Construction method and application of a functional enhanced dendritic cell cancer vaccine

Abstract

The present application relates to a kind of functional enhanced dendritic cell cancer vaccine construction method and application.The present application provides a kind of dendritic cell cancer vaccine construction method, which includes: 1) the expression level of the target gene in dendritic cell from tumor tissue and control tissue is compared, and the differentially expressed gene set is obtained;2) the gene of interest is obtained from the differentially expressed gene set obtained;And 3) the expression of the gene of interest in dendritic cell is regulated, and dendritic cell vaccine is prepared.The method of the present application is simple to operate, and the vaccine preparation process is mature, and the prepared dendritic cell vaccine has excellent antitumor immune effect.

Description

Technical Field

[0001] This invention relates to dendritic cell vaccine drugs for tumor immunotherapy and their preparation methods, belonging to the field of cell therapy. Specifically, this invention relates to methods for screening dendritic cell targets and related in vitro gene editing protocols. Background Technology

[0002] Single-cell sequencing technology is a biological research method that has emerged in recent years. By introducing single-cell sequencing technology into the study of various solid tumors, we have gained a deeper understanding of the types of immune cells present in the tumor microenvironment. [1-5] Previously, antigen-presenting cells were scarce in the tumor microenvironment, making it difficult to capture and analyze sufficient quantities using traditional biological research methods. However, as a crucial cell type linking tumor antigens to the body's adaptive immune system, especially the functionally most important dendritic cells, understanding these cells can significantly influence the formulation and optimization of cancer treatment strategies for patients. [6] .

[0003] By integrating a pan-cancer multi-sample single-cell sequencing dataset, we have gained a clearer understanding of dendritic cells in the human tumor microenvironment. [3] As specialized antigen-processing and presentation cells, dendritic cells have multiple subsets that are indispensable for activating antigen-specific T cell-associated subsets, thus playing a crucial role in the anti-tumor immune cycle. [7] However, current tumor immunotherapies targeting dendritic cells, including immunostimulants, cytokine administration, and dendritic cell vaccines, all have their limitations. Among these dendritic cell therapies, adoptive transfer therapy using autologous dendritic cell vaccines has relatively fewer toxic side effects, making it the most promising tumor treatment. The main process for dendritic cell tumor vaccines currently used in mainstream clinical trials involves: isolating and collecting monocytes from the patient's peripheral blood, culturing them in vitro with the addition of relevant growth factors to obtain a monocyte-derived dendritic cell phenotype, loading them with tumor antigens and stimulating their activation, and finally reinfusing them into the patient to activate a tumor-specific T-cell response. [6] In some clinical trials, these dendritic cell tumor vaccines have shown a certain degree of prolongation in patient survival. However, as a tumor immunotherapy with a relatively complex preparation process and patient-specific variability, its effect on prolonging the survival of cancer patients is often less than satisfactory. This is partly due to factors such as low antigen presentation efficiency, reduced cell migration function, and functional defects in dendritic cells caused by decreased cytokine secretion. [8] . Summary of the Invention

[0004] One of the objectives of this invention is to provide a new approach to screening potential targets for dendritic cells by combining human big data, in order to solve the problem of poor clinical anti-tumor efficacy of current dendritic cell-based vaccines.

[0005] In some implementation schemes, the inventors integrate data obtained from dendritic cells of multiple human cancer types, screen for novel dendritic cell-specific targets, and utilize increasingly sophisticated in vitro gene editing techniques to develop functionally enhanced dendritic cell vaccines, thereby activating the body's anti-tumor immune response.

[0006] In some embodiments, the present invention provides a method for constructing a dendritic cell cancer vaccine, which may include:

[0007] 1) Compare the expression levels of the target gene in dendritic cells from tumor tissue and control tissue to obtain the differentially expressed gene set;

[0008] 2) Select genes of interest from the obtained differentially expressed gene set; and

[0009] 3) Regulate the expression of the gene of interest in dendritic cells to prepare dendritic cell vaccines.

[0010] In some embodiments, regulating the expression of a gene of interest in dendritic cells may include increasing or decreasing the expression level of the gene of interest in the dendritic cells. In some embodiments, any suitable method may be used to increase or decrease the gene expression level, such methods are known in the art. For example, increasing gene expression level may include knocking in a gene, overexpressing a gene by regulatory elements such as promoters and / or enhancers, or activating a gene by CRISPRa; decreasing gene expression level may include knocking down or knocking out a gene by, for example, siRNA, shRNA, TALENS, ZFNS, CRISPRi, or CRISPR.

[0011] In some embodiments, the control tissue may include tissue different from the tumor tissue, such as adjacent normal tissue, healthy tissue, or tumor tissue having a different tumor type than the tumor, preferably adjacent normal tissue. In some embodiments, the control tissue may have the same or different tissue origin as the tumor.

[0012] In some embodiments, differential gene expression can be determined using appropriate techniques known in the art. In some embodiments, differential expression may include significant changes in the type and quantity of gene expression products (RNA or protein) at the transcriptional level (number and type of mRNA), post-transcriptional level (e.g., mRNA splicing, modification, transport, etc.), translational level (efficiency of protein synthesis, selection of start codons, etc.), or post-translational level (protein modification, localization, degradation, etc.). As known in the art, a significant change can refer to the presence or absence of a difference, or a difference of at least 5% in quantity or level, such as 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 100-fold, 1000-fold, 10000-fold or higher.

[0013] In some implementations, the genes of interest may include, for example, membrane protein genes. As known to those skilled in the art, membrane proteins are a class of functional proteins that are integrated into or anchored to the cell membrane or organelle membrane surface through post-translational modifications. Their core characteristic is that they bind to the lipid bilayer through transmembrane domains or lipid anchoring groups, playing a crucial role in intracellular and extracellular material exchange, signal transduction, energy conversion, and intercellular communication. Membrane proteins can be predicted and functionally annotated using bioinformatics methods, including, for example, sequence-based algorithms such as TopPred / SOSUI and TMHMM, deep learning models such as AlphaFold and MemNet for prediction, using tools such as BLAST and Pfam to compare against known membrane protein databases (such as UniProt) for functional annotation, and analyzing the association between membrane protein gene mutations and diseases through phenotypic association analysis combined with genomic variation databases (such as ClinVar). Membrane protein genes are the genes of membrane proteins, whose expression products, through post-translational modifications, form functional proteins with transmembrane domains that mediate core life activities such as intracellular and extracellular material exchange, signal transduction, energy conversion, and intercellular interactions. The regulation of membrane protein gene expression includes, for example, the transcriptional level regulation of promoter regions containing membrane-related cis-acting elements and transcription factors, as well as post-translational modifications, such as N-glycosylation and palmitoylation to enhance membrane binding stability or functional activity. Membrane protein genes encode proteins with transmembrane structures that perform core cell membrane functions; abnormal expression of these genes is closely related to various diseases and is an important target for drug development.

[0014] In some implementations, differentially expressed genes can be obtained by screening existing data or by comparing gene expression through experimental methods. In some implementations, target genes can be obtained as follows: a set of potential target genes is identified using bioinformatics methods, and then the gene expression of the potential target gene is compared in dendritic cells from tumor tissues and control tissues to obtain a differentially expressed gene set. In some implementations, for example, the bioinformatics methods include collecting datasets of single-cell sequencing of multiple human cancer types, obtaining single-cell sequencing data of dendritic cells from the dataset as a set of potential target genes, and then comparing the gene expression of the potential target gene in dendritic cells from tumor tissues and control tissues to obtain a differentially expressed gene set.

[0015] In some implementations, the expression levels of the target gene can be compared using gene chips (e.g., microarrays) or gene sequencing (e.g., next-generation sequencing).

[0016] In some embodiments, known target molecules in tumor immunity can be removed from the obtained differentially expressed gene set, and new target molecules can be retained. Then, genes of interest can be selected from the new target molecules. Alternatively, a set of membrane protein genes can be selected from the obtained differentially expressed gene set, known target molecules in tumor immunity can be removed from the obtained membrane protein gene set, and new target molecules can be retained. Then, genes of interest can be selected from the new target molecules. In some embodiments, the terms "target gene," "target gene," or "target" used herein are used interchangeably and may include appropriate genes or sets of genes that are the research target. In some embodiments, known target molecules can be identified, for example, by searching the literature. In some embodiments, the genes of interest described herein specifically refer to genes obtained through screening for improving the anti-tumor function of dendritic cell cancer vaccines. In some embodiments, genes of interest may include, for example, membrane protein genes.

[0017] In some embodiments, the regulatory role of membrane proteins in the antitumor function of dendritic cell vaccines can be verified using animal tumor models, such as mouse tumor models. In some embodiments, the verification method may include increasing or decreasing the expression level of membrane proteins in dendritic cells, and then determining changes in the antitumor function of the dendritic cell vaccine in the animal tumor model. In some embodiments, the verification method may include: increasing or decreasing the expression level of a gene of interest in single bone marrow cells of an animal, such as a mouse, inducing differentiation into bone marrow-derived dendritic cells, incubating with a tumor antigen and optional stimulant to obtain a dendritic cell vaccine loaded with the tumor antigen, administering it to an animal, and then determining the antitumor function of the dendritic cell vaccine. In some embodiments, regulating (e.g., increasing or decreasing) the expression level of a target molecule may include regulating (e.g., increasing or decreasing) the gene and / or protein levels of a target molecule (e.g., membrane protein).

[0018] In some embodiments, the present invention provides a dendritic cell cancer vaccine having altered levels of a gene of interest and / or its encoded protein, such as increasing or decreasing the level of a gene of interest and / or its encoded protein. In some embodiments, the gene of interest may include, for example, a membrane protein gene. In some embodiments, the dendritic cell cancer vaccine has decreased levels of the Plgrkt gene or protein. In some embodiments, the Plgrkt gene in the dendritic cell cancer vaccine is knocked down or eliminated. In some embodiments, the gene or protein levels in the dendritic cells or the vaccine thereof (e.g., alterations such as increasing or decreasing gene or protein levels in the dendritic cells or the vaccine thereof, or comparing differentially expressed genes therein) include gene or protein levels in the cells of their source, such as bone marrow cells. As is known in the art, increased or decreased gene or protein levels include significant changes in the gene or protein levels of membrane proteins, such as their presence or absence, or changes in their levels (increases or decreases) of at least 5%, such as 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 100-fold, 1000-fold, or 10000-fold or more.

[0019] In some embodiments, the present invention provides a method for developing a dendritic cell cancer vaccine, comprising altering the levels of a gene of interest and / or its encoded proteins in dendritic cells, such as increasing or decreasing the levels of membrane proteins. In some embodiments, the method comprises reducing the Plgrkt level in dendritic cells. In some embodiments, the method comprises knocking down or eliminating the Plgrkt gene in dendritic cells, for example by siRNA, shRNA, TALENS, ZFNS, CRISPRi, or CRISPR knockdown or elimination of the Plgrkt gene, for example, by using sgRNA with the sequence GCGTAACCATGAACTCCTGT (SEQ ID NO:1) to knock down or eliminate the Plgrkt gene via CRISPR. In some embodiments, the target sequence for knocking down or eliminating the Plgrkt gene includes GCGTAACCATGAACTCCTGT.

[0020] In this document, the regulation or alteration (e.g., increasing or decreasing) of target molecule levels can be performed using various methods well known to those skilled in the art. In some embodiments, the regulation or alteration (e.g., increasing or decreasing) of target molecule levels can be performed using a CRISPR / Cas system. As known to those skilled in the art, a CRISPR / Cas system can include guide RNA (gRNA) and Cas proteins, such as natural or non-natural Cas proteins, such as Cas9, Cas12, Cas13, etc. Guide RNA is a nucleic acid that recognizes a target molecule and can interact with a Cas protein, and can bind complementary to a portion of the nucleotides of the target molecule. Guide RNA can contain a backbone sequence and a guide sequence, the backbone sequence being the portion that interacts with the Cas protein and can be determined depending on the Cas protein used, and the guide sequence being able to bind complementary to the target molecule. In some embodiments, guide RNA can contain two RNAs, namely crRNA and tracrRNA. In some embodiments, guide RNA can be sgRNA, formed by linking the main portions of crRNA and tracrRNA.

[0021] In some embodiments, the gene of interest may be selected from one or more of the following genes: 1) the top ten genes upregulated or downregulated by differential fold change, such as the top ten upregulated genes TMEM176A, TNFSF10, FSCN1, MX1, GBP1, TMEM176B, LTB, STAT1, SAMD9L, CD14, or the top ten downregulated genes: IL1R2, IL1R1, MTRNR2L12, NBEAL1, MTRNR2L8, VMO1, MAP4K4, SIPA1L1, PIK3R5, SYTL3; or 2) membrane protein genes, such as the top ten membrane protein genes upregulated or downregulated by differential fold change, preferably membrane protein genes upregulated by differential fold change, such as TMEM176A, TMEM176B, CSF2RB, CYBB, CD40, SYGNR2, BST2, GRINA, CD84 and PLGRKT, preferably PLGRKT.

[0022] In some embodiments, the present invention provides a dendritic cell cancer vaccine constructed or prepared by the methods described herein. In some embodiments, the present invention provides a dendritic cell cancer vaccine having reduced Plgrkt levels, preferably wherein the Plgrkt gene is knocked out. In some embodiments, the present invention also provides the use of the dendritic cell cancer vaccine in the preparation of antitumor drugs. As is known to those skilled in the art, there are no particular limitations on the cancers or tumors that can be prevented and / or treated by dendritic cell cancer vaccines, and appropriate loaded antigens can be selected to target the corresponding cancer or tumor. Such tumor antigens and corresponding cancers or tumors have been well studied in the art. In some implementations, tumor antigens may include one or more tumor-associated antigens (TAAs), such as TRP-1, MART-1, Melan A, gp100, tyrosinase, tumor-specific mutant gene products such as CDK-4, β-linkin, MUM-1, oncogenes such as p53, K-ras, H-ras, cancer testis antigens such as MAGE, GAGE, NY-ESO1, overexpressed autoantigens such as MUC1, cyclin B1, Her2-neu, CEA, p53, SART-1, PRAME, p15, viral antigens such as HPV E7, EBV-derived antigens, and telomerase, etc. In some embodiments, the cancer or tumor can be a solid tumor or a hematologic malignancy, including, for example, central nervous system cancer, gynecological cancer, melanoma, thoracic cancer, lung cancer, ovarian cancer, breast cancer, pancreatic cancer, head and neck cancer, prostate cancer, skin cancer, esophageal cancer, thyroid cancer, gastric cancer, hepatocellular carcinoma, cholangiocarcinoma, renal cell carcinoma, testicular cancer, sarcoma, colorectal cancer, lymphoma, leukemia, multiple myeloma, etc. Methods for preparing dendritic cell vaccines are well known in the art. In some embodiments, the method may include the steps of isolating and / or providing a population of dendritic cell precursors. Dendritic cell precursors may include peripheral blood mononuclear cells, monocytes, or other bone marrow progenitor cells, which may be derived from mammals such as humans. In some embodiments, after isolation, purification, and / or enrichment, the dendritic cell precursors are induced to differentiate into dendritic cells, for example, by culturing the precursor cells in the presence of GM-CSF and interleukin-4 (IL-4). In some embodiments, dendritic cells may be transfected with nucleic acids such as mRNA encoding antigens (e.g., tumor antigens as described above). In some embodiments, the antigen may be autologous to the subject and may be derived from cancer cells or tumor tissue obtained from the subject. In some embodiments, dendritic cells loaded / transfected with the antigen may be frozen in a composition containing a cryoprotectant, and the thawed dendritic cell vaccine may be administered to the subject at an appropriate time after thawing.

[0023] In some embodiments, the present invention provides a kit comprising the vaccine of the present invention, which may include a container such as a vial containing the vaccine of the present invention, such as cryopreserved dendritic cells. In some embodiments, the present invention also provides the use of the dendritic cells of the present invention as a medicament, such as for the preparation of vaccines or pharmaceutical compositions or kits. The dendritic cells or compositions of the present invention can be used in immunotherapy, such as for the treatment or prevention of cancer. In some embodiments, the dendritic cells may optionally be co-administered with an adjuvant or cytokine such as GM-CSF, IL-12, IFN-α, IL-2, etc.

[0024] In some embodiments, the composition or kit may comprise the dendritic cells of the present invention and a pharmaceutically acceptable carrier and / or excipient. In some embodiments, a suitable formulation for administration may comprise an aqueous isotonic sterile injectable solution containing antioxidants, buffers, antibacterial agents, suspending agents, solubilizers, stabilizers, preservatives, immunostimulants, cytokines, and adjuvants, etc. In some embodiments, the dendritic cell composition or vaccine may be administered by a variety of methods, such as injection, including subcutaneous, intradermal, intravenous, intralymphatic, intra-articular, intramuscular, and intraperitoneal injections, as well as infusion.

[0025] This invention may cover the technical solutions described in one or more of the following aspects:

[0026] In some implementation schemes, gene sets with therapeutic potential are obtained and screened from human pan-cancer dendritic cell data, and dendritic cell vaccine functional targets with significant therapeutic effects on tumors are further screened through animal model experiments.

[0027] In some embodiments, the present invention provides a method for constructing and applying a gene-edited, functionally enhanced dendritic cell cancer vaccine, which may include one or more of the following steps:

[0028] Step (1): Identify potential target molecules for subsequent validation experiments by combining bioinformatics methods with literature review.

[0029] Step (2): Using gene editing methods, knock out relevant target molecules in dendritic cells to prepare related dendritic cell vaccines;

[0030] Step (3): Using a mouse tumor model, verify the regulatory effect of related molecules on the anti-tumor function of dendritic cell vaccines.

[0031] In some embodiments, the present invention provides a method for constructing and applying the above-mentioned gene-edited functionally enhanced dendritic cell cancer vaccine, wherein in step (1), the main method for identifying potential targets using bioinformatics methods combined with literature review may include one or more of the following steps:

[0032] Step (1-1): Collect datasets of single-cell sequencing of multiple human cancers. For example, this invention may include 158 single-cell sequencing datasets of 33 common human cancers.

[0033] Steps (1-2): From the above dataset, we obtained relevant data on dendritic cells, for example, we obtained sequencing data of 217,557 dendritic cells from 1,507 samples.

[0034] Steps (1-3): In these data, we compared the mRNA levels of differentially expressed genes from dendritic cells in and adjacent to tumors, and obtained the gene set of differentially expressed genes.

[0035] Steps (1-4): From the obtained differentially expressed gene set, screen out membrane-associated protein genes that are more likely to become targets, and obtain a new gene set;

[0036] Steps (1-5): In the newly obtained differentially expressed membrane-associated protein gene dataset, remove the target molecules that have been reported in tumor immunity through literature review, and retain other molecules that may become new targets.

[0037] In some embodiments, the present invention provides a method for constructing and applying the above-mentioned gene-edited functionally enhanced dendritic cell cancer vaccine, wherein step (2) may include one or more of the following steps:

[0038] Step (2-1): Design sgRNA sequences based on the full-length sequence of the new target;

[0039] Step (2-2): Introduce sgRNA or control untargeted sgRNA into the bone marrow single-cell suspension of an animal. For example, using a kit such as Lonza P3 Primary Cell 4D-Nucleofector Kit and IDT Alt-R™ Sp Cas9-RFPV3, the relevant sgRNA or control untargeted sgRNA is introduced into the freshly isolated bone marrow single-cell suspension of an animal such as a C57BL / 6j wild-type mouse by electroporation.

[0040] Steps (2-3) Induce differentiation into bone marrow-derived dendritic cells, for example, by culturing electroporated mouse bone marrow cells in a culture medium containing 100 ng / ml of recombinant mouse Flt3l protein for 14 days;

[0041] Steps (2-4): Confirm the knockout efficiency of the relevant target proteins. For example, confirm the knockout efficiency of the relevant target proteins by Western blotting and identify the sgRNA sequence that can stably knock out the relevant target proteins.

[0042] In some embodiments, the present invention provides a method for constructing and applying the above-mentioned gene-edited functionally enhanced dendritic cell cancer vaccine, wherein step (3) may include one or more of the following steps:

[0043] Step (3-1): Add tumor antigen for incubation. For example, on the 13th day of in vitro culture of stable bone marrow dendritic cells with knockout target molecules obtained in step (2-3) after 14 days of culture, add tumor-associated antigen and lipopolysaccharide stimulant for incubation for 24 hours.

[0044] Step (3-2): Apply dendritic cells loaded with tumor antigens, for example, at a concentration of 8 x 10⁻⁶. 5 Cells were injected subcutaneously into the unilateral inguinal lymph nodes of sex-matched C57BL / 6j mice aged 6-8 weeks.

[0045] Step (3-3): Optional, a second booster injection, for example, a second booster injection to mice using the same method and dosage one week after the first vaccine injection;

[0046] Step (3-4): Injection of tumor antigen-positive tumor cells, for example, one week after mice have received a second vaccination, subcutaneous injection of tumor-associated antigen-positive tumor cells used in step (3-1) is performed on the mice near the vaccination site.

[0047] Steps (3-5): Determine the changes in the anti-tumor function of dendritic cell vaccines. For example, through tumor measurement analysis over a certain period of time, determine the changes in the anti-tumor function of dendritic cell vaccines with knockout of relevant target molecules.

[0048] This invention provides a novel dendritic cell vaccine target screening scheme that can effectively screen differentially expressed genes in tumor dendritic cells, thereby preparing dendritic cell cancer vaccines with enhanced anti-tumor effects. The screening process is simple, and the vaccine preparation technology is mature. For example, the vaccine targeting the Plgrkt gene in tumor dendritic cells screened in this invention demonstrated the release of dendritic cell vaccine-related anti-tumor potential in the mouse MC38-OVA model, achieving a significantly better anti-tumor effect than the control group. Attached Figure Description

[0049] Figure 1 This is a schematic diagram of the Plgrkt target protein knockout in mouse bone marrow-derived dendritic cells in an embodiment of the present invention.

[0050] Figure 2 This is a schematic diagram of tumor growth in mice after the application of dendritic cell vaccine in an embodiment of the present invention. Detailed Implementation

[0051] The method for constructing the gene-edited, functionally enhanced dendritic cell cancer vaccine in this embodiment includes the following steps:

[0052] Example 1: Screening of novel targets for dendritic cell vaccines

[0053] To identify previously unreported dendritic cell targets for the development of enhanced dendritic cell vaccines, this study collected 158 single-cell sequencing datasets from publicly available human multi-cancer single-cell sequencing databases for 33 common human cancers (see Table 1). Among these, we obtained dendritic cell data, totaling 217,557 dendritic cell sequencing data points. Since these samples originated from both tumor and adjacent normal tissues of patients, we further grouped dendritic cells from these two sources to understand the phenotypic and functional changes of dendritic cells within the tumor microenvironment. Using the transcriptome of dendritic cells from adjacent normal tissues as a control group, we analyzed differentially expressed genes to identify genes whose transcriptional levels specifically changed in the tumor microenvironment, including all upregulated and downregulated genes with a significant p-value less than 0.05. Next, for these sets of upregulated and downregulated genes with significant changes in transcriptional levels, we calculated the fold change (Fold Change) of each gene relative to the average expression level of the same gene in adjacent dendritic cells, and ranked them according to Log2FoldChange. The top ten upregulated genes were: TMEM176A, TNFSF10, FSCN1, MX1, GBP1, TMEM176B, LTB, STAT1, SAMD9L, and CD14; while the top ten downregulated genes were: IL1R2, IL1R1, MTRNR2L12, NBEAL1, MTRNR2L8, VMO1, MAP4K4, SIPA1L1, PIK3R5, and SYTL3. In this example, we focused on the set of genes upregulated in dendritic cells of the tumor microenvironment, including membrane proteins and intracellular proteins. Considering that membrane proteins are more easily targeted than intracellular factors such as transcription factors, we further screened the genes with the largest upregulated expression levels and sorted them according to the magnitude of change. The top-ranked upregulated membrane protein-related genes included TMEM176A, TMEM176B, CSF2RB, CYBB, CD40, SYGNR2, BST2, GRINA, CD84, and PLGRKT. Excluding the genes GRINA and SYGNR2, whose functions in the immune system are completely unknown, this also included some genes with well-known functions in regulating dendritic cell homeostasis, differentiation and maturation, and antigen presentation, such as CD40, CSF2RB, BST2, and CYBB (also known as NOX2).[9-12] CD84 has been reported to regulate a range of innate and adaptive immune cells and has been explored as a novel target for the treatment of cancer and autoimmune disorders.

[13] The TMEM176A and TMEM176B cation channel genes are known to indicate the maturation status of dendritic cells, and the immunomodulatory effects of TMEM176B in macrophages and dendritic cells have been reported multiple times in recent years. [14-16] .

[0054] Among the remaining top-ranked upregulated genes, we selected PLGRKT, a gene that has been reported in the literature to play a regulatory role in other myeloid cells but has never been reported in dendritic cells, as the target gene for this study. Because previous literature has reported that the protein sequence of the PLGRKT molecule is highly conserved in various mammals (including humans, mice, rats, cattle, and dogs), its function is also quite conserved.

[17] .

[0055] The human PLGRKT gene sequence can be found at NCBI Reference Sequence: NC_000009.12, and the mouse PLGRKT gene sequence can be found at NCBI Reference Sequence: NC_000085.7. The human PLGRKT protein sequence is mgfifsksmnesmknqkefm lmnarlqler qlimqsemre rqmamqiaws reflkyfgtf fglaaislta gaikkkkpaflvpivplsfi ltyqydlgyg tllermkgea edileteksk lqlprgmitf esiekarkeq srffidk (SEQ ID NO:4), and the mouse PLGRKT protein sequence is mgfifsksmn enmknqqefm vtharlqler hltmqnemrerqmamqiaws reflkyfgtf fgiatislat galkrkkpaf lvpivplsfi ftyqydlgyg tllqrmkseaediletektk lelpkglitf eslekarreq sklfsdk (SEQ ID NO:5).

[0056] Example 2: Antitumor Function of Novel Targets for Dendritic Cell Vaccines

[0057] To investigate the potential regulatory role of PLGRKT molecules on dendritic cells, we conducted in vitro and in vivo experiments using mice as an animal model. Mouse bone marrow-derived dendritic cells are a commonly used research model, obtained by culturing and stimulating freshly isolated primary bone marrow cells from mice to achieve the phenotype and function of dendritic cells. Based on the mouse PLGRKT gene sequence, we designed multiple sgRNA sequences and had them manufactured using GenScript's EasyEdit sgRNA system. We found that the sgRNA with the sequence GCGTAACCATGAACTCCTGT (SEQ ID NO:1) exhibited the best knockout effect on the mouse PLGRKT molecule. Figure 1 The results are shown in "Knockout Group-1". In contrast, another sgRNA sequence, GCAACCATCTCTTTAGCAAC (SEQ ID NO:2), showed very poor knockout efficiency for the target protein, such as... Figure 1 The results in "Knockout Group-2" are shown. The specific knockout method includes the following steps:

[0058] Step (2-1): Based on the full sequence of the new target, design the EasyEdit sgRNA sequence and deliver it to GenScript for production;

[0059] Step (2-2): Using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024) and Alt-R™ Sp Cas9-RFP V3 (IDT, 10008163), the relevant sgRNA or the control non-targeting sgRNA (Genscript, sequence: AAATGTGAGATCAGAGTAAT (SEQ ID NO:3)) was introduced into the bone marrow single-cell suspension of freshly isolated C57BL / 6j wild-type mice (purchased from Jicui Yaokang) by electroporation.

[0060] Steps (2-3): Electroporated mouse bone marrow cells were cultured for 14 days in complete IMDM medium containing 100 ng / ml mouse recombinant Flt3l protein (PeproTech, 250-31L) [containing 90% IMDM medium (Gibco, 12440-053), 10% fetal bovine serum (Gibco, 10091-148), 1x penicillin-streptomycin (Eallbio, 03.12001A), 1x non-essential amino acids (Sigma, M-7145-100ml), 1x sodium pyruvate (Gibco, 11360-070), and 1x GlutaMAX (Gibco, 35050-061)] to induce differentiation into bone marrow-derived dendritic cells.

[0061] Steps (2-4): The knockout efficiency of the Plgrkt target protein was detected by Western blotting.

[0062] exist Figure 1 The upper band shows the visualization of the internal reference protein Gapdh at 37 kDa in bone marrow-derived dendritic cells from the control and Plgrkt knockout mice. The Gapdh antibody (CST, 5174s) used was diluted 1:5000. The lower band shows the visualization of the Plgrkt molecule at 18 kDa in bone marrow-derived dendritic cells from the control and Plgrkt knockout mice. The Plgrkt antibody (Thermo Fisher, PA5-98932) used was diluted 1:1000. It can be seen that the Plgrkt sgRNA in the knockout group-1 has an excellent knockout effect on this protein; no related protein band is observed in the knockout group-1.

[0063] The construction method and application of the above-mentioned gene-edited functionally enhanced dendritic cell cancer vaccine, step (3) includes the following steps:

[0064] Step (3-1): On the 13th day of in vitro culture, the bone marrow dendritic cells with stable knockout of target molecules obtained in step (2-3) were incubated with 20ug / ml ovalbumin OVA (Invivogen, Vac-Pova) and 100ng / ml lipopolysaccharide (Sigma, L2654) stimulant for 24 hours.

[0065] Step (3-2): After washing and collecting the dendritic cells loaded with tumor antigens, resuspend them in complete IMDM medium (containing 90% IMDM medium, 10% fetal bovine serum, 1x penicillin-streptomycin, 1x non-essential amino acids, 1x sodium pyruvate, 1x GlutaMAX), and pressurize at 8x10⁻¹⁰. 5 Cells were injected subcutaneously into the unilateral inguinal lymph nodes of sex-matched C57BL / 6j mice aged 6-8 weeks.

[0066] Step (3-3): One week after the first vaccine injection, mice were given a second subcutaneous booster vaccine injection using the same method and dosage. The cells injected this time were bone marrow-derived dendritic cells cultured in vitro for 14 days, and the processing method was the same as in step (3-1).

[0067] Steps (3-4): One week after the mice received the second vaccine injection, subcutaneously inject the mice with the tumor-associated antigen OVA-positive MC38-OVA tumor cell line (a gift from Professor Fu Yangxin's research group at Tsinghua University) used in step (3-1) near the vaccination site. The dosage of injected cells was 1 x 10⁻⁶ cells per mouse. 6cell;

[0068] Steps (3-5), as follows Figure 2 As shown, after tumor inoculation, mice underwent regular tumor observation and measurement analysis three times a week to determine changes in the anti-tumor function of the dendritic cell vaccine with knockout of relevant target molecules. It can be seen that, in the blue-represented target molecule knockout group, the growth rate of tumors containing relevant tumor antigens after dendritic cell vaccine inoculation was significantly inhibited compared to the control group treated with dendritic cell vaccine electroporated with non-target sgRNA (AAATGTGAGATCAGAGTAAT (SEQ ID NO:3)). The significance p-value was less than 0.0001 under the Wilcoxon test.

[0069] This application provides a method for constructing and applying a gene-edited, functionally enhanced dendritic cell cancer vaccine, comprising several parts: screening for tumor-associated dendritic cell targets, electroporation of mouse primary bone marrow cells to knock out the target and induce dendritic cell phenotype, vaccination of the prophylactic dendritic cell tumor vaccine, and evaluation of its anti-tumor efficacy. Among these, the target gene screening strategy, sgRNA knockout sequence design, and prophylactic vaccination process are key technical means in the construction process. Data from this application show that the GCGTAACCATGAACTCCTGT (SEQ ID NO:1) sequence targeting the Plgrkt gene has excellent knockout effects and can enhance the subsequent anti-tumor function of the vaccine. The above embodiments are merely examples demonstrating the application potential of the relevant strategies and are not intended to limit the implementation. Those skilled in the art can make other variations or modifications based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of the claims of this patent application.

[0070] Table 1: Single-cell sequencing datasets collected in this paper

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087] References:

[0088] [1] Papalexi, E., & Satija, R. (2018). Single-cell RNA sequencing to explore immune cell heterogeneity. Nature reviews. Immunology, 18(1), 35–45.https: / / doi.org / 10.1038 / nri.2017.76

[0089] [2] Zheng, L., Qin, S., Si, W., Wang, A., Xing, B., Gao, R., Ren, X., Wang, L., Wu, X., Zhang, J., Wu, N., Zhang, N., Zheng, H., Ouyang, H., Chen, K., Bu, Z., Hu, X., Ji, J., & Zhang, Z. (2021). Pan-cancer single-cell landscape of tumor-infiltrating T cells. Science (New York, N.Y.), 374(6574), abe6474. https: / / doi.org / 10.1126 / science.abe6474

[0090] [3] Cheng, S., Li, Z., Gao, R., Xing, B., Gao, Y., Yang, Y., Qin, S.,Zhang, L., Ouyang, H., Du, P., Jiang, L., Zhang, B., Yang, Y., Wang, X., Ren,X., Bei, J. X., Hu, X., Bu, Z., Ji, J., & Zhang, Z. (2021). A pan-cancersingle-cell transcriptional atlas of tumor infiltrating myeloid cells. Cell,184(3), 792–809.e23. https: / / doi.org / 10.1016 / j.cell.2021.01.010

[0091] [4] Tang, F., Li, J., Qi, L., Liu, D., Bo, Y., Qin, S., Miao, Y., Yu,K., Hou, W., Li, J., Peng, J., Tian, Z., Zhu, L., Peng, H., Wang, D., &Zhang, Z. (2023). A pan-cancer single-cell panorama of human natural killercells. Cell, 186(19), 4235–4251.e20. https: / / doi.org / 10.1016 / j.cell.2023.07.034

[0092] [5] Yang, Y., Chen, X., Pan, J., Ning, H., Zhang, Y., Bo, Y., Ren,X., Li, J., Qin, S., Wang, D., Chen, M. M., & Zhang, Z. (2024). Pan-cancersingle-cell dissection reveals phenotypically distinct B cell subtypes. Cell,187(17), 4790–4811.e22. https: / / doi.org / 10.1016 / j.cell.2024.06.038

[0093] [6] Wculek, S. K., Cueto, F. J., Mujal, A. M., Melero, I., Krummel,M. F., & Sancho, D. (2020). Dendritic cells in cancer immunology andimmunotherapy. Nature reviews. Immunology, 20(1), 7–24. https: / / doi.org / 10.1038 / s41577-019-0210-z

[0094] [7] Mellman, I., Chen, D. S., Powles, T., & Turley, S. J. (2023). Thecancer-immunity cycle: Indication, genotype, and immunotype. Immunity, 56(10), 2188–2205. https: / / doi.org / 10.1016 / j.immuni.2023.09.011

[0095] [8] Perez, C. R., & De Palma, M. (2019). Engineering dendritic cellvaccines to improve cancer immunotherapy. Nature communications, 10(1), 5408.https: / / doi.org / 10.1038 / s41467-019-13368-y

[0096] [9] Elgueta, R., Benson, M. J., de Vries, V. C., Wasiuk, A., Guo, Y.,& Noelle, R. J. (2009). Molecular mechanism and function of CD40 / CD40Lengagement in the immune system. Immunological reviews, 229(1), 152–172.https: / / doi.org / 10.1111 / j.1600-065X.2009.00782.x

[0097]

[10] Greter, M., Helft, J., Chow, A., Hashimoto, D., Mortha, A.,Agudo-Cantero, J., Bogunovic, M., Gautier, E. L., Miller, J., Leboeuf, M.,Lu, G., Aloman, C., Brown, B. D., Pollard, J. W., Xiong, H., Randolph, G. J.,Chipuk, J. E., Frenette, P. S., & Merad, M. (2012). GM-CSF controlsnonlymphoid tissue dendritic cell homeostasis but is dispensable for thedifferentiation of inflammatory dendritic cells. Immunity, 36(6), 1031–1046.https: / / doi.org / 10.1016 / j.immuni.2012.03.027

[0098]

[11] Moffat, J. M., Segura, E., Khoury, G., Caminschi, I., Cameron,P. U., Lewin, S. R., Villadangos, J. A., & Mintern, J. D. (2013). Targetingantigen to bone marrow stromal cell-2 expressed by conventional andplasmacytoid dendritic cells elicits efficient antigen presentation. Europeanjournal of immunology, 43(3), 595–605. https: / / doi.org / 10.1002 / eji.201242799

[0099]

[12] Savina, A., Jancic, C., Hugues, S., Guermonprez, P., Vargas, P.,Moura, I. C., Lennon-Duménil, A. M., Seabra, M. C., Raposo, G., & Amigorena,S. (2006). NOX2 controls phagosomal pH to regulate antigen processing duringcrosspresentation by dendritic cells. Cell, 126(1), 205–218. https: / / doi.org / 10.1016 / j.cell.2006.05.035

[0100]

[13] Cuenca, M., Sintes, J., Lányi, Á., & Engel, P. (2019). CD84 cellsurface signaling molecule: An emerging biomarker and target for cancer andautoimmune disorders. Clinical immunology (Orlando, Fla.), 204, 43–49.https: / / doi.org / 10.1016 / j.clim.2018.10.017

[0101]

[14] Condamine, T., Le Texier, L., Howie, D., Lavault, A., Hill, M.,Halary, F., Cobbold, S., Waldmann, H., Cuturi, M. C., & Chiffoleau, E.(2010). Tmem176B and Tmem176A are associated with the immature state ofdendritic cells. Journal of leukocyte biology, 88(3), 507–515.

[0102] https: / / doi.org / 10.1189 / jlb.1109738

[0103]

[15] Segovia, M., Russo, S., Jeldres, M., Mahmoud, YD, Perez, V.,Duhalde, M., Charnet, P., Rousset, M., Victoria, S., Veigas, F., Louvet, C.,Vanhove, B., Floto, RA, Anegon, I., Cuturi, MC, Girotti, MR,Rabinovich, GA, & Hill, M. (2019). Targeting TMEM176B Enhances Antitumor Immunity and Augments the Efficacy of Immune Checkpoint Blockers byUnleashing Inflammasome Activation. Cancer cell, 35(5), 767–781.e6.

[0104] https: / / doi.org / 10.1016 / j.ccell.2019.04.003

[0105]

[16] Jing, L., An, Y., Cai, T., Xiang, J., Li, B., Guo, J., Ma, X.,Wei, L., Tian, ​​Y., Cheng, X., Chen, X., Liu, Z., Feng, J., Yang, F., Yan, X., & Duan, H. (2023). A subpopulation of CD146 + macrophages enhance antitumor immunity by activating the NLRP3 inflammasome. Cellular & molecularimmunology, 20(8), 908–923. https: / / doi.org / 10.1038 / s41423-023-01047-4

[0106]

[17] Miles, L. A., Vago, J. P., Sousa, L. P., & Parmer, R. J. (2020).Functions of the plasminogen receptor Plg-R KT . Journal of thrombosis andhaemostasis : JTH, 18(10), 2468–2481. https: / / doi.org / 10.1111 / jth.15014。

Claims

1. A method for constructing a dendritic cell cancer vaccine, comprising: 1) Compare the expression levels of the target gene in dendritic cells from tumor tissue and control tissue to obtain the differentially expressed gene set; 2) Select genes of interest from the obtained set of differentially expressed genes; and 3) Regulate the expression of the gene of interest in dendritic cells to prepare dendritic cell vaccines.

2. The method of claim 1, wherein: a) Regulating the expression of the gene of interest in dendritic cells includes increasing or decreasing the expression level of the gene of interest in dendritic cells, and / or b) The control tissue includes tissues that are different from the tumor tissue, such as adjacent normal tissue, healthy tissue, or tumor tissue having a tumor that is different from the tumor, preferably adjacent normal tissue.

3. The method of claim 1 or 2, wherein the target gene in step 1) is obtained by: determining a set of potential target genes using bioinformatics methods, and then comparing the gene expression of the potential target gene in dendritic cells from tumor tissue and control tissue to obtain a set of differentially expressed genes.

4. The method of claim 3, wherein the bioinformatics method includes collecting a dataset of single-cell sequencing of multiple human cancers, obtaining single-cell sequencing data of dendritic cells from the dataset as a set of potential target genes, and then comparing the gene expression of the potential target gene in dendritic cells from tumor tissue and control tissue to obtain a set of differentially expressed genes.

5. The method of claim 1 or 2, wherein the comparison of the expression level of the target gene in step 1) is performed by gene chip or gene sequencing.

6. The method according to any one of claims 1-5, wherein step 2) further comprises: The differentially expressed gene pool is used to remove known target molecules in tumor immunity and retain new target molecules, and then the genes of interest are selected from the new target molecules. Alternatively, a set of membrane protein genes can be selected from the obtained differentially expressed gene set, known target molecules in tumor immunity can be removed from the obtained set of membrane protein genes and new target molecules can be retained, and then genes of interest can be selected from the new target molecules.

7. The method according to any one of claims 1-6, further comprising: 4) Validate the regulatory effect of dendritic cell vaccines of interest on antitumor function using animal tumor models, such as mouse tumor models.

8. The method of claim 7, wherein step 4) comprises: Increase or decrease the expression level of the target cell in dendritic cells and then determine the changes in the antitumor function of the dendritic cell vaccine in animal tumor models.

9. The method of claim 8, wherein step 4) comprises: In animal bone marrow single cells, the expression levels of genes of interest are increased or decreased, and their differentiation into bone marrow-derived dendritic cells is induced. These cells are then incubated with tumor antigens to obtain dendritic cell vaccines loaded with tumor antigens. These vaccines are administered to animals, and the antitumor function of the dendritic cell vaccines is then determined. Optionally, increasing gene expression levels includes gene knock-in, gene overexpression via regulatory elements such as promoters and / or enhancers, or gene activation via CRISPRa. Decreasing gene expression levels includes gene knockdown or knockout via, for example, siRNA, shRNA, TALENS, ZFNS, CRISPRi, or CRISPR.

10. The method according to any one of claims 1-9, wherein the gene of interest is selected from: 1) the top ten genes upregulated or downregulated by differential fold change, such as the top ten upregulated genes TMEM176A, TNFSF10, FSCN1, MX1, GBP1, TMEM176B, LTB, STAT1, SAMD9L, CD14, or the top ten downregulated genes IL1R2, IL1R1, MTRNR2L12, NBEAL1, MTRNR2L8, VMO1, MAP4K4, SIPA1L1, PIK3R5, SYTL3; or 2) membrane protein genes, such as the top ten membrane protein genes upregulated or downregulated by differential fold change, preferably membrane protein genes upregulated by differential fold change, such as TMEM176A, TMEM176B, CSF2RB, CYBB, CD40, SYGNR2, BST2, GRINA, CD84 and PLGRKT, preferably PLGRKT.

11. A method for preparing a dendritic cell cancer vaccine, comprising reducing the level of Plgrkt in dendritic cells.

12. The method of claim 11, wherein reducing Plgrkt levels comprises knocking down or eliminating the Plgrkt gene by siRNA, shRNA, TALENS, ZFNS, CRISPRi, or CRISPR.

13. The method of claim 12, wherein the sgRNA of the sequence GCGTAACCATGAACTCCTGT shown in SEQ ID NO:1 is used to knock down or eliminate the Plgrkt gene via CRISPR.

14. The method of claim 12 or 13, wherein the target sequence for knocking down or knocking out the Plgrkt gene includes GCGTAACCATGAACTCCTGT.

15. A dendritic cell cancer vaccine constructed or prepared by the method of any one of claims 1-14.

16. A dendritic cell cancer vaccine having reduced Plgrkt levels, preferably wherein the Plgrkt gene is knocked out.

17. The use of the dendritic cell cancer vaccine according to claim 15 or 16 in the preparation of an antitumor drug.

18. The application of claim 17, wherein the tumor is a solid tumor or a hematologic malignancy, such as central nervous system cancer, gynecological cancer, melanoma, thoracic cancer, lung cancer, ovarian cancer, breast cancer, pancreatic cancer, head and neck cancer, prostate cancer, skin cancer, esophageal cancer, thyroid cancer, gastric cancer, hepatocellular carcinoma, bile duct cancer, renal cell carcinoma, testicular cancer, sarcoma, colorectal cancer, lymphoma, leukemia, and multiple myeloma.

Images