A traditional chinese medicine extract magnetic chip and a method for screening target points and active ingredients for treating amyotrophic lateral sclerosis by using the same

Abstract

The application discloses a traditional Chinese medicine extract magnetic chip, which is constructed by grafting a functional group on the surface of Fe3O4 nano magnetic beads and then bonding traditional Chinese medicine extract medicine particles with the functional group. The chip can be used to screen the target points for treating amyotrophic lateral sclerosis, and further used to carry out reverse screening on active ingredients in the traditional Chinese medicine extract by using the screened target point proteins. The method is used to screen tubulysin A in the traditional Chinese medicine extract, and the tubulysin A has a remarkable effect in protecting nerve cells.

Description

Technical Field

[0001] This invention relates to the fields of traditional Chinese medicine and biomedical technology, specifically to a magnetic chip for traditional Chinese medicine extracts, and a method for using the chip to screen the target sites and active ingredients of traditional Chinese medicine extracts for the treatment of amyotrophic lateral sclerosis (ALS). Background Technology

[0002] Amyotrophic lateral sclerosis (ALS), also known as Lou Gehrig's disease, is a progressive neurodegenerative disease. Its pathogenesis involves the gradual degeneration and reduction of upper and lower motor neurons, leading to a gradual decrease in nerve control over muscles. Early symptoms typically include uneven muscle weakness in a single limb, painless muscle weakness, muscle spasms, and fatigue. This gradually progresses to impaired nerve innervation of all muscles, eventually resulting in limb weakness, difficulty speaking and swallowing, and respiratory failure. There is no cure for ALS; treatment focuses on relieving symptoms, slowing disease progression, and improving quality of life. Commonly used medications include riluzole and edaravone. Riluzole is currently the only approved drug to slow disease progression, but its effect is limited, only extending survival by a few months, and its mechanism of action is not fully understood. Edaravone is an antioxidant that can slow the progression of ALS to some extent, but its effectiveness varies considerably among individuals.

[0003] Currently, research on ALS is still in the exploratory stage. Several ALS-related gene mutations have been identified, including C9orf72, SOD1, TARDBP, and FUS. Misfolding of proteins such as SOD1 and TDP-43 is the prevailing pathogenic view, but no definitive conclusion has been reached. The complex pathological mechanisms of ALS pose a significant challenge to treatment. Its pathogenesis involves multiple intertwined pathways, such as protein misfolding, intracellular instability, mitochondrial dysfunction, and neuroinflammation. The interactions between these mechanisms mean that the therapeutic effect of a single target may be limited. Therefore, finding new therapeutic targets for ALS and developing new drugs based on them is crucial for overcoming this deadly neurodegenerative disease.

[0004] Patent document CN118576641A discloses a traditional Chinese medicine composition for treating amyotrophic lateral sclerosis (ALS), which is a compound of ginseng and cistanche. Ginseng has the effect of greatly replenishing vital energy, while cistanche has the effect of tonifying the kidney and replenishing essence. The combination of the two can improve ALS by supporting yang and relieving atrophy. However, the target and active ingredients of this traditional Chinese medicine composition are still unclear, which limits the modernization of traditional Chinese medicine and the development of new drugs. With the in-depth research on the active ingredients of traditional Chinese medicine, how to further explore their pharmacodynamic mechanisms and discover new mechanisms and targets has become the key to innovative traditional Chinese medicine research. Therefore, it is necessary to study the main target group of the above-mentioned traditional Chinese medicine composition and the potential active ingredients targeting key targets, so as to provide theoretical support for promoting the understanding of its molecular mechanism of improving ALS, the explanation of its pharmacodynamic material basis, and the specification of quality standards. Summary of the Invention

[0005] Based on the above-mentioned technological status, the purpose of this invention is to provide a magnetic chip for traditional Chinese medicine extracts, and to provide a method for using the chip to screen the target sites and active ingredients of traditional Chinese medicine extracts for the treatment of amyotrophic lateral sclerosis (ALS).

[0006] The present invention adopts the following technical solution: A magnetic chip containing a traditional Chinese medicine extract, wherein the extract is obtained from the following raw materials in parts by weight: ginseng 3-9 parts, cistanche deserticola 3-9 parts, and the magnetic chip is prepared by the following method: (1) Carboxylated Fe3O4 nanomagnetic beads were obtained by reacting ferric chloride hexahydrate, trisodium citrate dihydrate and sodium acetate trihydrate in an organic solvent. (2) The carboxylated Fe3O4 nanomagnetic beads are reacted with dimercaptosuccinic acid in an organic solvent to obtain mercaptolated Fe3O4 nanomagnetic beads; (3) The mercapto-modified Fe3O4 nanomagnetic beads were reacted with L-lysine triisocyanate, 4,4'-dihydroxybenzophenone and dimercaptosuccinic acid in the presence of organic solvent and initiator to obtain DHBP-grafted nanomagnetic beads in the dark. (4) Dissolve the Chinese herbal extract in an organic solvent and react it with the DHBP-grafted magnetic nanobeads under light to obtain a magnetic chip of the Chinese herbal extract.

[0007] Furthermore, the preparation method of the herbal extract includes the following steps: weighing ginseng and cistanche according to the specified weight proportions, decocting with water, filtering the aqueous extract, concentrating the filtrate to obtain an extract, and drying. Excipients can also be added to prepare granules, tablets, capsules, and other formulations.

[0008] The magnetic chip for Chinese herbal extracts constructed using this method has a high content of Chinese herbal extracts on the surface of magnetic particles. Infrared spectroscopy analysis shows that the Chinese herbal extract particles are bonded to the surface of magnetic particles rather than adsorbed on the surface, which can effectively enable target fishing.

[0009] Preferably, in step (1), the mass ratio of ferric chloride hexahydrate, trisodium citrate dihydrate, and sodium acetate trihydrate is (0.3-0.4):(0.15-0.25):(1.1-1.3).

[0010] Preferably, in step (1), the organic solvent is ethylene glycol.

[0011] Preferably, in step (1), the reaction temperature is 180-220℃ and the reaction time is 7-9h.

[0012] Preferably, in step (2), the mass ratio of carboxylated Fe3O4 nanomagnetic beads to dimercaptosuccinic acid is 1:(1-1.2).

[0013] Preferably, in step (2), the organic solvent is dimethyl sulfoxide.

[0014] Preferably, in step (2), the reaction temperature is 45-55℃ and the reaction time is 70-90min.

[0015] Preferably, in step (3), the mass ratio of L-lysine triisocyanate, 4,4'-dihydroxybenzophenone, and dimercaptosuccinic acid is (40-50):(40-50):1, and the mass ratio of dimercaptosuccinic acid to carboxylated Fe3O4 nanomagnetic beads is 1:(15-20).

[0016] Preferably, in step (3), the organic solvent is dimethyl sulfoxide.

[0017] Preferably, in step (3), the reaction temperature is 25-35℃ and the reaction time is 2-3h.

[0018] Preferably, in step (4), the mass ratio of the Chinese herbal extract to DHBP-grafted nanomagnetic beads is 1:(1.8-2.2).

[0019] Preferably, in step (4), the organic solvent is methanol.

[0020] Preferably, in step (4), the reaction is carried out under a nitrogen atmosphere for 0.8-1.2 h.

[0021] The specific preparation conditions vary depending on the drug being bonded to the nanomagnetic beads. Under the preferred conditions described above, this invention achieves optimal bonding effects on the traditional Chinese medicine extract.

[0022] This invention further provides a method for screening the therapeutic targets of traditional Chinese medicine extracts in the treatment of amyotrophic lateral sclerosis (ALS), comprising the following steps: (1) Total protein was extracted from the spinal cord, brainstem and cerebral cortex of ALS model animals as tissue samples; (2) Incubate tissue samples with DHBP-grafted magnetic nanobeads as described in any one of claims 1-6 to remove interference from non-specific proteins; (3) Add the magnetic chip hook of the traditional Chinese medicine extract according to any one of claims 1-6 to the tissue sample after removing non-specific proteins, and enrich the target proteins. (4) The target protein was identified by LC-MS / MS.

[0023] Further, in step (1), total protein was extracted from mouse spinal cord, brainstem and cerebral cortex using the Invent Minute™ Animal Cell / Tissue Total Protein Extraction Kit.

[0024] Furthermore, in step (2), the mass ratio of total protein to DHBP-grafted magnetic nanobeads in each tissue sample is (8-12):1.

[0025] Furthermore, in step (2), the incubation is carried out at 3-5°C for 12-18 minutes.

[0026] Furthermore, in step (3), the mass ratio of total protein to the magnetic chip of the Chinese herbal extract in each tissue sample is (4-6):1.

[0027] Furthermore, in step (4), the chromatographic conditions for LC-MS / MS are as follows: Chromatographic column: C18 reversed-phase column; Mobile phase A: 0.1% formic acid in water, Mobile phase B: 0.1% formic acid in acetonitrile; Elution gradient: 0-70 min, 2%-40% B; 70-75 min, 40%-95% B; 75-95 min, 95% B; The eluent was introduced into the mass spectrometer at a flow rate of 300 nL / min, with the following mass spectrometry parameters: resolution: 60000; maximum IT: 50 ms; scan spectrum: 350-2000 m / z; target value for false positive rate of peptide matching: 0.01; HCD collision energy: 35%.

[0028] The present invention further provides a method for screening active ingredients in traditional Chinese medicine compositions for treating amyotrophic lateral sclerosis, comprising the steps (1)-(4) above, and further comprising: (5) Construct plasmids for the target protein; (6) Express and purify the target protein in the protein expression system; (7) Construct an active compound library based on the components contained in the traditional Chinese medicine composition, and prepare solutions of each active compound; (8) The target protein is fixed on the surface of the CM5 sensor chip and bound and dissociated in the solutions of the above compounds. The equilibrium dissociation constant of each component is determined. The active ingredient for treating amyotrophic lateral sclerosis is the component with an equilibrium dissociation constant of less than 10 μM.

[0029] Further, in step (5), the target proteins are DDX17 (111-556) and SFPQ (276-535).

[0030] Further, in step (6), the protein expression system is E. coli BL21(DE3) competent cells.

[0031] Further, in step (7), the solvent for each active compound solution is 1×PBS-P buffer containing 5% (volume concentration) DMSO.

[0032] Furthermore, in step (8), the coupling value between the target protein and the CM5 sensor chip is above 13000RU, and the binding time and dissociation time are both 55-65s.

[0033] Using the above methods, this invention screened out the target sites of traditional Chinese medicine extracts in ALS model animals, and further screened out the active ingredients in traditional Chinese medicine extracts that act on ALS through key target proteins, providing a basis for achieving precise treatment with the traditional Chinese medicine extracts and formulating quality control standards.

[0034] This invention also provides the application of the screened active ingredient tubuloside A in the preparation of drugs that protect nerve cells.

[0035] Furthermore, the application is in the preparation of drugs that enhance nerve cell vitality.

[0036] Furthermore, the application is in the preparation of drugs that reduce the level of reactive oxygen species in nerve cells.

[0037] Furthermore, the application is in the preparation of drugs that inhibit the decrease in mitochondrial membrane potential within nerve cells. Attached Figure Description

[0038] Figure 1 The infrared spectrum of the SRKL chip prepared in Example 1; Figure 2 The silver staining results are from the experiment exploring and verifying the target hook fishing conditions in Example 3; Figure 3 The results of identifying target proteins hooked by the SRKL chip in the spinal cord, brainstem, and cerebral cortex in Example 3; Figure 4 For the analysis of the target proteome GO biological processes in Example 3; Figure 5 Functional analysis of GO molecules in the target proteome in Example 3; Figure 6 For the KEGG pathway analysis of the target proteome in Example 3; Figure 7 Cluster analysis of the target proteome in Example 3; Figure 8 The purification results of DDX1, DDX17, and SFPQ recombinant proteins in Example 4; Figure 9 The kinetic curves of the six compounds in Example 4 with DDX17 protein are shown. Figure 10 The kinetic curves of the three compounds in Example 4 with SFPQ protein are shown. Figure 11 The effect of the key active ingredient in Example 5 on H2O2-induced PC12 cell viability; Figure 12 The effect of the key active ingredient in Example 6 on the ROS level in H2O2-induced PC12 cells; Figure 13 The effect of the key active ingredient in Example 7 on the H2O2-induced mitochondrial membrane potential of PC12 cells. Detailed Implementation

[0039] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0040] Example 1: Preparation of Traditional Chinese Medicine Extracts Prescription: Ginseng 600g, Cistanche deserticola 600g Preparation method: Weigh out ginseng and cistanche according to the prescription, add water and decoct three times. Add 10 times the amount of water for the first decoction, and 8 times the amount of water for the second and third decoctions. Each decoction is 1.5 hours. Filter the solution and concentrate the filtrate under reduced pressure to obtain an extract with a relative density of 1.05 to 1.10 (60℃). Filter the extract and set it aside. Take the above extract and spray dry it using a spray dryer with an inlet air temperature of 175℃±5℃ and an outlet air temperature of 100℃±5℃. Collect the spray powder to obtain SRKL extract powder.

[0041] Example 2: Preparation of a magnetic chip containing traditional Chinese medicine extracts (1) Preparation of carboxylated Fe3O4 nanomagnetic beads (Fe3O4NPs) Dissolve 325 mg FeCl3•6H2O in 20 mL of ethylene glycol (EG) and stir at room temperature until completely dissolved, turning the solution a bright yellow. Add 200 mg C6H5Na3O7•2H2O and stir at room temperature for 3-4 h until completely dissolved. Add 1.2 g CH3COONa•3H2O (Na3Cit) and stir at room temperature until completely dissolved, turning the solution reddish-brown. Add the reaction solution to a stainless steel autoclave lined with tetrafluoroethylene and heat in an oven at 200 °C for 8 h. After cooling to room temperature, open the autoclave. Carefully discard the clear supernatant and add an appropriate amount of ethanol to transfer the black carboxylated Fe3O4 nanobeads from the bottom to a centrifuge tube. Use a strong magnet to hold the carboxylated Fe3O4 nanobeads, wash three times with anhydrous ethanol, and finally quantify to 3 mg / mL with anhydrous ethanol.

[0042] (2) Preparation of thiolized Fe3O4 nanomagnetic beads Take 15 mg of carboxylated Fe3O4 nanobeads into a 15 mL centrifuge tube, hold the carboxylated Fe3O4 nanobeads with a strong magnet, and wash three times with DMSO to completely replace the solvent. Add 2 mL of a DMSO solution containing 7.5 mg / mL meso-2,3-dimercaptosuccinic acid (DMSA), and react in a shaker at 200 rpm and 50 °C for 80 min. At this point, the solution is dark brown. The resulting mercapto compounds are washed three times with acetone using Fe3O4 nanobeads to completely replace the solvent.

[0043] (3) Preparation of DHBP-grafted magnetic nanobeads (DHBP-bound NPs) The mercaptolated Fe3O4 magnetic nanobeads were transferred to a three-necked flask using 50 mL of acetone and stirred in a 30 °C water bath at 200 rpm. 1 mL of a 42 mg / mL L-lysine diisocyanate (LTI) solution was added and stirred for 2 min. Then, 42 mg of 4,4'-dihydroxybenzophenone (DHBP) was added, followed by a few drops of 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU). The solution turned gray at this point. After reacting in the dark for 10 min, 0.9 mg of DMSA was added and reacted in the dark for 2 h to obtain DHBP-grafted magnetic nanobeads (DHBP-bound NPs). The DHBP-bound NPs were transferred to centrifuge tubes, washed three times with methanol, and quantified with methanol to a concentration of 0.5 mg / mL.

[0044] (4) Preparation of magnetic chips (SRKL chips) of traditional Chinese medicine extracts Weigh 5 mg of SRKL extract powder from Example 1 and dissolve it in 1 mL of methanol. Mix the solution with 20 mL of DHBP-bound NPs and transfer the mixture to a quartz photoreactor. While magnetically stirring, purge with nitrogen for 15 min to remove oxygen from the system. Place the quartz photoreactor in a photocuring machine and react with ultraviolet light for 1 h while magnetically stirring, allowing small molecules in SRKL to bond onto the solid-phase support DHBP-bound NPs, forming a magnetic chip of the traditional Chinese medicine extract (SRKL chip). After the reaction, transfer the magnetic chip to a 50 mL centrifuge tube. Use a magnet to attract the bottom of the centrifuge tube, wash three times with methanol to remove unreacted small molecules, and finally disperse the SRKL chip in 5 mL of methanol.

[0045] The dried SRKL chip was ground into a fine powder using an agate mortar and pestle. 2 mg of SRKL chip was evenly spread on the sample cell of a Fourier transform infrared spectrometer (FT-IR Spectrometer) and scanned in the frequency range of 400-4000 cm−1 to detect the functional groups on the surface of the SRKL chip.

[0046] Experimental results are as follows Figure 1 As shown, the SRKL extract powder and SRKL chip of Example 1 have similar infrared spectral characteristics, indicating that SRKL is bonded to the surface of DHBP-bound NPs, forming SRKL cross-linked nanoparticles, i.e., SRKL chips. For example, the infrared spectrum of the SRKL chip is significantly different from that of DHBP-bound NPs at 3359 cm⁻¹. -1 1263 cm -1 797 cm -1 761 cm -1 A stronger absorption peak is observed at 925 cm⁻¹, indicating that more hydroxyl groups are bonded to the surface of the SRKL chip; at 925 cm⁻¹... -1 The presence of a stronger absorption peak at 1602 cm⁻¹ indicates that more double bond structures are bonded to the surface of the SRKL chip. -1 1410 cm -1 1028 cm -1 The presence of a stronger absorption peak at 3359 cm⁻¹ indicates that more amine and amide structures are bonded to the surface of the SRKL chip. -1 1410 cm -1 925cm -1 The presence of a stronger absorption peak indicates that more carboxylic acid functional groups are bonded to the surface of the SRKL chip. In conclusion, the SRKL chip has been successfully constructed.

[0047] Example 3: Target hook fishing based on SRKL chip (1) Obtaining tissue samples from target hook fishing Three male ALS SOD1G93A mice were selected as experimental animals. The mice were anesthetized with isoflurane and fixed to a control table. The skin and ribs of the chest cavity were cut open to expose the heart and liver. An injection needle was inserted into the left ventricle of the mouse, and the right atrial appendage was cut open to allow blood to flow out. Physiological saline was infused until the mouse's limbs, liver, and tongue turned white. The cerebral cortex, brainstem, and spinal cord of the model mice were then harvested.

[0048] Total protein was extracted from mouse spinal cord, brainstem, and cerebral cortex using the Invent Minute™ Animal Cell / Tissue Total Protein Extraction Kit. The specific procedure was as follows: 15-20 mg of tissue was placed on a centrifuge column, and the tissue was repeatedly ground by pressing down and twisting with a plastic grinding stick 50-60 times. 200 μL of natural cell lysis buffer (SN-002) was added, and the tissue was ground again 30-60 times. The mixture was incubated on ice for 5 min, then centrifuged at 14000-16000 g for 1-2 min at 4 ℃. The centrifuge column was discarded, and the supernatant was collected as the extracted natural total protein.

[0049] Total natural protein concentration was determined using the BCA quantification method: 20 μL of 2 mg / mL BSA standard protein solution was added to 60 μL of PBS solution and mixed well, then diluted to 0.5 mg / mL. Subsequently, 20 μL, 18 μL, 16 μL, 12 μL, 8 μL, 4 μL, and 0 μL of PBS were added sequentially to different wells of a 96-well plate, followed by 0 μL, 2 μL, 4 μL, 8 μL, 12 μL, 16 μL, and 20 μL of 0.5 mg / mL BSA standard protein solution. 18 μL of PBS was added to the remaining wells of the 96-well plate, followed by 2 μL of protein supernatant. Solutions A and B from the BCA kit were mixed at a ratio of 50:1, and 200 μL of the mixture was added to each well. The plate was then incubated at 37 °C for 30 min. The absorbance of the solution at 570 nm was measured using an ELISA reader, and the protein concentration of each sample was calculated based on the standard curve of the BSA standard protein solution.

[0050] (2) Target fishing a. Exploration and verification of target hook fishing conditions The experiment included a blank control group, a binding group, and a competition group, with three replicates in each group. Protein solutions from the mouse spinal cord, brainstem, and cerebral cortex were adjusted to the same concentration using PBS, with each sample containing 0.25 mg of total protein. First, 50 μL of 0.5 mg / mL unbound DHBP-bound NPs was added to each of the three groups for pretreatment, followed by incubation at 4 °C for 15 min to remove interference from non-specific proteins. Then, the pretreated total protein solution was transferred to new centrifuge tubes. The blank control group received 100 μL of 0.5 mg / mL DHBP-bound NPs, while the binding and competition groups each received 100 μL of 0.5 mg / mL SRKL chips. The competition group used 100 μL of the drug solution from Example 1 (10 mg / mL) to competitively bind the target protein, while the binding group received the same volume of water. All samples were then incubated at 4 °C for 4 h to perform target targeting. After the initial electrophoresis, the protein solution was discarded. The SRKL chip was washed three times with PBS solution containing 1% SDS (sodium dodecyl sulfate). 100 μL of PBS solution containing 0.1% SDS and 20 μL of 6× loading buffer were added, and the mixture was thoroughly mixed by pipetting and heated at 98 °C for 10 min. The gel was then placed in an electrophoresis tank and filled with electrophoresis buffer. After removing the comb, 10 μL of sample was pipetted into each well. Electrophoresis was performed at 90 V. When sample separation began, the voltage was increased to 140 V, and electrophoresis was stopped when bromophenol blue in the sample reached the bottom of the separating gel. The separating gel portion was cut off and stained with silver using a Beyotime silver staining kit. The enriched products in each group were visualized to evaluate the target electrophoresis effect of the SRKL chip.

[0051] result( Figure 2 The results showed that the protein solution pretreated with DHBP-bound NPs no longer bound to the DHBP-bound NPs in the blank group, indicating that the pretreatment effectively solved the problem of non-specific adsorption of the magnetic nanobeads themselves. Compared with the blank group, the SRKL chip in the binding group was able to bind to some proteins. Based on the fundamental theory of target hooking, that is, the SRKL chip and the drug SRKL have the same target, SRKL can compete with the SRKL chip for binding to specific protein targets. In the competition group, the number of proteins bound to the SRKL chip decreased, which was shown in the gel results as the disappearance of some bands in the competition group compared with the binding group. These proteins may be specific targets for SRKL to directly bind and exert its drug effect, and high-resolution mass spectrometry is needed to identify protein information.

[0052] b. Formal target fishing The formal target hook fishing experiment conditions were the same as above. After the hook fishing was completed, the protein solution was discarded. The SRKL chips of the binding group and the competition group were washed three times with PBS solution containing 0.1% SDS, and then digested with Trypsin at 37 °C for 16 h. Subsequently, the binding group and the competition group were labeled with isotopes using light and heavy formaldehyde, respectively.

[0053] (3) Identification of target proteins based on high-resolution mass spectrometry (LC-MS / MS) The binding and competition group samples were mixed with equal volumes of light and heavy formaldehyde, respectively. After desalting, the mixtures were loaded onto a capture column packed with 5 μm C18 reversed-phase material. Chromatographic separation of the peptides was performed using a C18 reversed-phase column (75 μm × 10 cm, 3 μm particle size). The gradient elution program was as follows: 0–70 min, 2%–40% B; 70–75 min, 40%–95% B; 75–95 min, 95% B (solvent A: 0.1% formic acid aqueous solution, solvent B: 0.1% formic acid acetonitrile). The eluent was introduced into the mass spectrometer at a flow rate of 300 nL / min. The mass spectrometry parameters were as follows: resolution, 60,000; maximum IT (ms), 50; scan spectrum (m / z), 350–2000; false positive rate (FDR) target value for peptide matching (PSMs), 0.01; HCD collision energy (%): 35.

[0054] (4) Target identification Mass spectrometry results from the spinal cord, brainstem, and cerebral cortex samples detected 264, 713, and 317 proteins, respectively. Among them, 30, 22, and 13 proteins, respectively, showed higher mass spectrometric intensities in the binding group than in the competing group. Figure 3 These proteins, showing statistically significant differences, are considered potential targets for SRKL in treating ALS. Further analysis of these potential targets revealed that DDX1, MBP, and MAP6 proteins appeared repeatedly in all three datasets, while 12 other proteins appeared twice across all three datasets. These proteins may play an important role in the treatment of ALS with SRKL.

[0055] (5) Target swarm network analysis To investigate signaling pathways associated with potential SRKL target proteins, GO biological processes analysis was performed on the genes corresponding to these target proteins. The top ten pathways with the highest strength were selected and presented in the results. Figure 4The analysis results showed that the potential target proteins are related to biological functions such as mitochondrial ATP / ADP transport, messenger ribonucleoprotein complex transport, mitophagy, mitochondrial permeability regulation in the apoptosis signaling pathway, and microtubule polymerization. This suggests that SRKL may control the progression of ALS by regulating energy metabolism, microtubule polymerization, and autophagy through target proteins.

[0056] GO molecular function analysis was performed on the genes corresponding to potential target proteins, and the top ten pathways with the highest strength were selected and displayed. Figure 5 The analysis results showed that the pathways most significantly related to the potential target proteins were molecular functions such as adenine transport, ATP / ADP transport, oxidative phosphorylation, myelin components, ion transport, and microtubule structure. This indicates that SRKL mainly affects cellular energy metabolism and cellular transport through target proteins, thereby exerting a therapeutic effect on the progression of ALS.

[0057] In addition, KEGG pathway analysis was performed on the genes corresponding to potential target proteins, and the top ten pathways with the highest overlap with pathway proteins were selected and displayed. Figure 6 The analysis results show that the potential target proteins are associated with numerous neurodegenerative diseases and brain diseases, including ALS, which is the focus of this study. The proteins retrieved by the target hook, TUBB1B, TUBB2B, TUBB3, TUBB4B, TUBB4A, HNRNPA3, SC25A5, and SC25A4, are all related to ALS, demonstrating the reliability of the target hook results.

[0058] Finally, cluster analysis was performed on the genes corresponding to potential target proteins. Figure 7 The results showed that among the 48 significantly differentially expressed proteins, after removing proteins that were not correlated with other proteins, 37 proteins were divided into four categories, which were associated with the following four aspects: activation of AMPK downstream of NMDAR (energy metabolism pathway); mRNA processing and CRD-mediated mRNA stabilization complex; mitochondrial ATP transport; axonal growth inhibition, oligodendrocyte specialization and differentiation.

[0059] In summary, through GO analysis, KEGG analysis, and cluster analysis of the target protein, it was found that SRKL exerts its therapeutic effect on ALS by acting on the target protein, mainly affecting energy metabolism and mRNA processing.

[0060] Example 4: Screening of SRKL active ingredient groups based on key targets 1. Selection of SRKL target proteins Based on network analysis of the SRKL target group and literature review, we selected DDX1 and DDX17 proteins for screening SRKL active ingredients. DEAD-box (DDX) family proteins are highly conserved and numerous RNA helicases that mainly participate in the transcriptional regulation of host cell genes, playing a crucial role in the development of various diseases. DDX1 protein can regulate the transcriptional expression of X-box binding protein 1, affecting the clearance of misfolded proteins within cells, thereby influencing the development of neurodegenerative diseases. DDX17 protein is a novel regulator of the DNA damage response pathway; its upregulation can repair DNA damage caused by FUS protein mutations in ALS, thereby alleviating ALS. Therefore, these two proteins were selected as the main targets for screening SRKL active compounds.

[0061] In addition, a protein hooked out of the spinal cord was selected: proline- and glutamine-rich splicing factor (SFPQ), also known as polypyrimidine bundle-binding protein-associated splicing factor, is a multifunctional RNA and DNA-binding protein that can induce liquid-liquid phase separation and form biomolecular condensates. In ALS, the reduced phase separation potential of SFPQ may interfere with RNA metabolism and cellular function. Studies have shown that SFPQ and TDP-43 both function in the cell nucleus under normal conditions, but their mislocalization in ALS may jointly lead to RNA metabolic disorders and neuronal damage. Given the central role of SFPQ in ALS pathology, it is considered a potential therapeutic target; therefore, we also purified its protein in vitro and screened for SRKL-active compounds.

[0062] 2. Plasmid construction of target proteins Single colonies of DDX1 and DDX17 genes were obtained from a cDNA library at the School of Life Sciences, Peking University. Single colonies were picked and cultured in 10 mL of ampicillin-resistant LB broth at 37 °C and 200 rpm for 12 h. Plasmids containing the DDX1 and DDX17 genes were then extracted using the TransGen plasmid miniprep kit. Primers for DDX1-His, DDX17(80-729)-His, DDX17(111-556)-His, and the pQLink-Hx vector were designed. 25 μL of KOD One™ PCR Master Mix, 2 μL of 50 ng / μL DDX1 / DDX17(80-729) / DDX17(111-556) / pQLink-Hx plasmid, 1.5 μL of forward / reverse primers (10 μM), and 20 μL of RNase-free water were added to PCR tubes. After mixing thoroughly, PCR amplification was performed according to the procedure in Table 2. The target gene primers for DDX1, DDX17, and pQLink-Hx are shown in Table 1.

[0063]

[0064]

[0065] Prepare a 1% agarose gel, aspirate the PCR amplification product, and add it to the sample wells of the gel. Incubate at 120 V for 30 min until the DNA markers are completely separated. Then, place the gel under UV light and cut the gel containing the target band into a 1.5 mL centrifuge tube. Extract linear DNA using a biogel extraction kit. Detect the concentration of linear DNA using a Q3000 UV spectrometer.

[0066] Add 5 μL of 2× Basic Assembly Mix to a PCR tube, then add the linear DNA fragments of DDX1 / DDX17(80-729) / DDX17(111-556) and pQLink-Hx in a molar ratio of 1:2. Finally, add RNase-free H2O to a final volume of 10 μL, mix thoroughly by pipetting, and heat in a PCR instrument at 50 °C for 15 min. After cooling on ice, add all the recombinant product to 100 μL of Trans1-T1 competent cells and gently mix. Incubate the cells on ice for 30 min, then heat at 42 °C for 30 s, and immediately incubate on ice for 2 min. Add 450 μL of LB medium to the cells and rehydrate by shaking on a shaker at 37 °C and 200 rpm for 1 h. Subsequently, prepare LB agar plates containing ampicillin-resistant culture medium, aspirate the rehydrated bacterial culture, add it to the plates, and spread the culture with a bacterial inoculation loop. Invert the plates and incubate them in a 37°C multi-purpose microbial incubator until single colonies are visible to the naked eye.

[0067] Add 100 μg / mL of ampicillin to LB liquid medium, pick a single colony from an LB solid medium plate and add it to 500 μL of LB liquid medium. Amplify the culture by shaking on a shaker at 37 ℃ and 200 rpm for 8 h, and then take 100 μL of the bacterial solution for DNA sequencing verification.

[0068] Prepare 20 mL of LB liquid medium containing 100 μg / mL ampicillin resistance, add 400 μL of bacterial culture containing the target recombinant plasmid, and amplify overnight by shaking on a shaker at 37 ℃ and 200 rpm. Centrifuge the bacterial culture at 4000 rpm for 20 min, discard the supernatant and collect the bacterial cells. Extract the plasmid using the TransGen plasmid mini-prep kit, and detect the plasmid concentration using a Q3000 UV spectrometer.

[0069] The complete gene sequence of the SFPQ protein was obtained from the Uniprot database (https: / / www.uniprot.org / ). Based on the crystal structure information reported in the literature (PDB ID: 6WMZ, 6NCQ), two truncated versions of the SFPQ protein with well-defined domains were designed and constructed: SFPQ(214-598) and SFPQ(276-535). Primers were designed and synthesized according to the coding sequence of the target gene SFPQ, and the full-length SFPQ fragment was amplified from a human cDNA library by PCR.

[0070] SFPQ(214-598)-F: ATTTTCAGGGATCCGGCGGGCCGAAGCCAG SFPQ(214-598)-R: GCCTGTACAGAATTCCTAGCTGTAACTTTC SFPQ(276-535)-F: TATTTTCAGGGATCCGAGGGGTTTAAAGCC SFPQ(276-535)-R: GCCTGTACAGAATTCCTACAAAAGATTTGC The amplification products were subjected to agarose gel electrophoresis, and the target band was recovered and purified. Simultaneously, the pLinkHx prokaryotic expression vector was linearized by double digestion with the appropriate restriction endonuclease, and the linearized vector was also purified by gel electrophoresis. Subsequently, the purified SFPQ PCR product was ligated to the linearized vector using a homologous recombinase at 50°C. The ligation product was transformed into DH5α competent cells, plated on LB agar plates containing the appropriate antibiotics, and incubated overnight at 37°C. The next day, single colonies were picked for preliminary screening using colony PCR. Positive clones were expanded and cultured, and plasmids were extracted. The correctness of the inserted fragment was verified by double enzyme digestion and sequencing to ensure that the SFPQ plasmid sequence was accurate and free of frameshift mutations.

[0071] 3. Expression and purification of target proteins Take 100 μL of E. coli BL21(DE3) competent cells and thaw them on ice. Add 2 μL of pQLink-His-DDX1, pQLink-His-DDX17 (80-729), pQLink-His-DDX17 (111-556), pQLink-His-SFPQ (276-535), and pQLink-His-SFPQ (214-598) plasmids respectively. Gently tap the centrifuge tube to mix, and place it on ice for 30 min. Heat shock at 42 ℃ for 90 s, and then immediately place it on ice for 2 min. Add 500 μL of antibiotic-free LB liquid medium to the centrifuge tube and revive the cells on a shaker at 37 ℃ and 220 rpm for 1 h. Spread the revive bacterial culture on LB solid medium plates containing ampicillin (100 μg / mL). The plates were inverted and placed in a 37 °C multi-purpose microbial incubator, and cultured until single colonies were visible to the naked eye. Single colonies were picked and cultured in 1 L of LB broth containing ampicillin (100 μg / mL) for 12 h on a shaker at 37 °C and 220 rpm. IPTG was added to a final concentration of 0.5 mM, and the culture was induced for 16 h on a shaker at 16 °C and 200 rpm / min to express the three proteins.

[0072] Configure the purified protein buffer. Ni-binding buffer: 50 mM Tris; 250 mM KCl; 5 mM β-ME, pH=8.0. Ni-elution buffer: 50 mM Tris; 250 mM KCl; 5 mM β-ME, 500mM IMA, pH=8.0.

[0073] Collect the induced bacterial culture and centrifuge at 4000 rpm for 10 min, discard the supernatant, and collect the bacterial cells. Resuspend the bacterial cells in 40 mL of Ni-binding buffer, add 1 mM PMSF and 100 μg / mL RNase A enzyme, mix well by pipetting, and place in an ice-water bath. Sonicate at 400 W for 25 min (2 s sonication, 3 s pause) until the liquid is clear and uniformly brown. Then centrifuge the liquid at 15000 rpm for 1 h at 4 °C and collect the supernatant in a new 50 mL centrifuge tube. Add 500 μL of Ni-NTA packing material equilibrated with Ni-binding buffer to the supernatant, incubate at 4 °C with inversion for 1 h, pour the supernatant into a gravity column, and collect the Ni-NTA packing material on the gravity column. Prepare Ni-wash buffers with final IMA concentrations of 20 mM and 40 mM using Ni-binding buffer and Ni-elution buffer, respectively. Rinse the Ni-NTA packing material with 20 mL of each buffer to remove impurity proteins. Finally, add Ni-elution buffer to elute the target protein. Start collecting the liquid when the flowing liquid turns Coomassie Brilliant Blue staining solution blue, and stop collecting the liquid when the flowing liquid no longer turns Coomassie Brilliant Blue staining solution blue.

[0074] The collected eluent was concentrated using an ultrafiltration tube, centrifuged at 4000 rpm at 4 °C, and the eluent was replaced with PBS. This process was repeated three times. Finally, the protein was concentrated by centrifugation, and the protein concentration was detected using a Q3000 UV spectrometer. The aliquoted protein samples were flash-frozen in liquid nitrogen and stored at -80 °C. E. coli cells and the supernatant obtained after centrifugation were collected, along with the flow-through buffer and eluents from Ni-NTA column purification, Ni-binding buffer, Ni-wash buffer, and Ni-elution buffer. 50 μL of each of these samples was added, mixed thoroughly by pipetting, and heated at 98 °C for 10 min. SDS-PAGE gel separation followed the same procedure, and the separating gel was stained with Coomassie stain using an eStain L1 protein staining system.

[0075] The AKTA protein purification system, combined with a Superdex 200 10 / 300 GL molecular sieve, was used for fine purification of the protein. The protein solution to be purified was concentrated to 1 mL using an ultrafiltration tube and centrifuged at 12000 rpm and 4 °C for 20 min. The concentrated protein solution was collected for later use. Pump B was equilibrated with ultrapure water filtered through a 0.22 μm membrane, while pump A was equilibrated with Ni-binding buffer. With pump A running, the centrifuged protein solution was loaded into the molecular sieve at a flow rate of 0.4 mL / min for separation and purification. The protein elution curve was monitored in real time using a UV detector, and the eluent corresponding to the main peak was collected. The collected eluent was concentrated to an appropriate volume using a 30 kDa ultrafiltration tube. The protein molecular weight and purity were observed by SDS-PAGE and Coomassie Brilliant Blue staining, following the same procedure. The protein was aliquoted and stored at -80 °C for later use.

[0076] like Figure 8 As shown, this study successfully expressed five recombinant proteins—DDX1, DDX17 (80-729), DDX17 (111-556), SFPQ (214-598), and SFPQ (276-535)—in a prokaryotic expression system. Among them, DDX1-His, DDX17 (80-729), and SFPQ (214-598) proteins were effectively expressed in the prokaryotic system, but significant protein degradation occurred during subsequent molecular sieve chromatography purification. In contrast, DDX17 (111-556) and SFPQ (276-535) proteins not only showed stable expression in the prokaryotic system, but also yielded high-purity protein products after molecular sieve purification, with SDS-PAGE analysis showing a purity exceeding 90%. This result indicates that DDX17 (111-556) and SFPQ (276-535) exhibit better stability under experimental conditions and are more suitable for subsequent functional studies.

[0077] 4. Reverse screening of SRKL active compounds using surface plasmon resonance technology (1) Construction of the SRKL active compound library Based on the content and types of components in the traditional Chinese medicines ginseng and cistanche, we selected 29 representative compounds to form the SRKL compound library for subsequent identification of active substances based on their action targets. Detailed information on the compound library is shown in Table 3.

[0078]

[0079] (2) Reverse screening of active compounds The CM5 sensor chip surface was activated for 1200 s using a mixed solution of EDC / NHS (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide / N-hydroxysuccinimide) (0.4 M EDC / 0.1 M NHS). DDX17 (111-556)-His and SFPQ (276-535) proteins were dissolved in acetate buffer at pH 4.5 and immobilized on the chip surface via amino coupling. The final coupling values ​​for both proteins exceeded 13000 RU, meeting experimental requirements. Each compound was prepared into a 20 mM solution with DMSO, diluted to 200 μM (containing 5% DMSO) with 1×PBS-P buffer and DMSO, and serially diluted using PBS-P buffer containing 5% DMSO to obtain 10 concentration gradients (including a 0 concentration control). Binding and dissociation times were set to 60 s and 60 s, respectively, with a flow rate of 30 μL / min. To eliminate the solvent effect, solvent correction was performed using PBS-P solutions containing 4.5% and 5.8% DMSO, and the equilibrium dissociation constants and binding kinetics of each compound for the two proteins were determined.

[0080] Experimental results show that, through screening of the SRKL compound library, nine compounds were found to have strong binding affinity to DDX17(111-556) protein, and their equilibrium dissociation constants (KD values) were all below 30 μM (Table 4).

[0081]

[0082] Further analysis revealed that the top six compounds (echinacoside, 2-acetylverascoside, verbascoside, ginsenoside Rb1, ginsenoside Rg2, and tubuloside A) and the DDX17(111-556) protein all had KD values ​​below 10 μM, indicating that these components may have higher bioactivity potential. Their kinetic curves are shown in... Figure 9 Molecular interaction characterization analysis revealed that the binding of echinacoside, the active ingredient derived from Cistanche deserticola, to the DDX17(80-729) protein exhibited a typical "slow binding-difficult dissociation" kinetic profile. SPR analysis showed that this compound displayed a low binding rate constant (ka = 4.89 × 10⁻² M). -1 s -1 ) and an extremely small dissociation rate constant (kd = 1.97 × 10⁻⁴ M -1 s -1The extremely low equilibrium dissociation constant (KD = 0.4 nM) further confirms that the complex formed by the two has an exceptionally stable binding conformation. Pharmacological studies have shown that echinacoside contains 1.2-3.5% (w / w) of Cistanche deserticola, making it one of its most abundant phenylethanoid glycosides. This high content, combined with its excellent protein-binding properties, suggests that echinacoside is likely a key pharmacodynamic substance for SRKL in treating ALS, exerting its therapeutic effect by specifically regulating the function of the DDX17 protein.

[0083] Experimental results with SFPQ(276-535) protein showed that all nine compounds in SRKL exhibited strong binding affinity to SFPQ(276-535) protein, and their equilibrium dissociation constants (KD values) were all below 25 μM (Table 5).

[0084]

[0085] Further analysis revealed that the top three compounds (tubule-derived glycoside A, echinacoside, and R-ginsenoside Rg3) and the SFPQ (276-535) protein all had KD values ​​below 10 μM, indicating that these components may possess higher bioactivity potential. Their kinetic curves are shown in... Figure 10 .

[0086] In summary, echinacoside, 2-acetylverascoside, verbascoside, ginsenoside Rb1, ginsenoside Rg2, and tubuloside A, among other active ingredients, exhibit strong binding affinity to the DDX17 (111-556) protein, while tubuloside A, echinacoside, and R-ginsenoside Rg3 primarily bind to the SFPQ (276-535) protein to exert their effects. This suggests that echinacoside and tubuloside A have good binding activity to both proteins and may be key active ingredients of SRKL.

[0087] Example 5: Effect of active ingredients on cell viability in an oxidative stress model 1. Establishment of a H2O2-induced oxidative stress model in PC12 cells PC12 cells in the logarithmic growth phase were digested with 0.25% trypsin, resuspended in high-glucose DMEM medium containing 10% fetal bovine serum, and seeded into 96-well and 24-well plates at densities of 10,000 cells / well and 60,000 cells / well, respectively. The plates were incubated at 37 ℃ in a 5% CO2 incubator until the cells were fully adherent.

[0088] The experiment consisted of a control group, a model group, and groups treated with different drugs. After cell adhesion for 24 h, the old culture medium was discarded. Each drug treatment group was pretreated with complete culture medium containing different test drugs, with a monomeric small molecule drug concentration of 20 μM and a total effective fraction drug concentration of 60 μg / mL. Simultaneously, the control and model groups received equal volumes of solvent as a control. After 16 h of pretreatment, all groups except the control group were replaced with fresh complete culture medium containing 800 μM H2O2 and cultured for another 8 h to establish a PC12 cell oxidative stress injury model.

[0089] 2. MTT assay for cell viability The protective effect of pre-drug administration against H2O2-induced PC12 cell damage was assessed using the MTT assay. After modeling, the culture medium in the 96-well plates was replaced with serum-free medium containing 0.5 mg / mL MTT solution, and the plates were incubated in the dark for 4 h. The supernatant was carefully aspirated, and 100 μL of DMSO was added to each well. The plates were then shaken at low speed for 10 min to fully dissolve the purple crystals. The optical density of each well was measured at 570 nm using a microplate reader. Cell viability was calculated using the following formula: Cell viability (%) = (OD value of experimental group / OD value of control group) × 100%. The protective effect of pre-drug administration against oxidative damage in PC12 cells was evaluated by comparing the cell viability of each group.

[0090] 3. Experimental Results Experimental results showed that, compared with the control group, the cell viability of the model group cells decreased to below 60% after treatment with 800 μM H2O2 for 8 h, indicating that the oxidative stress injury model was successfully constructed. Pretreatment with SRKL monomers at a concentration of 20 μM significantly improved cell viability compared with the model group. Figure 11 ).

[0091] Example 6: Effect of active ingredients on intracellular reactive oxygen species (ROS) levels in an oxidative stress model Using the oxidative stress model cells from Example 5, intracellular ROS levels were detected using the DCFH-DA fluorescent probe method. After modeling, the culture medium in the 24-well plates was aspirated, and the cells were gently washed twice with pre-warmed PBS. The DCFH-DA probe was diluted 1:1000 with serum-free medium to a final concentration of 10 μM. 1 mL of the diluted DCFH-DA working solution was added to each well, and the cells were incubated at 37 °C in the dark for 30 min. After incubation, the culture medium was aspirated, and Hoechst 33342 staining solution (final concentration 10 μg / mL) was added. The cells were then incubated at 37 °C in the dark for 10 min. The cells were then washed three times with PBS to thoroughly remove any unextracted dye and probe. The culture plates were immediately observed and images were acquired under a fluorescence microscope at an excitation wavelength of 488 nm and an emission wavelength of 525 nm. The experimental results are expressed as mean fluorescence intensity, reflecting intracellular ROS levels.

[0092] The results showed that, compared with the control group, the model group cells exhibited strong green fluorescence after treatment with 800 μM H2O2 for 8 h, and the average fluorescence intensity of the cells was significantly increased, indicating that oxidative stress led to the accumulation of a large amount of ROS, and the model was successfully established. Compared with the model group, treatment with 20 μM of each active monomer could reduce the intensity of green fluorescence to varying degrees, suggesting that it can effectively remove excess ROS in cells. Figure 12 A). Further quantitative analysis was performed using image analysis software to calculate the mean fluorescence intensity of cells. The results showed that the intracellular ROS levels were significantly reduced after intervention with each active monomer. Notably, compared with the positive control drug riluzole, all the detected monomers exhibited stronger ROS scavenging capabilities. Among them, tubuloside A, verbascoside, and 2-acetylverascoside showed particularly prominent effects, resulting in the lowest mean fluorescence intensity of cells treated with them (A). Figure 12 B) indicates that the three have the most significant effect in reducing intracellular ROS levels.

[0093] Example 7: Effect of the active ingredient on mitochondrial membrane potential in oxidative stress model cells Using the oxidative stress model cells from Example 5, changes in mitochondrial membrane potential were detected using the JC-1 fluorescent probe. The JC-1 staining working solution was prepared according to the Beyotime Mitochondrial Membrane Potential Detection Kit instructions. Cell culture medium was discarded, and 1 mL of cell culture medium was added, followed by 1 mL of JC-1 staining working solution, which was then thoroughly mixed. The culture plate was incubated at 37 °C in the dark for 20 min. After incubation, the supernatant was discarded, and the cells were washed twice with PBS to remove unbound fluorescent dye. After adding 2 mL of cell culture medium, the cells were immediately observed and photographed under a fluorescence microscope. JC-1 exists in aggregate form in mitochondria with normal membrane potential, emitting red fluorescence; when cell apoptosis or damage leads to a decrease in mitochondrial membrane potential, JC-1 exists in monomer form in the cytoplasm, emitting green fluorescence. The degree of mitochondrial membrane potential depolarization was assessed by calculating the green / red fluorescence ratio.

[0094] Fluorescence micrographs ( Figure 13 A) showed that the blank group cells were dominated by red fluorescence with weak green fluorescence and a low green / red fluorescence ratio, indicating that the mitochondrial membrane potential was in a normal physiological state. In contrast, after treatment with 800 μM H2O2 for 8 h, the model group cells showed a significant increase in green fluorescence intensity, a significant decrease in red fluorescence intensity, and a significantly higher green / red fluorescence ratio than the blank group. This confirmed that H2O2 successfully induced mitochondrial membrane potential depolarization in PC12 cells, and the model was successfully established. After pre-treatment with 20 μM of each active monomer, the intracellular fluorescence characteristics changed to varying degrees. ImageJ image analysis software was used to quantitatively analyze the red and green fluorescence intensities in at least three fields of view for each group, and the green / red fluorescence ratio was calculated to reflect the relative level of mitochondrial membrane potential. The results showed ( Figure 13 (B) Compared with the model group, the green / red fluorescence ratio of most active monomer treatment groups showed a decreasing trend, indicating that they could improve the depolarization state of mitochondrial membrane potential to a certain extent. Among them, the improvement effect of the tubuloside A intervention group was the most prominent, with its green / red fluorescence ratio significantly lower than that of the model group, suggesting that tubuloside A can effectively inhibit the decrease in mitochondrial membrane potential induced by H2O2 and has a significant mitochondrial protective effect.

[0095] As can be seen from Examples 5-7, tubuloside A has a protective effect on the oxidative stress neuronal model in multiple aspects.

[0096] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions or improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A magnetic chip for extracting traditional Chinese medicine, characterized in that, The herbal extract is obtained from the following raw materials in parts by weight: ginseng 3-9 parts, cistanche deserticola 3-9 parts. The magnetic chip is prepared by the following method: (1) Carboxylated Fe3O4 nanomagnetic beads were obtained by reacting ferric chloride hexahydrate, trisodium citrate dihydrate and sodium acetate trihydrate in an organic solvent. (2) The carboxylated Fe3O4 nanomagnetic beads are reacted with dimercaptosuccinic acid in an organic solvent to obtain mercaptolated Fe3O4 nanomagnetic beads; (3) The mercapto-modified Fe3O4 nanomagnetic beads were reacted with L-lysine triisocyanate, 4,4'-dihydroxybenzophenone and dimercaptosuccinic acid in the presence of organic solvent and initiator to obtain DHBP-grafted nanomagnetic beads in the dark. (4) Dissolve the Chinese herbal extract in an organic solvent and react it with the DHBP-grafted magnetic nanobeads under light to obtain a magnetic chip of the Chinese herbal extract.

2. The magnetic chip for traditional Chinese medicine extracts according to claim 1, characterized in that, The preparation method of the herbal extract includes the following steps: weigh ginseng and cistanche according to the weight proportions, add water and decoct, filter the water extract, concentrate the filtrate to extract, and dry.

3. The magnetic chip for traditional Chinese medicine extracts according to claim 1 or 2, characterized in that, In step (1): The mass ratio of ferric chloride hexahydrate, trisodium citrate dihydrate, and sodium acetate trihydrate is (0.3-0.4):(0.15-0.25):(1.1-1.3); and / or: The organic solvent is ethylene glycol; and / or: The reaction temperature is 180-220℃, and the reaction time is 7-9 hours.

4. The magnetic chip for traditional Chinese medicine extracts according to claim 1 or 2, characterized in that, In step (2): The mass ratio of carboxylated Fe3O4 nanobeads to dimercaptosuccinic acid is 1:(1-1.2); and / or: The organic solvent is dimethyl sulfoxide; and / or: The reaction temperature is 45-55℃, and the reaction time is 70-90 min.

5. The magnetic chip for traditional Chinese medicine extracts according to claim 1 or 2, characterized in that, In step (3): The mass ratio of L-lysine triisocyanate, 4,4'-dihydroxybenzophenone, and dimercaptosuccinic acid is (40-50):(40-50):1, and the mass ratio of dimercaptosuccinic acid to carboxylated Fe3O4 nanobeads is 1:(15-20); and / or: The organic solvent is dimethyl sulfoxide; and / or: The reaction temperature is 25-35℃, and the reaction time is 2-3 hours.

6. The magnetic chip for traditional Chinese medicine extracts according to claim 1 or 2, characterized in that, In step (4): The mass ratio of traditional Chinese medicine extract to DHBP-grafted magnetic nanobeads is 1:(1.8-2.2); and / or: The organic solvent is methanol; and / or: The reaction was carried out under a nitrogen atmosphere for 0.8-1.2 hours.

7. A method for screening the therapeutic targets of traditional Chinese medicine extracts in the treatment of amyotrophic lateral sclerosis (ALS), characterized in that, Includes the following steps: (1) Total protein was extracted from the spinal cord, brainstem and cerebral cortex of ALS model animals as tissue samples; (2) Incubate tissue samples with DHBP-grafted magnetic nanobeads as described in any one of claims 1-6 to remove interference from non-specific proteins; (3) Add the magnetic chip hook of the traditional Chinese medicine extract according to any one of claims 1-6 to the tissue sample after removing non-specific proteins, and enrich the target proteins. (4) The target protein was identified by LC-MS / MS.

8. The method according to claim 7, characterized in that, In step (1), total protein was extracted from mouse spinal cord, brainstem, and cerebral cortex using the Invent Minute™ Animal Cell / Tissue Total Protein Extraction Kit; and / or: In step (2), the mass ratio of total protein to DHBP-grafted magnetic nanobeads in each tissue sample is (8-12):1; and / or: In step (2), the incubation is performed at 3-5°C for 12-18 minutes; and / or: In step (3), the mass ratio of total protein to the magnetic chip of the traditional Chinese medicine extract in each tissue sample is (4-6):1; and / or: In step (4), the chromatographic conditions for LC-MS / MS are as follows: Chromatographic column: C18 reversed-phase column; mobile phase A: 0.1% formic acid in water, mobile phase B: 0.1% formic acid in acetonitrile; elution gradient: 0-70 min, 2%-40% B; 70-75 min, 40%-95% B; 75-95 min, 95% B; The eluent was introduced into the mass spectrometer at a flow rate of 300 nL / min. The mass spectrometry parameters were as follows: resolution: 60000; maximum IT: 50 ms; scan spectrum: 350-2000 m / z; target value for false positive rate of peptide matching: 0.01; HCD collision energy: 35%.

9. A method for screening active ingredients in traditional Chinese medicine compositions for treating amyotrophic lateral sclerosis (ALS), characterized in that, Including steps (1)-(4) as described in claim 7 or 8, it further includes: (5) Construct plasmids for the target protein; (6) Express and purify the target protein in the protein expression system; (7) Construct an active compound library based on the components contained in the traditional Chinese medicine composition, and prepare solutions of each active compound; (8) The target protein is fixed on the surface of the CM5 sensor chip and bound and dissociated in the solutions of the above compounds. The equilibrium dissociation constant of each component is determined. The compound with an equilibrium dissociation constant of less than 10 μM is the potential active ingredient for treating amyotrophic lateral sclerosis.

10. The method according to claim 9, characterized in that, In step (5), the target proteins are DDX17 (111-556) and SFPQ (276-535); and / or: In step (6), the protein expression system is E. coli BL21(DE3) competent cells; and / or: In step (7), the solvent for each active compound solution is 1×PBS-P buffer containing 5% DMSO; and / or: In step (8), the coupling value between the target protein and the CM5 sensor chip is above 13000RU, and the binding time and dissociation time are both 55-65s.

11. Application of tuberose glycoside A in the preparation of drugs that protect nerve cells.

12. The application according to claim 11, characterized in that... Application of tuberose glycoside A in the preparation of drugs to improve the viability of cells in oxidative stress models.

13. The application according to claim 11, characterized in that... Application of tuberose glycoside A in the preparation of drugs that reduce intracellular reactive oxygen species levels in oxidative stress model cells.

14. The application according to claim 11, characterized in that... Application of tuberose glycoside A in the preparation of drugs that inhibit the decrease in mitochondrial membrane potential in oxidative stress model cells.

Images