; the Transcriptor First Strand cDNA Synthesis Kit (catalog number 04896866001) and the FastStart Universal SYBR Green Master (Rox) (catalog number 4913914001) were both purchased from Roche. Primers were synthesized by Suzhou Genewise Biotechnology Co., Ltd. Primers were designed with the mouse Utrophin A gene as the target gene, referencing its mRNA sequence template NM_011682.4; primers were designed with the mouse GAPDH gene as the internal reference gene, referencing its mRNA sequence template NM_008084.4. The primer sequences are as follows:

[0045] Utrophin A:

[0046] Upstream primer UTRN (M)-F: GACACTAGCACGGACCTCAC

[0047] Downstream primer UTRN (M)-R: AAGGTCGGGAAATGTTGGCT

[0048] GAPDH:

[0049] Upstream primer GAPDH (M)-F: GAAAGCTGTGGCGTGATGGC

[0050] Downstream primer GAPDH (M)-R: TGGGGGTAGGAACACGGAAG

[0051] method

[0052] Cell treatment: C2C12 cells in logarithmic growth phase were digested into a single-cell suspension with 0.25% Trypsin-EDTA (Gibco, REF25200-056) and seeded into 6-well plates at a density of 5 × 10⁶ cells per well. 5 Cells were collected. Once the cells adhered and reached 80%-90% confluence, culture medium containing different concentrations of Trichostatin A, Givinostat, Mocetinostat, and Chidamide was added to each well, bringing the final concentrations of each compound in each well to 0.03 μM, 0.10 μM, and 0.30 μM, respectively. Three replicates were set up for each concentration. A control group containing only the same volume of DMSO was also included. After 48 hours of treatment, the culture medium was discarded.

[0053] RNA extraction and reverse transcription: Add 1 mL of Trizol reagent to each well and extract total RNA from cells according to the instructions. RNA concentration and purity were measured using an IMPLEN NanoPhotometer N50. Select A... 260 / A 280 RNA samples with a ratio between 1.8 and 2.0 were used for subsequent experiments. 3 μg of total RNA was taken and reverse transcribed into cDNA according to the reverse transcription kit instructions.

[0054] qRT-PCR: Primer mix (10 μM) was prepared for both upstream and downstream primers of the corresponding gene. Using cDNA as template, qRT-PCR was performed using a FastStart Universal SYBR Green Master (Rox) instrument. The reaction volume was 20 μL, including 10 μL FastStart Universal SYBR Green Master (Rox), 2 μL Primer Mix (10 μM), 5 μL cDNA template, and 3 μL ddH2O. The reaction was performed on a real-time quantitative PCR instrument (Thermo, ABI QuantStudio 6) under the following conditions: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, and 72℃ extension for 15 s, for a total of 40 cycles. Three technical replicates were set up for each sample. GAPDH was used as an internal control gene, and 2... ⁻ΔΔCt The relative expression level of the mouse Utrophin A gene was calculated using a method. During the calculation, the Ct value of the target gene Utrophin A was corrected using the Ct value of the GAPDH gene to eliminate differences in RNA extraction, reverse transcription, and PCR reaction efficiency among different samples.

[0055] Results: The effects of different concentrations (0.03 μM, 0.10 μM, 0.30 μM) of Trichostatin A, Chidamide, Givinostat, and Mocetinostat) on the expression level of Utrophin A mRNA in the mouse myoblast cell line C2C12 were detected by qRT-PCR. The results are shown in the attached figure. Figure 1 As shown.

[0056] Specifically, in the TrichostatinA treatment group, as the concentration increased from 0.03 μM to 0.10 μM, the UtrophinA mRNA level increased from approximately 1.4 times to approximately 2.0 times that of the control group, showing an upward trend; when the concentration was further increased to 0.30 μM, its mRNA level was approximately 2.3 times that of the control group, and the upregulation rate slowed down.

[0057] In the chidamide treatment group, the level of Utrophin A mRNA was approximately 1.5 times that of the control group at a concentration of 0.03 μM, increased to approximately 2.5 times at a concentration of 0.10 μM, and reached approximately 3.3 times at a concentration of 0.30 μM, showing a relatively obvious concentration-dependent upregulation trend.

[0058] In the Givinostat treatment group, the level of Utrophin A mRNA was relatively low at a concentration of 0.03 μM, approximately 0.8 times that of the control group; when the concentration was increased to 0.10 μM, it increased to approximately 2.1 times; and at a concentration of 0.30 μM, it was approximately 2.7 times, showing that the effect was not obvious at low concentrations, but the promoting effect increased with increasing concentration.

[0059] In the Mocetinostat treatment group, the levels of Utrophin A mRNA at the three concentrations (0.03 μM, 0.10 μM, and 0.30 μM) were approximately 0.7, 0.9, and 1.0 times that of the control group, respectively. Overall, the promoting effect on Utrophin A mRNA expression was weak, and the effect of concentration changes was not significant.

[0060] In summary, although Trichostatin A, Chidamide, Givinostat, and Mocetinostat all belong to the histone deacetylase inhibitor (HDACi) class, their effects on Utrophin A gene expression in the mouse myoblast cell line C2C12 vary considerably. Mocetinostat showed almost no promoting effect on Utrophin A gene expression; Trichostatin A and Givinostat had some promoting effect; Chidamide showed a significant upregulation effect on Utrophin A mRNA at all concentrations, exhibiting a clear concentration-dependent effect. Compared with Givinostat, a drug already marketed for treating Duchenne muscular dystrophy, and Trichostatin A, known to improve Duchenne muscular dystrophy, Chidamide demonstrated an unexpected advantage in upregulating Utrophin A gene expression. Furthermore, the upregulation of Utrophin A gene expression is closely related to the improvement and treatment of Duchenne muscular dystrophy, fully demonstrating the great potential of Chidamide in the treatment of Duchenne muscular dystrophy.

[0061] Example 2: In vivo pharmacodynamic study of chidamide in a DMD mouse model

[0062] 1. Research on drugs and their formulation

[0063] 1.1 Research drug: Chidamide, sourced from Shenzhen Chipscreen Biosciences Co., Ltd.;

[0064] 1.2 The drug preparation methods are shown in Table 1 below.

[0065]

[0066] 2. Laboratory animals

[0067] 2.1 Species and strains: C57BL / 6J mouse; B6-Dmd Del52 mouse

[0068] B6-Dmd Del52 mice, also known as DMD model mice, are a Duchenne muscular dystrophy (DMD) mouse model on a C57BL / 6 (B6) background: by deleting exon 52 of the Dmd gene to cause a frameshift, resulting in the loss of functional dystrophin and exhibiting a progressive myopathy phenotype.

[0069] 2.2 Sex: Male

[0070] 2.3 Number: 10 C57BL / 6J mice; 40 B6-Dmd Del52 mice

[0071] 2.4 Purchase Source: Jiangsu Jicui Yaokang Biotechnology Co., Ltd.

[0072] 3. Experimental Methods

[0073] 3.1 Animal Model and Grouping

[0074] Ten C57BL / 6J mice were selected as blank control mice (C57BL / 6+Vehicle group); 40 B6-Dmd Del52 mice were divided into 5 groups and administered drugs according to grip strength and serum CK value (CK value is the primary indicator and grip strength is the secondary grouping indicator) (the day of grouping is recorded as PG-D0), with 10 mice in each group.

[0075] 3.2 The dosing regimen is shown in Table 2 below:

[0076]

[0077] 3.3 Detection Indicators

[0078] 3.3.1 Animal response and weight change after drug administration: The weight of mice was measured twice a week, and the relationship between the weight change and the time of drug administration was recorded; at the same time, the survival and health status of the mice, such as the general state of the animals' activity and feeding during the drug administration period, were observed.

[0079] 3.3.2 Animal behavioral testing

[0080] Grip strength testing: Grip strength of mice was tested using a mouse rotarod fatigue tester before the start of the experiment and once a month after the start of the experiment.

[0081] 3.3.3 Pathological staining analysis: At the experimental endpoint, the left tibialis anterior muscle, the diaphragm (divided into two parts), and the myocardium were used for Sirius red (PSR) staining, Masson trichrome staining, and myeloperoxidase (MPO) staining; the right tibialis anterior muscle and the other part of the diaphragm were prepared in frozen embedding medium (OCT) for Oil Red O (ORO) staining.

[0082] Statistical analysis: Experimental data were analyzed using GraphPad Prism software. One-way ANOVA was used to compare differences between groups. p < 0.05 was considered statistically significant.

[0083] 4. Experimental Results and Analysis

[0084] 4.1 Animal responses and weight changes after drug administration: After the experiment, mice in all groups ate and drank normally, and were generally in good condition with no abnormal reactions. The weight of DMD model mice in group 2 was slightly higher than that of normal mice in group 1. After administration of different concentrations of chidamide, the weight of mice in groups 3-5 was slightly lower than that of DMD model mice in group 2. See Appendix for details. Figure 2 ;

[0085] 4.2 Animal behavioral test results

[0086] The grip strength of the DMD model group (group 2) was significantly lower than that of the blank control group (group 1) at each time point, indicating that the mice in the model group showed obvious muscle degeneration characteristics (p < 0.01). In contrast, the grip strength of the different time points and different doses of chidamide administration groups (groups 3-5) increased to varying degrees, and the differences were significant (p < 0.05 or p < 0.01).

[0087] 4.3 Pathological staining analysis results

[0088] Sirius red (PSR) and Masson's trichrome staining results: In the DMD model group (group 2), the staining of Sirius red and Masson's trichrome in the diaphragm, tibialis anterior muscle, and myocardial tissue was significantly higher than that in the blank control group (group 1) (p < 0.01), indicating increased collagen deposition and aggravated fibrosis. In contrast, the collagen content in different doses of chidamide administration groups (groups 3-5) was significantly lower than that in the DMD model group (group 2) (p < 0.05 or p < 0.01). See the schematic diagram and statistical chart of Sirius red (PSR) staining results. Figure 3 Schematic diagram and statistical chart of Masson trichrome staining results are shown below. Figure 4 .

[0089] Myeloperoxidase (MPO) staining results: In the DMD model group (group 2), the myeloperoxidase (MPO) staining in the diaphragm, tibialis anterior muscle, and myocardial tissue was significantly higher than that in the blank control group (group 1) (p < 0.01), indicating significant neutrophil infiltration and active acute inflammation. In contrast, the inflammation in the different doses of chidamide administration groups (groups 3-5) was significantly reduced compared to the DMD model group (group 2) (p < 0.05 or p < 0.01). See the schematic diagram and statistical chart of myeloperoxidase (MPO) staining results below. Figure 5 .

[0090] Oil Red O (ORO) staining results: In the DMD model group (group 2), the diaphragm and tibialis anterior muscle showed significantly higher Oil Red O staining than the blank control group (group 1) (p < 0.05), indicating that fatty infiltration and increased fat proportion occurred in the muscle tissue. In contrast, the different doses of chidamide administration groups (groups 3-5) showed varying degrees of reduced fatty infiltration compared to the DMD model group (group 2), with statistically significant differences (p < 0.05). See the schematic diagram and statistical graph of the Oil Red O (ORO) staining results below. Figure 6 .

[0091] In summary, behavioral tests revealed that DMD model mice exhibited typical muscle degeneration characteristics, namely decreased grip strength. Different administration times and dosages of chidamide improved muscle degeneration to varying degrees, demonstrating statistically significant advantages. Pathological examination showed significant staining of Sirius Red, Masson's Tricolor, MPO, and Oil Red O in the diaphragm and tibialis anterior muscles of the DMD model mice, while significant staining of Sirius Red, Masson's Tricolor, and MPO was observed in the myocardium. This indicates increased collagen deposition, aggravated fibrosis, significant muscle inflammation, and degenerative lesions, accompanied by an increased proportion of fat. Chidamide demonstrated statistically significant advantages in alleviating these lesions. Furthermore, no abnormalities were observed in the mice's response and weight changes after administration, indicating good safety and no adverse reactions after chidamide administration. This fully demonstrates that chidamide possesses both unexpected safety and efficacy in the treatment of DMD.

[0092] Example 3: An exploratory clinical study on the safety and efficacy of chidamide in the treatment of Duchenne muscular dystrophy.

[0093] Sample size: 10 subjects

[0094] Primary inclusion criteria: Subjects must meet all of the following inclusion criteria:

[0095] 1. In randomization, males aged ≥6 years who do not require bed rest and have characteristic clinical symptoms or signs of DMD at the time of screening (such as proximal muscle weakness, Gower's sign, and elevated serum creatine kinase levels).

[0096] 2. Diagnosed with DMD through genetic testing;

[0097] 3. Able to provide informed consent and / or written consent signed by the party concerned and / or their parents / legal guardians (in accordance with local regulations);

[0098] 4. Able to complete two 4-step step test (4SCT) screening assessments;

[0099] 5. Average 2 screenings and 4SCT assessments ≤ 8 seconds;

[0100] 6. Screening time for getting up from the ground ≥3 seconds and <10 seconds;

[0101] 7. Manual Muscle Testing (MMT) score ≥ 3 during screening;

[0102] 8. The patient has been using systemic corticosteroids for at least 6 months prior to the start of the study treatment, and there have been no significant changes in the type, dose, or dosing regimen of corticosteroids (excluding changes related to weight changes) for at least 6 months prior to the start of the study treatment, and it is reasonably expected that the dose and dosing regimen will not change significantly during the study period;

[0103] 9. Subjects must be willing to take appropriate contraceptive measures (if necessary).

[0104] Primary exclusion criteria: Subjects meeting any of the following criteria will not be included in the study:

[0105] 1. Exposure to another clinical trial drug within 3 months prior to the start of the study treatment (the only permitted exception is the use of Deflazacort).

[0106] 2. Exposure to idebenone within 3 months prior to the start of the study treatment;

[0107] 3. Exposure to any dystrophin repair products (e.g., Ataluren, exon skipping) within 6 months prior to the start of the study treatment.

[0108] 4. Any medication other than corticosteroids that may affect muscle strength or function (such as growth hormone) used within 3 months prior to the start of the study treatment; vitamin D, calcium and other supplements may be taken as long as the intake has been stable within 3 months prior to the start of the study treatment; if testosterone is used as an alternative therapy for delayed puberty, and the testosterone dose and treatment regimen have been stable for at least 6 months, and the circulating testosterone level is within the normal range for the subject's age;

[0109] 5. Had surgery within 3 months prior to the start of the study that may affect muscle strength or function, or plans to have surgery at any time during the study period;

[0110] 6. Loss of plantar flexion in the normal range of motion of the ankle joint due to contracture is ≥30° (that is, assuming the normal dorsiflexion is 20°, the fixed loss of plantar flexion caused by plantar displacement exceeds 10°);

[0111] 7. Change in contracture treatment within 3 months before enrollment, such as continuous plaster fixation, contracture control devices, night splints, stretching exercises (passive, active, self-performed), or such interventions are expected to be required during the study;

[0112] 8. Presence of other clinically significant diseases that, in the investigator's opinion, may adversely affect the subject's safety, make it unlikely that the treatment process or follow-up will be completed, or may impair the evaluation of study results;

[0113] 9. Diagnosed with other uncontrolled neurological diseases or has relevant uncontrolled physical diseases unrelated to DMD;

[0114] 10. At screening, platelet count, white blood cell count, and hemoglobin are <Lower Limit of Normal (LLN) (for abnormal screening laboratory test results (<LLN), platelet count, white blood cells and hemoglobin will be measured once again: if the repeated test result is still <LLN, the subject will be excluded);

[0115] 11. Symptomatic cardiomyopathy or heart failure (New York Heart Association class III or IV) or left ventricular ejection fraction <50% at screening;

[0116] 12. Current or past history of liver disease or impairment, including but not limited to elevated total bilirbin (i.e., > 1.5 times the upper limit of normal), unless it is secondary to Gilbert's syndrome or matches the pattern consistent with Gilbert's syndrome;

[0117] Renal insufficiency, defined as serum cystatin C >2 times the upper limit of normal. If the value is 2 times the upper limit of normal, serum cystatin C will be tested once again; if the repeated test result is still >2 times the upper limit of normal, the subject shall be excluded;

[0118] 14. Fasting triglyceride level >300 mg / dL (3.42 mmol / L) at screening;

[0119] 15. Positive for hepatitis B surface antigen, hepatitis C antibody or human immunodeficiency virus test at screening;

[0120] 16. QT interval on electrocardiogram >450 milliseconds (3 consecutive readings at 5-minute intervals) or past history of additional risk factors for torsades de pointes (such as heart failure, hypokalemia or family history of long QT syndrome);

[0121] 17. Mental illness / social circumstances that prevent potential subjects from understanding and complying with muscle function testing and / or research protocol procedures;

[0122] 18. Has an allergic reaction to any component of the research drug;

[0123] 19. Sorbitol intolerance or sorbitol malabsorption, or hereditary fructose intolerance;

[0124] 20. Contraindications to MRI or MRS (such as claustrophobia, metallic implants, or epileptic seizures).

[0125] 21. Has a serious chronic infectious disease or a recurrent infectious disease;

[0126] 22. The researchers believe that participants may not be able to complete this study or comply with its requirements (due to administrative or other reasons).

[0127] Subjects who do not meet the inclusion / exclusion criteria may be re-screened twice, with at least a 3-month interval between the two assessments, based on the researchers' judgment.

[0128] Test drug: Chidamide, provided by Shenzhen Chipscreen Biosciences Co., Ltd.

[0129] Dosage regimen: The dosage (0.5 mg / kg / day) is selected according to the subject's weight, and the medication is administered twice a week, with an interval of no less than 3 days between the two doses (Monday to Thursday, or Tuesday to Friday, or Wednesday to Saturday), 30 minutes after a meal.

[0130] Study endpoints

[0131] Key outcome variables:

[0132] 1. Primary outcome variable for efficacy: Mean change in 4SCT in DMD patients after 12 months of treatment with chidamide.

[0133] 2. Secondary outcome variables for effectiveness:

[0134] (1) Average change in time to stand (TTSTAND) since the start of the ground station;

[0135] (2) Average change in the 6-minute walk test (6MWT);

[0136] (3) Average change in the 10-meter walk / run test;

[0137] (4) Changes in the performance of the Upper Limb test (PUL);

[0138] (5) Mean change in the North Star Ambulatory Assessment (NSAA);

[0139] (6) Mean changes in fat content of the vastus lateralis muscle (assessed by muscle MR and musculoskeletal ultrasound).

[0140] Safety outcome variables:

[0141] 1. Number of subjects who experienced treatment-emergent adverse events (TEAEs) and serious adverse events (SAEs) (from baseline to end of study).

[0142] 2. Types, incidence, and severity of TEAEs and SAEs (from baseline to end of study);

[0143] 3. Changes from baseline to the end of the study:

[0144] (1) Vital signs and clinical laboratory tests (blood biochemistry and hematology);

[0145] (2) Evaluate respiratory function using FVC, FEV1, FVC / FEV1, and PEF;

[0146] (3) Electrocardiogram and echocardiography (ECHO) to evaluate cardiac function;

[0147] (4) Assess changes in cognitive function using children's intelligence scales;

[0148] (5) Height, weight, and BMI.

[0149] This study is planned to last 12 months and includes two phases:

[0150] 1. Screening period: 2 weeks before administration until the start of administration

[0151] 2. Treatment duration: 12 months

[0152] Chidamide treatment effectively improved efficacy indicators such as 4SCT, TTSTAND, and 6MWT in DMD patients, and no serious adverse events were observed. Therefore, chidamide treatment for DMD patients is both effective and safe.

[0153] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Use of chidamide or its derivatives in the preparation of medicaments for the treatment and / or prevention of muscular dystrophy; preferably, the derivatives of chidamide are selected from pharmaceutically acceptable salts, solvates, enantiomers, crystal form A and crystal form B.

2. The use as described in claim 1, characterized in that, The muscle atrophy mentioned is Duchenne muscular dystrophy (DMD).

3. The use as described in claim 1 or 2, characterized in that, The unit dose of the said chidamide or its derivative is 5-30 mg; preferably 5 mg, 10 mg, 15 mg, 20 mg, 25 mg or 30 mg.

4. The use as described in any one of claims 1-3, characterized in that, The patients receiving the drug treatment are children; preferably, the children are ≥6 years old.

5. The use as described in any one of claims 1-4, characterized in that, The drug is administered orally.

6. Use of a pharmaceutical composition comprising chidamide or a derivative thereof and at least one pharmaceutically acceptable excipient in the preparation of a medicament for treating and / or preventing muscular dystrophy; preferably, the derivative of chidamide is selected from its pharmaceutically acceptable salts, its solvates, its enantiomers, crystal form A and crystal form B.

7. The use as described in claim 3, characterized in that, The muscle atrophy mentioned is Duchenne muscular dystrophy (DMD).

8. The use as described in claim 6 or 7, wherein the unit dose of chidamide or its derivative in the pharmaceutical composition is 5-30 mg; preferably 5 mg, 10 mg, 15 mg, 20 mg, 25 mg or 30 mg.

9. The use as described in any one of claims 6-8, characterized in that, The patient treated with the composition is a child; preferably, the child is ≥6 years old.

10. The use as described in any one of claims 6-9, characterized in that, The composition is administered orally.

Images