Use of wac knockdown adenovirus in preparation of drugs for preventing and treating sarcopenia

Abstract

The application belongs to the field of biological medicine, and discloses application of WAC knockdown adenovirus in preparation of a medicine for preventing and treating sarcopenia. Through an adenovirus-associated virus mediated RNA interference technology, WAC gene is taken as a target to specifically intervene in FAPs, a key cell subpopulation in a pathological process of sarcopenia. The application discloses a core regulation role of WAC in aging of FAPs, and develops AAV-shWAC as a DNA therapy. The therapy does not directly act on muscle fibers, but removes a pollution source in a muscle microenvironment, i.e. SASP of aged FAPs, so as to restore regeneration potential of the muscle. Experimental demonstration of the application shows that WAC knockdown can significantly reduce secretion of inflammatory factors of aged FAPs, and in a sarcopenia mouse model, AAV-shWAC muscle injection can significantly improve muscle mass and grip strength, and reverse muscle atrophy, thereby providing a new target and gene therapy strategy for clinical treatment of sarcopenia.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to a WAC knockdown adeno-associated virus targeting FAPs, and more specifically to the application of WAC knockdown adenovirus in the preparation of drugs for the prevention and treatment of sarcopenia. Background Technology

[0002] Sarcopenia is an age-related syndrome characterized by progressive loss of skeletal muscle mass, strength, and function, severely impacting the quality of life of older adults and increasing the risk of falls, fractures, and death. Current clinical treatment for sarcopenia primarily relies on high-protein diets and resistance training. However, older adults often experience physical weakness, joint problems, or poor adherence to training, making it difficult to maintain high-intensity exercise regimens. Furthermore, nutritional supplementation alone has limited effectiveness in improving severe muscle atrophy. Currently, there are no specific drugs on the market that target the pathological mechanisms of sarcopenia.

[0003] Skeletal muscle regeneration and homeostasis depend on multicellular interactions. Fibro-adipogenic progenitors (FAPs) are a type of mesenchymal precursor cells located in the muscle interstitium. In young, healthy muscle, FAPs proliferate rapidly after injury and secrete paracrine factors to support the differentiation of muscle satellite cells (MuSCs) and muscle regeneration. However, with aging, FAPs undergo functional heterogeneity, manifested as cellular senescence, increased fibrosis tendency, and activation of the senescence-associated secretory phenotype (SASP). Senescent FAPs secrete large amounts of pro-inflammatory factors (such as IL-6 and TNF-α) and pro-fibrotic factors, leading not only to chronic inflammation of the muscle microenvironment but also inhibiting the myogenic capacity of muscle satellite cells, directly driving the development of sarcopenia. Current gene therapy and drug development largely focus on the anabolic metabolism of myofibers themselves (such as testosterone and myosin inhibitors) or the activation of muscle satellite cells (MuSCs). This overlooks the functional changes in intermediate cells of the muscle microenvironment (especially fibroblasts) during aging. Senescent fibroblasts transform from "regenerative support cells" into "pro-inflammatory and pro-fibrotic cells," worsening the muscle regeneration microenvironment (Niche). Without improving this microenvironment, simply stimulating muscle fibers or stem cells often fails to achieve lasting therapeutic effects.

[0004] SASP factors (such as IL-6, TNF-α, and TGF-β) secreted by aging fibroblasts (FAPs) are a core cause of chronic low-grade inflammation and inhibition of muscle regeneration. Current technologies lack gene therapies capable of specifically reversing the aging phenotype of FAPs and blocking SASP secretion. Existing anti-inflammatory drugs are typically administered systemically, have poor specificity, and are prone to causing systemic side effects (such as immunosuppression). WAC (WW Domain Containing Adaptor With Coiled-Coil), as an important adaptor protein, participates in various cellular biological processes. Currently, the specific expression pattern and regulatory mechanism of the WAC gene in skeletal muscle interstitial cell senescence have not been elucidated, therefore, no gene therapy drugs targeting WAC have been developed.

[0005] This invention discovered that WAC expression is significantly increased in aging fibroblasts (FAPs) and confirmed that WAC is a key checkpoint regulating the SASP phenotype of FAPs. Based on this, this invention proposes the application of WAC knockdown adenovirus in the preparation of drugs for the prevention and treatment of sarcopenia.

[0006] Develop a WAC knockdown adeno-associated virus that targets FAPs and uses DNA therapy to specifically intervene in FAPs, reversing their aging phenotype and thus effectively alleviating sarcopenia. Summary of the Invention

[0007] This invention aims to provide the application of WAC knockdown adenovirus in the preparation of drugs for the prevention and treatment of sarcopenia. By using adeno-associated virus (AAV) vectors to precisely target FAPs, inhibit the secretion of SASP factors, and improve the muscle regeneration microenvironment, the invention can alleviate sarcopenia from the root cause.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] In a first aspect, the present invention provides the application of shRNA that interferes with WAC expression in the preparation of drugs for the prevention and treatment of sarcopenia, wherein the nucleotide sequence of the shRNA is shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3.

[0010] Secondly, the present invention provides the application of recombinant plasmids in the preparation of drugs for the prevention and treatment of sarcopenia, wherein the recombinant plasmids carry shRNA with nucleotide sequences such as those shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3.

[0011] Thirdly, the present invention provides the application of viruses targeting FAPs in the preparation of drugs for the prevention and treatment of sarcopenia, wherein the virus carries shRNA with nucleotide sequences such as SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3.

[0012] Preferably, the virus is a WAC knockdown adenovirus.

[0013] Preferably, the method for constructing the WAC knockdown adenovirus includes the following steps:

[0014] Step 1: Design and synthesize shRNAs that interfere with WAC expression;

[0015] Step 2: Insert the shRNA into the adeno-associated virus (AAV) shuttle vector to construct the pAAV-shWAC recombinant plasmid;

[0016] Step 3: Package and purify the pAAV-shWAC recombinant plasmid to obtain WAC knockdown adenovirus.

[0017] Preferably, the packaging purification includes: co-transfecting host cells with pAAV-shWAC recombinant plasmid, AAV packaging plasmid, and helper plasmid, collecting cells, repeatedly freezing and thawing cells to release the virus, and purifying by gradient centrifugation.

[0018] Preferably, the serotype of the AAV packaging plasmid is MyoAAV2A.

[0019] Preferably, the host cell is a HEK293T cell.

[0020] Fourthly, the present invention provides a drug for preventing and treating sarcopenia, comprising the aforementioned WAC knockdown adenovirus.

[0021] Preferably, it also includes a pharmaceutically acceptable carrier and / or excipient.

[0022] Compared with the prior art, the beneficial effects of the present invention are:

[0023] 1. This invention provides a gene therapy vector targeting a novel target. By constructing an adeno-associated virus that specifically knocks down the WAC gene, this invention provides a genetically engineered tool that can precisely intervene in the expression level of WAC in FAPs cells, filling the gap in the application of this gene in the treatment of sarcopenia.

[0024] 2. Reversing the aging phenotype of FAPs and eliminating "toxic" factors in the microenvironment: This invention inhibits the aging-associated secretory phenotype (SASP) in FAPs by knocking down the WAC gene, significantly reducing the release of pro-inflammatory factors such as IL-6 and TNF-α, thereby restoring the muscle microenvironment from an "inhibitory regeneration" state to a "supportive regeneration" state.

[0025] 3. Promote muscle regeneration and alleviate sarcopenia symptoms: This invention aims to improve the microenvironment and relieve the inhibition of muscle satellite cell differentiation, thereby macroscopically increasing the cross-sectional area of ​​muscle fibers (CSA) and improving muscle grip strength, providing a long-acting, safe DNA therapy that addresses the root cause of age-related sarcopenia in clinical treatment.

[0026] 4. A treatment plan with high specificity and low side effects: By utilizing the natural affinity of adeno-associated viruses (such as MyoAAV2A) for skeletal muscle and interstitial cells, combined with specific interference sequences, this invention aims to achieve precise local or systemic treatment and avoid the side effects caused by systemic administration of traditional anti-inflammatory drugs. Attached Figure Description

[0027] Figure 1 The results show the expression levels of WAC in FAPs derived from muscle tissue of young and old mice (A is the mRNA level detected by RT-qPCR, and B is the protein level detected by Western Blot).

[0028] Figure 2 The results show the WAC expression levels of FAPs derived from muscle tissue of young mice after passage or TNF-α-induced aging (A is the mRNA level detected by RT-qPCR, and B is the protein level detected by Western Blot).

[0029] Figure 3 To validate the WAC knockdown efficiency of a young mouse muscle tissue-derived FAPs cell model after siWAC treatment;

[0030] Figure 4 The effect of WAC knockdown on the SASP phenotype of passaged or TNF-α-induced aging FAPs (A: SA-β-gal staining results; B: mRNA expression levels of SASP-related factors (IL-6, IL-1β)).

[0031] Figure 5 A spectrum of the AAV-shWAC vector;

[0032] Figure 6 To validate the WAC knockdown efficiency of a sarcopenia mouse model after AAV-shWAC treatment;

[0033] Figure 7 Histological analysis of muscle tissue in a mouse model of sarcopenia after treatment with AAV-shWAC (A is H&E staining image, B is DAPI staining image, C is muscle fiber cross-sectional area statistics).

[0034] Figure 8This is an analysis of muscle mass in a sarcopenic mouse model after treatment with AAV-shWAC in this embodiment of the invention (A is a gross muscle diagram, B is muscle mass statistics).

[0035] Figure 9 The muscle function of the sarcopenic mouse model after AAV-shWAC treatment in this embodiment of the invention is measured (A is the mouse suspension time, B is the mouse grip strength, and C is the mouse running time to exhaustion). Detailed Implementation

[0036] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0037] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0038] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0039] Example 1 revealed that WAC was abnormally elevated in aging FAPs.

[0040] In this embodiment, muscle tissue from young mice (2 months old) and aged mice (20 months old) was digested to prepare single-cell suspensions. Free-active protein cells (FAPs) were sorted using flow cytometry and labeled as CD45- / CD31- / ITGA7- / Sca1+ / PDGFRA+ cells. Total RNA and total protein were extracted from the sorted FAPs, and WAC expression levels were detected using RT-qPCR and Western Blot, respectively.

[0041] Compared with young mice, the mRNA and protein expression levels of WAC in FAPs of aged mice were significantly increased, suggesting that high WAC expression is closely related to the aging of FAPs and the progression of sarcopenia (see [link to original text]). Figure 1 ).

[0042] In this embodiment, primary free radical spore-forming enzymes (FAPs) were isolated from the muscle of young mice and cultured in vitro. Senescence was assessed after passage (P1 refers to the population after the first passage of primary cells, and P2, P6, and P10 refer to the cumulative 2nd, 6th, and 10th passage populations, respectively) and TNF-α-induced senescence. Using primary FAPs as a control, the WAC expression level of FAPs after passage and TNF-α-induced senescence was detected using RT-qPCR and Western Blot.

[0043] The results showed that the mRNA and protein expression levels of WAC in FAPs were significantly increased after passage to P10 and after induction with TNF-α (see [link to study]). Figure 2 ).

[0044] Example 2: In vitro experimental verification of WAC knockdown efficiency

[0045] Based on the results of Example 1, this example designs a specific siRNA sequence targeting the mouse WAC gene sequence, as follows:

[0046] siWac#1 (SEQ ID NO.1):GTGCACTTCATAGTTCAATTT;

[0047] siWac#2 (SEQ ID NO.2):CCAGTTACTCTCCACAAGAAA;

[0048] siWac#3 (SEQ ID NO. 3): GCGAGAGCAGAGGATACTATT.

[0049] In this embodiment, primary FAPs were isolated from the muscles of young patients and divided into four groups: a control group (siNC) treated with a non-homologous siRNA sequence of the target gene WAC; and three experimental groups treated with siWac#1, siWac#2, and siWac#3, respectively. Forty-eight hours after infection, the expression level of WAC in the FAP cell model was detected using RT-qPCR.

[0050] like Figure 3 As shown, the mRNA expression level of WAC in primary FAPs significantly decreased after treatment with siWac. The decrease was most pronounced with siWAC#3, therefore siWAC#3 was used for subsequent functional validation.

[0051] Example 3: In vitro experiments verify that WAC knockdown can reverse the aging secretion phenotype of FAPs.

[0052] In this embodiment, primary free radical fibroblasts (FAPs) were isolated from the muscle of young mice and cultured in vitro. The cultured FAPs were divided into two groups: a control group treated with a non-homological siRNA sequence targeting the WAC gene, and an experimental group treated with siWAC#3 targeting WAC. Forty-eight hours after infection, senescence was induced by passage to P10 and TNF-α, followed by senescence assays and SASP (saturated saline phospholipids) detection.

[0053] The method for detecting aging is as follows: the level of cellular aging is detected using an SA-β-gal staining kit.

[0054] The method for detecting SASP is as follows: cell culture supernatant and cell lysate are collected, and the expression of key SASP factors (IL-6, IL-1β, TNF-α, TGF-β) is detected by RT-qPCR.

[0055] like Figure 4 As shown, P10+siNC represents FAPs passaged to P10 after treatment with a siRNA sequence that is homologous to the target gene WAC; TNF-α+siNC represents FAPs that have undergone TNF-α-induced senescence after treatment with a siRNA sequence that is homologous to the target gene WAC; P10+siWac represents FAPs passaged to P10 after treatment with siWAC#3; TNF-α+siWac represents FAPs that have undergone TNF-α-induced senescence after treatment with siWAC#3. Compared with the control group, the proportion of SA-β-gal positive cells in the experimental group FAPs was significantly reduced. RT-qPCR results showed that WAC knockdown significantly downregulated the mRNA levels of pro-inflammatory factors such as IL-6 and TNF-α. The results indicate that WAC knockdown can effectively inhibit the SASP phenotype of senescent FAPs.

[0056] Example 4: Construction and Production of AAV Virus Targeting WAC

[0057] Based on the results of Examples 2-3, this example constructs an AAV virus targeting WAC according to the sequence of siWac#3 to verify the effects of knocking down or silencing WAC on the aging of FAPs and sarcopenia.

[0058] In this embodiment, as Figure 5 As shown, the construction of an AAV virus targeting WAC includes:

[0059] (1) Design of shRNA sequences for targeted knockdown of WAC gene

[0060] A specific shRNA sequence was designed based on the siWac#3 sequence targeting the mouse WAC gene sequence, as shown in SEQ ID NO.3. A non-targeted control sequence was also designed.

[0061] (2) Construction of AAV plasmid

[0062] The shRNA sequence was cloned into an AAV shuttle plasmid containing a U6 promoter and a GFP reporter gene to construct the pAAV-U6-shWAC-CMV-GFP recombinant plasmid (abbreviated as pAAV-shWAC).

[0063] (3) Virus packaging and purification

[0064] A three-plasmid co-transfection system was used to co-transfect HEK293T cells with recombinant plasmid pAAV-shWAC, AAV packaging plasmid pAAV-Rep / Cap (MyoAAV2A serotype), and pHelper plasmid (helper plasmid) using PEI transfection reagent. Cells were collected after 72 hours, and the virus was released by repeated freeze-thaw cycles. Viral particles were purified using iodixanol gradient centrifugation.

[0065] (4) Titer determination

[0066] The viral genome titer was determined by qPCR and adjusted to 1×10^12 VG / mL to obtain AAV virus targeting WAC for later use.

[0067] In this embodiment, a negative control virus carrying a non-targeted control sequence was simultaneously constructed using the method for constructing an AAV virus targeting WAC.

[0068] Example 5: In vivo experimental verification of AAV-shWAC treatment to alleviate sarcopenia in mice

[0069] This embodiment addresses the progression of sarcopenia by reducing WAC expression in FAPs through multiple-site injections of WAC knockdown adenovirus into SAMP8 mice. The specific protocol is as follows:

[0070] Ten-month-old SAMP8 mice were selected as a sarcopenia model and randomly divided into two groups: the AAV-shNC or shNC group and the AAV-shWAC or shWac group. Young mice served as normal controls. AAV virus (1×10^11 VG / mouse) was injected at multiple sites into the quadriceps femoris (QF) and gastrocnemius (GAS) muscles. The AAV-shNC group received the negative control virus prepared in Example 4, while the AAV-shWac group received the WAC-targeting AAV virus prepared in Example 4. Four weeks after injection, tissue samples were collected, and the WAC knockdown efficiency, muscle morphology, muscle mass, and muscle function of the sarcopenia mice treated with shWAC were detected and analyzed.

[0071] Immunofluorescence staining and image analysis revealed a significant decrease in WAC protein levels of FAPs in muscle tissue of the AAV-shWac injection group (see [link to image analysis]). Figure 6 This result proves that the WAC gene knockdown was successful in the model mice.

[0072] H&E staining results showed that untreated SAMP8 mice had small muscle fibers and increased interstitial fibrosis; while the AAV-shWAC treatment group had well-organized muscle fibers, significantly increased muscle fiber cross-sectional area (CSA) compared to the control group, and reduced fibrosis (see [link to study]). Figure 7 ).

[0073] Muscle mass analysis results showed that the grip strength of the limbs of mice in the AAV-shWAC treatment group was significantly improved compared with that in the control group, indicating that muscle function was improved (see...). Figure 8 )

[0074] Grasp strength test results showed that the grip strength of mice in the AAV-shWAC treatment group was significantly improved compared with that in the control group, indicating that muscle function was improved (see...). Figure 9 ).

[0075] In summary, the WAC knockdown AAV virus targeting FAPs constructed in this invention can reverse the aging of FAPs and the SASP phenotype by downregulating WAC expression, improve the microenvironment for muscle regeneration, thereby effectively increasing muscle mass and strength and alleviating sarcopenia.

[0076] This specific embodiment is merely an explanation of the present invention and is not intended to limit the invention. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they are within the scope of the claims of the present invention.

Claims

1. The application of shRNA that interferes with WAC expression in the preparation of drugs for the prevention and treatment of sarcopenia, characterized in that, The nucleotide sequence of the shRNA is shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.

3.

2. The application of recombinant plasmids in the preparation of drugs for the prevention and treatment of sarcopenia, characterized in that, The recombinant plasmid carries shRNA with nucleotide sequences such as SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.

3.

3. The application of viruses targeting FAPs in the preparation of drugs for the prevention and treatment of sarcopenia, characterized in that, The virus carries shRNA with nucleotide sequences such as SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.

3.

4. The application according to claim 3, characterized in that, The virus in question is a WAC knockdown adenovirus.

5. The application according to claim 4, characterized in that, The method for constructing the WAC knockdown adenovirus includes the following steps: Step 1: Design and synthesize shRNAs that interfere with WAC expression; Step 2: Insert the shRNA into the adeno-associated virus (AAV) shuttle vector to construct the pAAV-shWAC recombinant plasmid; Step 3: Package and purify the pAAV-shWAC recombinant plasmid to obtain WAC knockdown adenovirus.

6. The application according to claim 5, characterized in that, The packaging and purification process includes: co-transfecting host cells with the pAAV-shWAC recombinant plasmid, AAV packaging plasmid, and helper plasmid; collecting the cells; repeatedly freezing and thawing the cells to release the virus; and purifying the virus by gradient centrifugation.

7. The application according to claim 6, characterized in that, The serotype of the AAV packaging plasmid is MyoAAV2A.

8. The application according to claim 6, characterized in that, The host cell was HEK293T cell.

9. A drug for preventing and treating sarcopenia, characterized in that, The WAC knockdown adenovirus comprising any one of claims 4-8.

10. A medicament for treating sarcopenia according to claim 9, characterized in that, It also includes pharmaceutically acceptable carriers and / or excipients.

Images