Use of irak4 gene in anti-emetic

Abstract

This invention discloses IRAK4 Application of genes in anti-emetic toxin (deoxynivalenol, DON). This invention utilizes porcine CRISPR / Cas9 whole-genome knockout library screening technology to perform high-throughput screening of host molecular targets responding to DON toxicity, successfully identifying host genes with DON toxicity effects. IRAK4 To verify IRAK4 The relationship between genes and DON toxicity was further investigated using CRISPR / Cas9 technology to knock out candidate targets in porcine cells, and a [presumably a specific gene or mechanism] was constructed. IRAK4 Gene knockout monoclonal cell lines. After DON treatment, compared with wild-type control cells, IRAK4 Gene knockout monoclonal cells significantly inhibited DON-induced cytotoxicity, confirming that... IRAK4 Genes are key targets for host regulation of DON toxicity effects and can serve as molecular intervention targets for preventing and treating DON toxicity damage, thus having significant application value.

Description

Technical Field

[0001] This invention belongs to the fields of biotechnology and molecular toxicology, specifically involving IRAK4 Application of genes in antiemetic toxins. Background Technology

[0002] Deoxynivalenol (DON) is a compound mainly produced by Fusarium graminearum (… Fusarium graminearum ) and yellow Fusarium ( Fusarium culmorum DON is a toxic metabolite produced by pathogenic fungi such as barley and corn. This natural toxin was first isolated from contaminated barley in 1972 and subsequently detected in contaminated corn. It was named vomitoxin because it induces severe vomiting in laboratory animals. Due to its high thermal stability, DON cannot be completely degraded by conventional food processing methods such as baking or boiling, making it a major mycotoxin requiring close attention in the food and feed safety field.

[0003] Doxorubicin (DON) is one of the most prevalent mycotoxins contaminating grains and feed globally. A survey conducted between 2021 and 2024 analyzed 2,411 feed samples, detecting DON in 98.9% of the samples. Pigs are most susceptible to DON toxicity. A 2026 study showed that dietary DON concentrations as low as 0.25 mg / kg (far below the limits of 1 mg / kg in China and 0.9 mg / kg in the EU) can induce subclinical multi-organ toxicity in weaned piglets, manifested as decreased antioxidant capacity, thrombocytopenia, and intestinal damage.

[0004] The toxic mechanisms of dopamine monoxide (DON) have long been a major research focus in agricultural and food science. Although existing research has elucidated several aspects of its cytotoxicology, including oxidative stress, endoplasmic reticulum stress, ribosome toxicity, and complex interactions between molecular signaling pathways, the primary cellular targets of its cytotoxicity remain unclear. Similarly, the mechanisms by which DON induces vomiting, anorexia, and other toxic syndromes in pigs and other animals are not fully understood. Summary of the Invention

[0005] Based on the shortcomings and deficiencies of existing technologies, this invention aims to further identify the main host targets regulating the toxicity of vomitoxin (deoxynivalenol, DON) and elucidate its potential toxic mechanisms. Using whole-genome CRISPR / Cas9 knockout library technology, this invention systematically performs high-throughput screening and identification of molecular targets related to DON toxicity effects in a porcine cell model. Specifically, using a CRISPR knockout (KO) library, whole-genome screening was conducted in the porcine intestinal epithelial cell line IPI-2I, successfully obtaining a series of functionally validated toxicity-related molecular targets, from which [the following was identified / identified / discussed ... IRAK4 Genes, and provided IRAK4 Application of genes as key targets in reducing or antagonizing the toxicity of vomitoxin.

[0006] One object of the present invention is to provide an animal anti-vomiting toxin toxicity drug, said drug comprising an IRAK4 inhibitor, the nucleotide sequence of the gene encoding said IRAK4 being shown in SEQ ID NO.3.

[0007] Preferably, the inhibitor is a CRISPR / Cas9 system for knocking out the gene encoding IRAK4.

[0008] Preferably, the CRISPR / Cas9 system includes sgRNA, the nucleotide sequence of which is the target site shown in SEQ ID NO. 4.

[0009] Preferably, the animal is a pig.

[0010] A second object of the present invention is to provide the use of an IRAK4 inhibitor in the preparation of a medicament against the toxicity of vomiting toxins, wherein the nucleotide sequence of the gene encoding IRAK4 is shown in SEQ ID NO.3.

[0011] A third objective of this invention is to provide a cell model resistant to vomitoxin toxicity, in which... IRAK4 The gene is knocked down or eliminated, the aforementioned IRAK4 The nucleotide sequence of the gene is shown in SEQ ID NO.3.

[0012] Preferably, the knockdown is performed using a CRISPR / Cas9 system.

[0013] Preferably, the CRISPR / Cas9 system includes sgRNA, the nucleotide sequence of which is the target site shown in SEQ ID NO. 4.

[0014] Preferably, the cells are porcine intestinal epithelial cells.

[0015] A fourth objective of this invention is to provide the application of an IRAK4 inhibitor in the preparation of a cell model resistant to vomitoxin toxicity, wherein the nucleotide sequence of the gene encoding IRAK4 is shown in SEQ ID NO.3.

[0016] The beneficial effects of this invention are: This invention utilizes porcine CRISPR / Cas9 whole-genome knockout library screening technology to perform high-throughput screening and identification of host molecular targets responding to DON toxicity. This helps in discovering known pathways regulating cellular responses to DON, as well as previously unknown novel pathways. Furthermore, it successfully identified host genes exhibiting DON toxicity effects. IRAK4 To verify IRAK4The relationship between genes and DON toxicity was further investigated using CRISPR / Cas9 technology to knock out candidate targets in porcine cells, thus constructing a [system / mechanism]. IRAK4 Gene knockout monoclonal cell lines. After DON treatment, compared with wild-type control cells, IRAK4 Gene knockout monoclonal cells significantly inhibited DON-induced cytotoxicity, confirming that... IRAK4 The gene is a key target for host regulation of DON toxicity, providing not only new molecular intervention targets for preventing and treating DON toxic damage, but also deepening the understanding of the mechanism of DON-induced cytotoxicity, and has important application value. Attached Figure Description

[0017] Figure 1 Western blot identification IRAK4 Expression of IRAK4 protein in gene knockout cell lines.

[0018] Figure 2 It is a verification IRAK4 The gene knockout cell lines showed stronger DON resistance; where A represents the CCK8 assay results under DON treatment. IRAK4 Compared to wild-type cells, the cell viability of gene knockout cell lines was higher when treated with DON (B). IRAK4 A schematic diagram of the cytotoxicity of gene knockout cell lines.

[0019] Figure 3 It is a verification IRAK4 Gene knockout cell lines showed lower ROS levels under DON treatment; A represents the results of DCFH-DA probe detection of wild-type (NT) and... IRAK4 ROS levels in gene knockout cell lines before and after DON treatment; B is a comparison between wild-type (NT) cell lines and... IRAK4 Peak positions of gene knockout cell lines after DON treatment, where C represents the quantification of wild-type (NT) cell lines and... IRAK4 The fluorescence intensity of gene knockout cell lines after DON treatment was used to represent the ROS level. Statistical differences between groups were compared using analysis of variance (ANOVA), with significance level expressed as ** (P < 0.01).

[0020] Figure 4 It is a test IRAK4 Expression levels of antioxidant stress proteins in gene knockout cell lines before and after DON treatment. Detailed Implementation

[0021] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0022] The following examples utilize CRISPR / Cas9 knockout library technology to perform high-throughput screening of targets involved in the toxic effects of DON, and then use CRISPR / Cas9 technology to knock out candidate targets. IRAK4 The gene can significantly inhibit the DON-induced cytotoxic effect. Specifically, the following examples demonstrate the construction of key candidate targets. IRAK4 A homozygous knockout monoclonal cell line of the gene was established, and experimental results were demonstrated. IRAK4 Gene knockout can significantly increase the host cell’s resistance to DON.

[0023] Example 1: High-throughput screening of key candidate targets involved in the toxic effects of DON using a whole-genome CRISPR / Cas9 knockout library from pigs. 1. High-throughput screening workflow for whole-genome CRISPR / Cas9 knockout libraries A genome-wide unbiased strategy was employed to screen key targets involved in the toxic effects of DON, including the following steps: (1) Using a pig whole genome CRISPR / Cas9 library plasmid, package the library lentivirus; (2) The library lentivirus was transduced into the IPI-2I cell line. After 12 hours of library treatment, 0.5 μg / mL purine toxin pressure screening was performed to remove untransduced cells and construct a whole-genome mutant cell library. (3) Treat the whole genome mutant cell bank with 10 μM DON and observe the cell pathogenesis continuously. After the cell death situation stabilizes, collect the surviving resistant cells. For the surviving cells obtained in the first round, perform the second and third rounds of DON treatment experiments in the same way to finally obtain a cell bank with stable resistance to DON. (4) Genomic DNA was extracted from the surviving cells collected after the last round (3rd round) of DON treatment, PCR amplification was performed, and an amplicon high-throughput sequencing library was constructed. Subsequently, the enriched sgRNA and enriched candidate genes were identified by bioinformatics analysis. (5) Conduct functional studies on the selected candidate genes.

[0024] It is worth noting that the commercial pig CRISPR / Cas9 knockout library (Yuanjing Biotechnology, pgGeCKO Library) used in this embodiment contains a total of 123,951 gRNAs, targeting 20,661 genes, with 6 gRNAs designed for each gene. It also contains 2000 non-target control sgRNAs.

[0025] 2. Collection of DON-resistant cells, preparation of sequencing libraries, NGS sequencing and analysis. Following the library screening procedure described above, the mutant cell library was treated with 10 μM DON for 48 h in each round. After 48 h, the DON was removed, and the cells were cultured in fresh DON-free medium (DMEM + 10% FBS) for 48 h to revitalize the resistant cell population. This procedure was repeated for a total of three rounds. The cell lines from the final round were collected for later use.

[0026] The screening process was repeated four times, resulting in the collection of four resistant cell samples and four whole-genome mutant cell bank samples.

[0027] Genomic DNA was extracted from the collected cells according to the instructions of the Quick-DNA™ Midiprep Plus Kit (D4075, Zymo Research). Amplification and library construction were performed targeting the integrated sgRNA. The PCR amplification primers were: LentiCRISPRv2-F: ATTTCTTGGGTAGTTTGCAGTTT, SEQ ID NO.1; LentiCRISPRv2-R: GACTCGGTGCCACTTTTTCA, SEQ ID NO.2.

[0028] After sequencing, comparative analysis was performed using the MAGeCK program on four resistant cell samples and four whole-genome mutant cell bank samples. Significantly enriched sgRNAs and gene loci in the resistant cell samples were enriched, and key target genes were screened from these. IRAK44 Its nucleotide sequence is shown in SEQ ID NO.3.

[0029] Example 2: Construction using CRISPR / Cas9 technology IRAK4 Gene knockout monoclonal cell lines (1) IRAK4 Design of gene-editing sgRNA Design Targets IRAK4 The gene's sgRNA recognizes the target site TCTGGACTTGAAGAGTCTGG (SEQ ID NO. 4), with a PAM site containing "TGG" at the 3' end of the target sequence. Sensitive strand (IRAK4-sgRNA-F: CACCGTCTGGACTTGAAGAGTCTGG, SEQ ID NO. 5) and antisense strand (IRAK4-sgRNA-R: AAACCCAGACTCTTCAAGTCCAGAC, SEQ ID NO. 6) DNA targeting the above target were synthesized.

[0030] (2) Preparation of gene editing vectors containing sgRNA The synthesized sense and antisense DNA strands were mixed in an equimolar ratio and placed in a boiling water bath at 100°C for 5 min. The water bath was then turned off, and the mixture was allowed to cool naturally to room temperature. During the slow cooling process, the complementary double-stranded DNA renatured to form sgRNA double-stranded DNA, which carried sticky ends at both ends that were complementary to the BpiI restriction sites in the PX330 vector.

[0031] The BpiI restriction sites of the pX330 vector (42230, Addgene) were digested using the BpiI enzyme (ER1011, Thermo Fisher). The digestion system is shown in Table 1 below.

[0032] Table 1 BpiI enzyme digestion system The enzyme digestion reaction was carried out at 37°C for 2 h. Gel electrophoresis was used to determine whether the enzyme digestion was complete, and the purified enzyme-digested linearized vector was recovered from the gel.

[0033] The annealing product was ligated with the enzyme-digested linearized vector, and the ligation reaction system is shown in Table 2 below.

[0034] Table 2. Ligation reaction system of annealing product and enzymatically cleaved linearized vector The ligation reaction was performed at 16°C for at least 2 hours. The ligation product was then transformed into *E. coli* TOP10 transformants. Single bacterial clones were subsequently picked, plasmids were extracted, and plasmid sequencing confirmed successful recombinant plasmid construction. The successfully constructed recombinant plasmid was named pX330-pIRAK4. After extensive amplification, the recombinant plasmid was prepared for transfection.

[0035] (3) IRAK4 Preparation of gene knockout monoclonal IPI-2I cell lines IPI-2I porcine intestinal epithelial cell line was cultured in DMEM containing 10% FBS at 37℃ and 5% CO2. The cells were then plated into 24-well plates and maintained at a density of 70-80% aggregation for approximately 12 hours. Twelve hours after platening, liposomes were transfected using Lipofectamine 3000 (L3000, Thermo Fisher). To perform cell stress selection and enrichment of positive clones simultaneously with gene editing, a co-transfection strategy using the gene editing vector (pX330-pIRAK4) and the pcDNA3.1 vector (V79020, Thermo Fisher) was employed. The pcDNA3.1 vector provided a neomycin resistance marker for G418 selection to enrich positive cell clones. Twenty-four hours after transfection, the transfected cells were digested and plated into five 10cm culture dishes, approximately 1000 cells per dish. After 24 hours, the cells adhered to the wall, and G418 antibiotic was added to 500 μg / mL for screening to enrich positive monoclonal IPI-2I cell lines.

[0036] After approximately two weeks of selection and culture with 500 μg / mL G418 antibiotic, significant cell death was observed, along with the formation of monoclonal cell colonies. Plump and dense cell clones were individually selected and cultured in 24-well plates. Once the 24-well plates were confluent, they were passaged into 6-well plates. After the 6-well plates were confluent, half a cell was harvested from each well, and genomic DNA was extracted and amplified. IRAK4 Sanger sequencing was performed on a sequence approximately 500 bp near the gene target site to identify whether a site-directed mutation occurred and whether the mutation resulted in a homozygous frameshift mutation. The PCR amplification primer sequences are as follows: IRAK4-F: AGATGCTGTTCCCAAACCCA, SEQ ID NO.7; IRAK4-R: CTGTTTGGTGGTCCTCCAGT, SEQ ID NO. 8.

[0037] (4) Identification by sequencing analysis yielded results in... IRAK4 The specific mutation types of monoclonal cells that produce double isotropic frameshift mutations (i.e., homozygous mutations) at the gene target site are shown in the table below. IRAK4 Gene knockout monoclonal cells produced a 4bp homozygous deletion at the target site (specific mutation details are shown in Table 3, where short lines indicate the deleted base positions). This mutation resulted in a frameshift mutation, producing a premature stop codon, thereby hindering the expression of the mature full-length protein.

[0038] Table 3 IRAK4 Mutation status of gene knockout monoclonal IPI-2I cells (5) IRAK4 Western blot analysis was performed on the gene knockout monoclonal IPI-2I cell line using the rabbit polyclonal antibody anti-IRAK4 (PA517531, Thermo Fisher Scientific). Protein level detection confirmed that the cloned cell line completely did not express IRAK4 protein, thus confirming... IRAK4 Gene knockout monoclonal IPI-2I cells (hereinafter referred to as...) IRAK4 Gene knockout cell line successfully constructed Figure 1 ).

[0039] Example 3: IRAK4 Gene knockout cells inhibit DON-induced cell death right IRAK4 Gene knockout cells and control wild-type cells (IPI-2I cells) were seeded into 96-well plates. After adhesion, the culture medium was replaced with a gradient concentration of DON (i.e., DEME + 10% FBS + 0-10 μM DON). Specifically, DON was dissolved in DMSO to gradient concentrations (from high to low) of 10, 5, 2.5, 1.25, 0.625, and 0 μM, with at least 5 replicates for each gradient. Cell viability was assessed after incubation at 30°C for 48 h. Cell viability was measured using the CCK-8 cell proliferation and toxicity assay kit (CK04, Tongren Chemical). The absorbance was read at 450 nm using a microplate reader, and cell viability and half-maximal inhibitory concentration (IC50) were calculated. 50 () curve, comparison IRAK4 Difference in viability between gene knockout cells and controls.

[0040] The results show IRAK4 Gene knockout cells showed a significant inhibitory effect on DON-induced cytotoxicity, specifically under DON treatment, IRAK4 Gene knockout cells showed significantly increased viability and a significantly reduced number of dead CCK8 cells. Figure 2 ).

[0041] Example 4: IRAK4 Gene knockout cells exhibit reduced reactive oxygen species levels and higher expression of antioxidant stress genes. Early literature reported that various mycotoxins cause cytotoxicity by inducing an increase in reactive oxygen species (ROS) in cells, thereby increasing cellular oxidative stress. To detect... IRAK4 The molecular mechanism by which gene knockout cells resist DON cytotoxicity was investigated by examining cellular ROS levels and the levels of typical oxidative stress proteins to assess the potential molecular causes of cellular resistance to DON cytotoxicity.

[0042] (1) IRAK4Gene knockout monoclonal cells and control wild-type cells (IPI-2I cells, NT) were seeded into 24-well plates, with each cell type divided into two groups, each with four replicate wells. One group (DON group) was treated with 10 μM DON, and the other group was treated with the same volume of DMSO as the control. After 48 h of treatment, the cells were stained with the ROS probe DCFH-DA (E004-1-1, Nanjing Jiancheng). DCFH-DA was diluted to a final concentration of 10 µM with serum-free DMEM medium, and the cells were incubated at 37 °C for 30 min. The cells were then collected, washed twice with PBS, and resuspended in 100 µL PBS. Flow cytometry was used to analyze the proportion of positive cells and fluorescence intensity, and fluorescence analysis was performed using a wavelength-dependent channel at 488 nM excitation.

[0043] Figure 3 Figure A shows the ROS levels of the two cell lines before and after DON treatment, as detected by the DCFH-DA probe. The peak position corresponds to the fluorescence intensity; the further to the right the peak is, the stronger the fluorescence intensity, indicating a higher ROS level. The leftmost single peak for both cell lines represents normal cells (negative control) that were not labeled with the DCFH-DA probe. Figure 3 Figure A shows a significant rightward shift in the peak plots of all cells after DON treatment, confirming that DON exposure significantly increases cellular ROS levels. Comparing the peak plot positions of the two cell types after DON treatment shows... IRAK4 The peak value of the gene knockout cell line was significantly lower than that of the wild-type control, confirming... IRAK4 Gene knockout cells had lower ROS levels compared to wild-type cell lines after DON treatment. Figure 3 (B in the text). Quantifying the fluorescence intensity of two cell lines after DON treatment ( Figure 3 The C in the figure further illustrates that IRAK4 gene knockout cells had lower ROS levels compared to wild-type cell lines after DON treatment. These results indicate that, under DON treatment, the ROS levels of both gene knockout cell lines were significantly lower than the ROS levels of the control wild-type cells. Figure 3 ).

[0044] (2) After plating the cells into 24-well plates as described above and treating them with 10 μM DON, collect the cells and lyse them using RIPA cell lysis buffer to prepare cell lysis buffer. After the concentration of the cell lysis buffer was measured and adjusted to be consistent using a BCA protein concentration assay kit (Thermo Fisher), SDS-PAGE protein electrophoresis and PVDF membrane transfer were performed. To detect antioxidant stress proteins, incubation was performed using antibodies against GPX4, NRF2, SOD1, NQO1, and GCLC. The antibodies used were: rabbit monoclonal antibody anti-NRF2 (80593-1-RR, Proteintech), rabbit monoclonal antibody anti-GPX4 (59735T, CST), rabbit monoclonal antibody anti-GCLC (52183T, CST), rabbit monoclonal antibody anti-SOD1 (GTX637934, Genetex), and rabbit polyclonal antibody anti-NQO1 (GTX100235, Genetex). β-actin was used as an internal control protein, with the antibody being HRP-coupled mouse monoclonal antibody anti-β-actin (A00730-100, Genscript). Subsequent steps included washing, incubation with secondary antibody (HRP-coupled goat anti-rabbit IgG (7074, CST), and washing again. The final product was incubated with ECL (specifically, SuperSignal). TM The expression level of the target protein was detected by exposing the West Atto hypersensitive substrate (A38556, Thermo Fisher).

[0045] The detection of antioxidant stress protein levels showed that DON treatment significantly reduced antioxidant protein levels, while IRAK4 Gene knockout cells treated with DON showed varying degrees of increase in the levels of antioxidant stress proteins compared to wild-type cells treated with DON. Figure 4 ).

[0046] Based on a comprehensive analysis of ROS levels and antioxidant stress protein levels, IRAK4 After gene knockout, DON-induced cellular ROS levels decreased, accompanied by an increase in the levels of some antioxidant stress proteins, thus alleviating DON-induced cell death.

Claims

1. A drug for treating vomitoxin toxicity in animals, characterized in that, The drug includes an IRAK4 inhibitor, the nucleotide sequence of which is shown in SEQ ID NO.

3.

2. The drug according to claim 1, characterized in that, The inhibitor is a CRISPR / Cas9 system used to knock out the gene encoding IRAK4.

3. The drug according to claim 2, characterized in that, The CRISPR / Cas9 system includes sgRNA, the nucleotide sequence of which is the target site shown in SEQ ID NO.

4.

4. The drug according to claim 1, characterized in that, The animal in question is a pig.

5. The use of IRAK4 inhibitors in the preparation of drugs to combat the toxicity of vomitoxin, characterized in that, The nucleotide sequence of the gene encoding IRAK4 is shown in SEQ ID NO.

3.

6. A cell model resistant to vomitoxin toxicity, characterized in that, In cells IRAK4 The gene is knocked down or eliminated, the aforementioned IRAK4 The nucleotide sequence of the gene is shown in SEQ ID NO.

3.

7. The cell model according to claim 6, characterized in that, The knockout was performed using the CRISPR / Cas9 system.

8. The cell model according to claim 7, characterized in that, The CRISPR / Cas9 system includes sgRNA, the nucleotide sequence of which is the target site shown in SEQ ID NO.

4.

9. The cell model according to claim 7, characterized in that, The cells mentioned are porcine intestinal epithelial cells.

10. The application of IRAK4 inhibitors in the preparation of cell models resistant to vomitoxin toxicity, characterized in that, The nucleotide sequence of the gene encoding IRAK4 is shown in SEQ ID NO.3.

Images