Recombinant nanobodies against feline calicivirus and uses thereof

Abstract

The application relates to the field of biotechnology, in particular to a recombinant nanobody against feline calicivirus and application thereof, an amino acid sequence of the recombinant nanobody is shown as SEQ ID NO: 2, and a nucleotide sequence for coding the amino acid sequence is shown as SEQ ID NO: 1. The yield of the recombinant nanobody is 1.3 mg / mL, the purity reaches 85%, the recombinant nanobody has good neutralizing virus activity, the half effective inhibitory concentration IC 50 50 μg / mL, can significantly reduce the excretion level of feline calicivirus in kittens, has high biological activity, and can be applied to the prevention and / or treatment of feline calicivirus infection. The recombinant nanobody FCV-Nb53A7 of the application can be used for developing neutralizing antibody drugs, diagnostic reagents or vaccine adjuvants, and provides a potential candidate drug for the prevention and control of feline calicivirus infection.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a recombinant nanobody against feline calicivirus and its applications. Background Technology

[0002] Feline calicivirus (FCV) infection is a viral respiratory infectious disease in felines. Affected cats primarily exhibit upper respiratory tract symptoms, including lethargy, serous and mucous nasal discharge, conjunctivitis, stomatitis, tracheitis, and bronchitis, often accompanied by biphasic fever. FCV infection is a prevalent disease in cats, characterized by high morbidity and low mortality. Currently, vaccination is the primary means of prevention and control, but existing vaccines offer limited protection and carryover effects after immunization, posing new challenges to this approach. Therefore, the development of novel preventative and therapeutic drugs is essential.

[0003] Nanobodies are antibody fragments composed of individual variable domains (VHHs) of heavy chain antibodies, possessing the smallest functional antigen-binding active region. They are characterized by small molecular weight, good stability, high affinity, and strong tissue penetration. They can also recognize gap epitopes of antigens and have advantages such as low genetic modification difficulty, low production cost, and weak immunogenicity, making them extremely promising for applications. However, there are currently few research reports on nanobodies against feline calicivirus. Summary of the Invention

[0004] The present invention aims to provide a recombinant nanobody against feline calicivirus and its application, so as to fill the gap in the field of anti-feline calicivirus nanobody.

[0005] The technical solution adopted by this invention to solve the technical problem is as follows:

[0006] This invention provides a recombinant nanobody against feline calicivirus, the amino acid sequence of which is shown in SEQ ID NO:2.

[0007] The present invention provides a recombinant nanobody against feline calicivirus, wherein the nucleotide sequence encoding the amino acid sequence is shown in SEQ ID NO:1.

[0008] The present invention provides a recombinant eukaryotic expression plasmid containing the encoding gene of a recombinant nanobody against feline calicivirus.

[0009] This invention provides a recombinant yeast strain for expressing a recombinant nanobody against a feline calicivirus.

[0010] Preferably, the nucleotide sequence encoding the recombinant yeast strain is SEQ ID NO:3.

[0011] This invention provides the use of a recombinant nanobody against feline calicivirus in the preparation of medicaments for the prevention and / or treatment of feline calicivirus infection.

[0012] Preferably, the drug is a neutralizing antibody drug, a diagnostic reagent, or a vaccine adjuvant.

[0013] Compared with the prior art, the beneficial effects of the present invention are:

[0014] The recombinant nanobody FCV-Nb53A7 of this invention has the characteristics of small molecular weight, easy gene modification, and short production preparation cycle. It is more suitable for rapidly mutating virus strains and can solve the defects of traditional vaccine development cycle that is long and cannot keep up with the progress of virus mutation.

[0015] The recombinant nanobody FCV-Nb53A7 of this invention possesses good neutralizing activity and diagnostic potential, exhibiting significant neutralizing activity in cells and assays, with an IC50 (half-maximal inhibitory concentration). 50 The concentration was 6.50 μg / mL, demonstrating good viral inhibition ability, significantly superior to anti-feline calicivirus nanobodies reported in previous literature. Therefore, the recombinant nanobody FCV-Nb53A7 of this invention can be used to develop neutralizing antibody drugs, diagnostic reagents, or vaccine adjuvants, providing a promising candidate drug for the prevention and control of feline calicivirus infection.

[0016] Furthermore, this invention constructed a recombinant eukaryotic expression plasmid pPIC9K-FCV-Nb53A7 and a recombinant yeast engineered strain, achieving efficient expression and purification of the recombinant nanobody FCV-Nb53A7 in the Pichia pastoris system. The molecular weight of the expression product was approximately 13 kDa, consistent with the theoretical value, with a purity of 85% and a yield of 1.3 mg / mL. Attached Figure Description

[0017] Figure 1 This is the insertion rate identification result of the VHH phage library of immune alpacas constructed in Example 1.

[0018] Figure 2 The results are ELISA detection results of solid-phase screening of the VHH phage library of immunized alpacas in Example 2.

[0019] Figure 3 This is the SDS-PAGE identification result of the recombinant nanobody FCV-Nb53A7 in Example 3.

[0020] Figure 4 This is the result of the half-maximal inhibitory concentration (IC50) determination of the recombinant nanobody FCV-Nb53A7 in Example 4. Detailed Implementation

[0021] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0022] Example 1: Construction of a VHH phage plasmid library for immunizing alpacas

[0023] (1) The feline triple vaccine (purchased from Zoetis (Suzhou) Animal Health Products Co., Ltd., the antigen of which contains inactivated feline panleukopenia virus, feline herpesvirus and feline calicivirus) was injected subcutaneously into the neck of an adult healthy alpaca (purchased from Shenzhen Shunyu Biotechnology Co., Ltd.), with an injection volume of 2 mL / alpaca. Booster immunizations were given on days 14, 28 and 42 after immunization, and serum antibody titers were measured.

[0024] When the ELISA titer of serum antibodies reached 1:20000, peripheral blood of alpacas was collected, lymphocytes were separated using human peripheral blood lymphocyte separation medium, RNA was extracted using an RNA extraction kit and a reverse transcription kit, and then reverse transcribed into cDNA. Finally, the nanobody (VHH) sequence of alpaca antibody was amplified using a two-round nested PCR method.

[0025] The primer sequences for the first round of nested PCR amplification are P1-F and P1-R, and the specific sequence information is as follows:

[0026] P1-F: GTCCTGGCTGCTCTTCTACAAGG;

[0027] P1-R:GGTACGTGCTGTTGAACTGTTCC.

[0028] The primer sequences for the second round of nested PCR amplification are P2-F and P2-R, and the specific sequence information is as follows:

[0029] P2-F: GAGCTC GATGTGCAGCTGGTGGA, the underlined part is the Sac I restriction site;

[0030] P2-R: ACTAGT TGAGGAGACGGTGACCT, the underlined part is the Spe I restriction site.

[0031] The primers for both rounds of nested PCR amplification were synthesized by General Biotech (Anhui) Co., Ltd.

[0032] (2) The amplified alpaca antibody nanobody sequence and pComb3Xss plasmid were digested with restriction endonucleases Sac I and Spe I, ligated with T4 ligase, and transformed into E. coli TG1 competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.). Forty-eight single colonies were picked the following day and subjected to bacterial culture PCR identification. The results of the bacterial culture PCR identification are as follows: Figure 1 As shown, 45 single colonies were positive, and sequencing confirmed that all of these sequences were distinct. This experimental result indicates that the positive rate of the VHH phage library for immunized alpacas reached 93.75% (45 / 48), confirming the successful construction of the VHH phage library for immunized alpacas. Based on the amounts of RNA extraction, reverse transcription, ligation system, plate counting, and dilution ratios, the estimated library size of the VHH phage library for immunized alpacas constructed in this invention is 2 × 10⁻⁶. 6 indivual.

[0033] Example 2: Screening of recombinant nanobody sequences against feline calicivirus

[0034] The purified feline calicivirus (provided by Dr. Qian Jing of the Veterinary Research Institute of Jiangsu Academy of Agricultural Sciences) was administered at 100 TCID50. 50 / wells are coated with an ELISA plate, and the VHH sequence that can bind to feline calicivirus is screened using antibody library solid-phase screening technology. This VHH sequence is the anti-feline calicivirus nanobody sequence.

[0035] The VHH phage plasmid library of immunized alpacas constructed in Example 1 was plated on 2×YT medium (containing 100 μg / mL ampicillin sodium). The next day, single colonies were picked and transferred to 96-well plates, each well containing 400 μL of 2×YT medium (with additional 0.4% glucose and 100 μg / mL ampicillin sodium). After incubation at 37°C for 3 h, the culture was transferred to 96-well deep-well plates and incubated at 37°C with shaking for 6 h until OD was reached. 600nm At an infection rate of 0.5, helper phage M13KO7 (purchased from Thermo Fisher Scientific) was inoculated at an MOI of 20. After incubation at 37°C for 30 min with shaking for 60 min, the precipitate was centrifuged at 4000 r / min, the supernatant was discarded, and the precipitate was resuspended in 400 μL of 2×YT medium (100 μg / mL ampicillin sodium, 75 μg / mL kanamycin, 100 mmol / L IPTG). The precipitate was incubated at 37°C with shaking for 16 h, and after centrifugation at 4000 r / min, 200 μL of the supernatant was added to an ELISA plate coated with feline calicivirus antigen (100 TCID50). 50 / well), perform ELISA detection, and collect OD. 450 nm Calculate the P / N value (experimental well OD) for each well. 450 nm / Negative control well OD 450 nm A P / N value greater than 3 is considered positive. Phage-ELISA test results are as follows: Figure 2 As shown, 12 VHH sequences were screened. Among them, the VHH sequence numbered FCV-Nb53A7 had the highest P / N value (14.986), and its nucleotide sequence is SEQ ID NO:1, while the corresponding encoded amino acid sequence is SEQ ID NO:2.

[0036] Example 3 Expression and identification of recombinant nanobody FCV-Nb53A7

[0037] (1) Construction of recombinant eukaryotic expression plasmid pPIC9K-FCV-Nb53A7;

[0038] Based on the codon preferences of Pichia pastoris, codon optimization was performed without altering the amino acid sequence. An EcoRI restriction site was introduced at the 5' end of the nanobody sequence FCV-Nb53A7, and a Not I restriction site and a stop codon (TGA) were introduced at the 3' end. The constructed gene sequence was sent to GenScript Biotech for synthesis. Using a homologous recombination kit (purchased from TransGen Biotech), the synthesized gene was ligated into the Pichia pastoris expression vector pPIC9K to obtain the recombinant eukaryotic expression plasmid pPIC9K-FCV-Nb53A7.

[0039] (2) Construction of recombinant yeast engineered strains;

[0040] The recombinant eukaryotic expression plasmid pPIC9K-FCV-Nb53A7 was linearized using restriction endonuclease Sal I (purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.). The plasmid was then added to Pichia pastoris GS115 competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), gently mixed, and transferred to a pre-chilled electroporation cuvette. After incubation on ice for 5 minutes, the cells were transferred to an electroporator (purchased from Bio-Rad Biomedical Products (Shanghai) Co., Ltd.). The electroporation parameters were set as follows: voltage 1.8 kV, resistance 250 Ω, and capacitance 15 µF. Immediately after electroporation, 1 mL of pre-chilled 1 M sorbitol (purchased from Shanghai Beyotime Biotechnology Co., Ltd.) was added. After two pipette spins, the cells were transferred to a 15 mL centrifuge tube and incubated statically at 30°C for 2 h. The cells were then centrifuged at 4000 rpm for 4 minutes at room temperature. The cells were collected and resuspended in 100 µL of YPG medium (purchased from Beijing Solarbio Science & Technology Co., Ltd.), and spread onto a plate containing 100 μL of YPG medium. The culture was carried out on YPG solid medium containing µg / mL bleomycin (Zeocin, purchased from Shanghai Beyotime Biotechnology Co., Ltd.) at 37°C for 3 days. Single colonies were picked for PCR identification, with a length of 384 bp. After successful identification, a recombinant yeast strain for expressing recombinant nanobodies was obtained. The nucleotide sequence encoding this recombinant yeast strain is SEQ ID NO:3.

[0041] (3) Preparation of recombinant nanobody FCV-Nb53A7;

[0042] The obtained recombinant yeast strain was first inoculated into 50 mL of YPG medium for revitalization. The next day, 5 mL of the culture was inoculated into a 1 L shake flask (containing 400 mL of YPG medium) and cultured overnight at 28°C and 200 r / min. The cells were collected by centrifugation and resuspended in an equal volume of BMMY liquid medium (purchased from Beijing Solarbio Science & Technology Co., Ltd.). The cells were induced at 28°C and 200 r / min for 120 hours (with methanol added every 24 hours to a final concentration of 0.5%). The supernatant was collected and purified according to the affinity chromatography column (purchased from Shanghai Beyotime Biotechnology Co., Ltd.) instructions to obtain the recombinant protein. The molecular weight and purity of the recombinant protein were analyzed by SDS-PAGE. The identification results are as follows: Figure 3 As shown, the relative molecular mass of the obtained recombinant protein is 13 kDa, which is consistent with the expected value, indicating that the recombinant protein is the recombinant nanobody FCV-Nb53A7, with a concentration of 1.3 mg / mL and a purity of 85%.

[0043] Example 4: Detection of the neutralizing activity of recombinant nanobody FCV-Nb53A7

[0044] Take 50 μL of recombinant nanobodies of different concentrations (50 μg / mL, 25 μg / mL, 12.5 μg / mL, 5 μg / mL, 0.5 μg / mL) and mix them with an equal volume of 2000 TCID50. 50 Feline calicivirus was co-incubated at 37°C for 1 h and then seeded into FK81 cells (purchased from the Cell Bank of the Chinese Academy of Sciences Type Culture Collection Committee), with 5 replicates. A positive control group was set up (50 μL of 2000 TCID3 was seeded). 50 Feline calicivirus (FCV) and a negative control group (100 μL PBS) were used. Cell status was observed every 24 h. The supernatant was harvested on day 5 post-inoculation, and the TCID of the virus in the supernatant was measured. 50 Titrate. Neutralization percentage = [1 - (mean TCID in the positive group)] 50 - Average TCID in the experimental group 50 ) / (mean TCID in the positive group) 50 - Average TCID in the negative group 50 [×100%, data processing and analysis were performed using GraphPad Prism software.] The results showed that different concentrations (50 μg / mL, 25 μg / mL, 12.5 μg / mL, 5 μg / mL) of recombinant nanobody FCV-Nb53A7 could inhibit feline calicivirus replication, with an IC50 of 100%. 50 It is 6.50 μg / mL ( Figure 4The recombinant nanobody FCV-Nb53A7 exhibits significant biological activity and can be used to prepare drugs for the prevention and treatment of feline calicivirus.

[0045] The recombinant nanobody FCV-Nb53A7 prepared by this invention exhibits excellent neutralizing activity, significantly superior to existing anti-feline calicivirus nanobodies, and can be used to prepare drugs for the prevention and / or treatment of feline calicivirus infection. This invention is simple and convenient to operate, has low production costs, and can ensure the yield, activity, safety, and practicality of the recombinant nanobody, making it suitable for large-scale production.

[0046] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. However, these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A recombinant nanobody against feline calicivirus, characterized in that, Its amino acid sequence is shown in SEQ ID NO:

2.

2. The recombinant nanobody against feline calicivirus according to claim 1, characterized in that, The nucleotide sequence encoding the amino acid sequence is shown in SEQ ID NO:

1.

3. A recombinant eukaryotic expression plasmid containing the encoding gene of a recombinant nanobody against feline calicivirus as described in claim 1 or 2.

4. A recombinant yeast strain used to express a recombinant nanobody against feline calicivirus as described in claim 1 or 2.

5. The recombinant yeast strain according to claim 4, characterized in that, The nucleotide sequence encoding the recombinant yeast strain is SEQ ID NO:

3.

6. The use of a recombinant nanobody against feline calicivirus as described in claim 1 or 2 in the preparation of a medicament for the prevention and / or treatment of feline calicivirus infection.

7. The application according to claim 6, characterized in that, The drug is a neutralizing antibody drug, a diagnostic reagent, or a vaccine adjuvant.

Images