A monoclonal antibody against human alpha-klotho protein and kl1 domain and a preparation method thereof

Abstract

The application discloses a kind of anti-human alpha-Klotho protein and KL1 domain monoclonal antibody and preparation method thereof, belong to monoclonal antibody technical field.The application is with recombinant human alpha-Klotho extracellular domain protein and KL1 domain protein as immunogen, by mouse immunization, phage display antibody library construction and antigen affinity screening, obtain the monoclonal antibody capable of specifically recognizing human alpha-Klotho protein, the monoclonal antibody includes the variable region with specific heavy chain complementarity determining region CDR3 sequence, preferably includes the amino acid sequence described herein or its derived variant.The antibody has good specificity and binding activity, can effectively recognize Klotho protein and its KL1 domain.The antibody has the advantages such as strong specificity, high affinity, low cross-reaction, can be used for ELISA, immunochromatography, immunohistochemistry, flow cytometry and various detection platforms, further be applied to Klotho related disease detection, diagnosis and research.

Description

Technical Field

[0001] This invention belongs to the fields of biotechnology and monoclonal antibody technology, specifically relating to a monoclonal antibody against human α-Klotho protein and KL1 domain and its preparation method. Background Technology

[0002] α-Klotho protein is a type I transmembrane glycoprotein whose extracellular domain can be cleaved to form soluble Klotho protein. Studies have shown that Klotho protein is closely related to various diseases such as aging, chronic kidney disease, diabetes, and neurodegenerative diseases. Therefore, its detection has important applications in basic research, disease diagnosis, and drug development.

[0003] However, existing α-Klotho antibodies still have certain limitations, making it difficult to meet the demands for high-sensitivity detection and industrial applications. Furthermore, most publicly available α-Klotho antibodies only provide product information without disclosing key antibody sequences, hindering recombinant expression, engineered modification, and stable production. In particular, the complex structure of α-Klotho proteins, their highly hydrophobic transmembrane regions, and abundant glycosylation sites make the preparation of native conformational antigens difficult, further limiting the development of high-performance antibodies.

[0004] Existing Klotho antibodies mainly have the following problems: 1. Insufficient specificity: Different antibodies have inconsistent recognition patterns for α-Klotho. Some antibodies show multiple non-specific bands in Western blotting, making it difficult to accurately distinguish between KL1, KL2, or full-length α-Klotho. 2. Limited affinity: Due to incomplete folding of the immunoantigen or lack of natural glycosylation modification, some antibodies have a weak ability to recognize natural α-Klotho protein, making it difficult to meet the high-sensitivity detection requirements of ELISA, immunochromatography and other methods. 3. Poor batch-to-batch consistency: Most existing antibodies are polyclonal antibodies or hybridoma antibodies with undisclosed sequences, resulting in significant performance differences between different batches, which affects the stability and repeatability of test results; 4. Insufficient applicability of detection platforms: Some antibodies are only suitable for Western blotting or immunohistochemistry detection, making it difficult to meet the needs of quantitative detection, rapid detection and multi-platform application.

[0005] Therefore, developing monoclonal antibodies against human α-Klotho protein with clear sequence information, good specificity, and high affinity is of great significance for the detection, analysis, and related research of human α-Klotho protein. Summary of the Invention

[0006] Therefore, the purpose of this invention is to provide a monoclonal antibody capable of specifically recognizing human α-Klotho protein and the KL1 domain, and a method for preparing the same, in order to solve the technical problems of existing α-Klotho antibodies, such as insufficient specificity, low affinity, large batch-to-batch variability, and difficulty in meeting the requirements for high-sensitivity detection.

[0007] To achieve the above objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides a monoclonal antibody capable of specifically recognizing human α-Klotho and its KL1 domain, each of the monoclonal antibodies comprising: heavy chain complementarity-determining regions VH CDR1, VH CDR2, and VH CDR3, and light chain complementarity-determining regions VL CDR1, VL CDR2, and VL CDR3. The amino acid sequence of the monoclonal antibody VH CDR1 is selected from the sequence shown in SEQ ID NO.1 or SEQ ID NO.2, the amino acid sequence of VH CDR2 is selected from the sequence shown in SEQ ID NO.3 or SEQ ID NO.4, the amino acid sequence of VH CDR3 is selected from the sequences shown in SEQ ID NO.5-19, the amino acid sequence of VL CDR1 is selected from the sequence shown in SEQ ID NO.20, the amino acid sequence of VL CDR2 is selected from the sequence shown in SEQ ID NO.21, and the amino acid sequence of VL CDR3 is selected from the sequence shown in SEQ ID NO.22.

[0008] Based on the above technical solution, the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.23, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.24.

[0009] Table 1. Amino acid sequences of monoclonal antibodies

[0010] Based on the above technical solution, the antibody is further selected from IgG, Fab, scFv or single-domain antibodies and their antigen-binding fragments.

[0011] Secondly, the present invention provides a method for preparing the monoclonal antibody, comprising the following steps: (1) Antigen preparation: Based on the structural sequence of human α-Klotho protein, α-Klotho extracellular domain protein and KL1 domain protein were designed and expressed by CHO cells and E. coli expression system, respectively, and the antigen protein was purified. (2) Animal immunization: Eight-week-old Balb / c mice were initially immunized by intraperitoneal injection of 90-110 μg of antigen. Three booster immunizations were performed by intraperitoneal injection of 90-110 μg of antigen in each mouse on the 10th, 20th and 30th days after the initial immunization. On the 7th day after the final immunization, tail blood was collected from the mice and antibody titers were detected by ELISA. (3) Construction of immune antibody library: Total RNA was extracted from the spleen tissue of mice with high antibody titers after immunization, and cDNA was obtained by reverse transcription. The antibody heavy chain variable region gene (VH) and light chain variable region gene (VL) were amplified, and VH and VL were spliced ​​together using linker peptides to form scFv gene; (4) Construction of phage display library: The scFv gene is inserted into the phage display vector, transformed into host bacteria and packaged with helper phages to construct an immune phage display antibody library; (5) Antibody panning and identification: Recombinant human α-Klotho protein or KL1 domain protein is used as the screening target. Specific binding phages are enriched through multiple rounds of affinity panning, and target monoclonal antibodies are obtained by sequencing and binding activity identification.

[0012] Based on the above technical solution, the antigen protein purification method is further described as nickel column affinity chromatography, ion exchange chromatography, gel filtration chromatography, or a combination thereof.

[0013] Thirdly, the present invention provides a nucleic acid molecule encoding the amino acid sequence of the monoclonal antibody.

[0014] Fourthly, the present invention provides a recombinant expression vector into which the nucleic acid molecule is inserted.

[0015] Fifthly, the present invention provides a host cell carrying the expression vector.

[0016] In a sixth aspect, the present invention provides the application of the monoclonal antibody, the nucleic acid molecule, the expression vector, or the host cell in the preparation of a human α-Klotho protein detection reagent.

[0017] Furthermore, the detection reagent is suitable for detection platforms such as enzyme-linked immunosorbent assay (ELISA), immunochromatography, immunohistochemistry, immunofluorescence, and flow cytometry.

[0018] Compared with the prior art, the present invention has the following beneficial effects: 1. The human α-Klotho extracellular domain protein and KL1 domain protein constructed in this invention have had their transmembrane regions removed, while retaining key functional domains and native antigenic epitopes. They exhibit good solubility and stability, enabling efficient expression in eukaryotic and prokaryotic expression systems and yielding high-purity antigen proteins.

[0019] 2. This invention uses phage display technology to screen and obtain multiple monoclonal antibodies targeting human α-Klotho protein and KL1 domain. The obtained antibodies have good specificity and high affinity, and can effectively recognize natural or recombinant human α-Klotho protein.

[0020] 3. The α-Klotho monoclonal antibody of the present invention has a wide range of applications and can be used in various detection platforms such as immunochromatography, ELISA, immunohistochemistry, and flow cytometry, enabling high-sensitivity detection of α-Klotho protein in serum, urine, tissue and cell samples.

[0021] 4. The monoclonal antibodies, nucleic acid molecules, expression vectors, and host cells provided by this invention can serve as important tools for basic research related to human α-Klotho, biomarker detection, and the development of in vitro diagnostic reagents, and have good prospects for industrial application. Attached Figure Description

[0022] To more clearly illustrate the embodiments of the present invention, the accompanying drawings involved in the embodiments will be briefly described below.

[0023] Figure 1 The pXC-Klotho(38-980)-10His plasmid constructed in Example 1 of this invention is shown in the image.

[0024] Figure 2 pET-28a(+)-KL1 constructed for Embodiment 2 of the present invention (64–505) Plasmid map.

[0025] Figure 3 The image shows the purification results of recombinant human α-Klotho protein in Example 1 of this invention, where lane 1 contains 2 μg of protein, lane 2 contains 5 μg of protein, and lane 3 contains 10 μg of protein.

[0026] Figure 4 The image shows the purification results of the human α-Klotho protein KL1 domain in Example 2 of this invention. In (a), lanes 1-4 are the samples before induction, after induction, supernatant, and precipitate, respectively; lanes 5-8 are WB1, WB2, 200 mM imidazole, and 500 mM imidazole, respectively. (b) shows the ion exchange chromatography and SDS-PAGE results of the KL1 truncated protein. (c) shows the gel filtration chromatography and SDS-PAGE results of the KL1 truncated protein. (d) shows the electrophoresis results of the concentrated KL1 truncated protein sample.

[0027] Figure 5 This is a flowchart of the mouse immune response to the KL1 truncated somatic protein induced by the present invention.

[0028] Figure 6This is an ELISA result of the KL1 truncated protein induced by this invention. Detailed Implementation

[0029] The present invention will be described in detail below with reference to the embodiments. However, the implementation of the present invention is not limited thereto. Obviously, the embodiments described below are only some embodiments of the present invention. For those skilled in the art, other similar embodiments can be obtained without creative effort and all fall within the protection scope of the present invention.

[0030] Example 1: Construction, expression and purification of recombinant human α-Klotho protein 1. Design of α-Klotho protein expression sequence Based on the human α-Klotho protein gene sequence (GenBank accession number: NM_004795.3), the extracellular domain coding sequence (corresponding to amino acid residues 34-981) was selected as the target expression fragment. An IL-2 signal peptide sequence was introduced at the N-terminus of the target protein to promote secretory protein expression; a 10×His tag was introduced at the C-terminus for subsequent protein purification and detection.

[0031] 2. Construction of recombinant expression vectors Using the KL(NM_004795) pcDNA3.1-3×Flag-C plasmid as a template, the coding sequence of the α-Klotho extracellular domain (aa34~981) was amplified by PCR. The amplified product was double-digested with EcoRI and HindIII, and then ligated into the pXC17.4-SP-antigen-His vector, which had undergone the same enzyme digestion treatment, to construct the recombinant expression vector pXC-Klotho-10His. Colony PCR, enzyme digestion analysis, and sequencing confirmed the correct construction of the recombinant vector. Its plasmid map is shown below. Figure 1 .

[0032] 3. Construction of a cell line stably expressing recombinant human α-Klotho protein CHO cells were cultured to the logarithmic growth phase (1.5 × 10⁻⁶). 6 ~3.0×10 6 (cells / mL), collect 2×10 7 Cells were resuspended in electroporation buffer, and 25 μg of recombinant expression vector was added. Transfection was performed using an electroporator at 1240 V. After transfection, cells were cultured in CD04 medium containing 6 mM glutamine for 48 h to recover. After recovery, cells were transferred to selection medium containing 25 μM MSX for pressure selection and continuous passage. Once cell growth and viability stabilized, a CHO engineered cell line capable of stably secreting and expressing recombinant human α-Klotho protein was obtained.

[0033] 4. Expression and purification of recombinant human α-Klotho protein Stable expression cell lines were seeded into CD04 medium for suspension culture, with an initial cell density of 0.5 × 10⁶ cells / year. 6 The culture was conducted using a fed-batch culture method, with nutrients and glucose solution added periodically to maintain a glucose concentration of 4–6 g / L. After 14 days of culture, the culture supernatant was collected, and cells and impurities were removed by centrifugation to obtain a clear supernatant containing recombinant human α-Klotho protein.

[0034] Using Ni 2+ Affinity chromatography was used to purify recombinant human α-Klotho protein. Culture supernatant was loaded onto a pre-equilibrated nickel ion affinity chromatography column, washed with equilibration buffer, and eluted with imidazole-containing elution buffer to collect the target protein fraction. The protein was then dialyzed into PBS buffer, centrifuged to remove the precipitate, and filtered through a 0.22 μm filter for sterilization.

[0035] SDS-PAGE analysis of the purified product showed that recombinant human α-Klotho protein with the theoretical molecular weight was obtained. Figure 3 The protein concentration was determined to be approximately 0.8 mg / mL, with a total volume of approximately 55 mL, yielding approximately 44 mg of recombinant human α-Klotho protein. The purified protein was aliquoted and stored at [location missing]. Keep at 80℃ for later use.

[0036] Example 2: Construction, expression and purification of recombinant human α-Klotho truncated protein 1. α-Klotho truncated gene design Based on the structural sequence of the Klotho protein (GenBank accession number: NM_004795.3), a truncated KL1 domain coding sequence (G64-G505) was designed. To improve the soluble expression level of the protein in *E. coli*, a PelB signal peptide, a TFA membrane-penetrating peptide, and a SUMO tag were introduced at the N-terminus, and a 6×His tag was introduced at the C-terminus. Simultaneously, the gene sequence was codon-optimized to adapt to the *E. coli* expression system.

[0037] 2. Construction of recombinant expression vectors The optimized KL1 domain gene fragment was digested with EcoRI and XhoI and ligated into the pET-28a(+) vector to construct the recombinant expression vector pET-28a(+)-KL1(64–505). Colony PCR, double enzyme digestion identification, and sequencing verification confirmed the correct construction of the recombinant expression vector. Its plasmid map is shown below. Figure 2 .

[0038] 3. Expression and purification of recombinant human α-Klotho truncated protein The recombinant expression vector was transformed into *E. coli* BL21(DE3) competent cells. Positive single clones were picked and inoculated into LB medium containing kanamycin and cultured until the bacterial culture reached OD500. 600 When the concentration reached 0.6-0.8, IPTG was added to a final concentration of 0.5 mM, and expression was induced at 18℃ for 16 h.

[0039] Bacterial cells were collected and sonicated. After centrifugation, the supernatant was collected as the soluble protein sample. Initial purification was performed using Ni-NTA affinity chromatography, followed by further purification using anion exchange chromatography and gel filtration chromatography. The target protein peak was collected and concentrated.

[0040] SDS-PAGE analysis of the purified product showed that the KL1 truncated protein with the theoretical molecular weight was obtained. Figure 4 Purity analysis showed that the target protein had a purity of approximately 88% and a concentration of approximately 1.2 mg / mL, which meets the requirements for subsequent antibody preparation and related detection experiments in immunized animals.

[0041] Example 3: Preparation and evaluation of immune response of mice immunized against human α-Klotho 1. Mouse immunization The recombinant human α-Klotho extracellular domain protein (aa34–981) obtained in Example 1 and the KL1 domain protein obtained in Example 2 were used as immunogens, respectively. Six 8-week-old Balb / c mice were randomly divided into two groups (KL immunization group and KL1 immunization group), with 3 mice in each group. For the first immunization, the antigen was emulsified with Freund's complete adjuvant at a 1:1 volume ratio and injected intraperitoneally, with each mouse receiving 100 μg of antigen. Subsequently, booster immunizations were performed on days 10, 20, and 30, with the antigen emulsified with Freund's incomplete adjuvant at a 1:1 volume ratio and injected intraperitoneally, with each immunization dose being 100 μg / mouse. The immunization schedule is as follows. Figure 5 As shown.

[0042] 2. Antibody titer testing Serum was collected from mice 7 days after the last immunization. Antibody titers were detected using indirect ELISA with recombinant human α-Klotho protein or KL1 protein as the coating antigen. The results are as follows: Figure 6 As shown, the results indicate that both groups of mice produced high levels of antigen-specific antibodies, with some mice maintaining strong binding activity even under high dilution conditions, indicating good immunization efficacy and suitability for subsequent antibody library construction.

[0043] Example 4: Construction and screening of anti-human α-Klotho single-chain antibody library 1. RNA extraction and reverse transcription Mice with the highest antibody titers after immunization were selected, and their spleens were aseptically isolated after cervical dislocation. Total RNA was extracted using the TransGen Biotech ER501 high-purity RNA extraction kit. 1% agarose gel electrophoresis showed clear and intact 28S and 18S bands with no significant degradation; the A260 / 280 ratio was 1.92, indicating good RNA purity.

[0044] Reverse transcription was performed using the TransGen Biotech Reverse Transcription Kit AE311-02. The reaction mixture consisted of 2 μg RNA, 1 μL Oligo(dT) primer, 2 μL dNTP mixture, 1 μL RNase inhibitor, 1 μL reverse transcriptase, 5 μL buffer, and water to a final volume of 20 μL. The reaction conditions were: 65℃ for 5 min, 42℃ for 45 min, and 0℃ for 15 min to obtain the first strand of cDNA, which was then stored at -20℃ for later use.

[0045] 2. PCR amplification of VH and VL genes Design mouse antibody VH and VL gene-specific primers, the primer nucleotide sequences of which are shown below: VH upstream primer (SEQ ID NO.25): 5'-GAGGTGCAGCTGCAGCAGTCTGG-3' VH downstream primer (SEQ ID NO.26): 5'-TGAGGAGACGGTGACCAGGGTGCC-3' VL upstream primer (SEQ ID NO.27): 5'-GACATTGTGCTGACCCAGTCTCC-3' VL downstream primer (SEQ ID NO.28): 5'-TGTTGAAGCTCTTGGTCCCCTCC-3' PCR amplification was performed using cDNA as a template. The PCR reaction system consisted of 2 μL cDNA, 1 μL each of forward and reverse primers, 0.5 μL Taq enzyme, 2 μL dNTP mixture, 5 μL buffer, and water added to a final volume of 25 μL. The reaction conditions were as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 45 s, 35 cycles, and a final extension at 72℃ for 10 min.

[0046] The amplification products were detected by 1.5% agarose gel electrophoresis. The size of the VH and VL gene fragments was approximately 340 bp, consistent with expectations. The PCR products were recovered and purified for later use.

[0047] 3. Splicing of scFv single-chain antibody genes The VH and VL genes were spliced ​​using overlap extension PCR (SOE-PCR), and the flexible linker peptide (Gly4Ser)3 was introduced. Its nucleic acid sequence is shown below (SEQ ID NO.29): GGCGGCGGCGGCTCGGGCGGCGGCGGCTCGGGCGGCGGCGGC The forward and reverse complementary sequences of the linker peptide were inserted into the 3' end of the downstream primer VH and the 5' end of the upstream primer VL, respectively, so that the VH and VL fragments form a 20 bp overlap region.

[0048] SOE-PCR reaction system: 2 μL of VH purified product, 2 μL of VL purified product, 0.5 μL of Taq enzyme, 2 μL of dNTP mixture, 5 μL of buffer, and water added to 25 μL; reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 30 cycles, and 72℃ final extension for 10 min.

[0049] The spliced ​​product was detected by agarose gel electrophoresis. The size of the scFv gene fragment was approximately 800 bp, which was in line with expectations. It was recovered, purified and used for later use.

[0050] 4. Construction of recombinant phage libraries The scFv gene and enzyme digestion ( Eco RⅠ and Xho I) Ligate the pCANTAB-5E vector. The ligation system is as follows: 3 μL scFv gene, 1 μL vector, 1 μL T4 DNA ligase, 2 μL buffer, add water to 10 μL, and ligate overnight at 16°C.

[0051] The ligation product was transformed into TG1 competent cells, incubated on ice for 30 min, heat-shocked at 42℃ for 90 s, incubated on ice for 2 min, and then 800 μL of SOC medium was added. The cells were incubated at 37℃ and 220 rpm for 1 h. 100 μL of the bacterial culture was plated on LB agar plates containing ampicillin and glucose, and incubated overnight at 37℃. The colony count was performed, and the library volume was calculated to be approximately 1.2 × 10⁻⁶. 8 CFU.

[0052] The correctly identified recombinant bacteria were used to infect M13KO7 helper phage. After packaging with the helper phage, a recombinant phage library displaying scFv antibodies was obtained and named the KL1-scFv phage display library.

[0053] 5. Antibody Panning Coating: Dilute the KL1 truncated protein to 10 μg / mL with coating buffer, add 100 μL to each well, coat the microplate at 4℃ overnight, wash 3 times with PBST, add 250 μL of 5% skim milk, and block at 37℃ for 1 h.

[0054] First round of selection: 100 μL of KL1-scFv phage library (approximately 1×10⁻⁶) was collected. 11 Add pfu to the coated wells, incubate at room temperature for 2 h, wash 10 times with PBST, add 100 μL of 0.2 M glycine-HCl (pH 2.2) to elute the bound phage, immediately neutralize to pH 7.0 with 1 M Tris-HCl (pH 9.0), collect the eluent, infect TG1 competent cells, and amplify for the second round of panning.

[0055] Second round of panning: The amplified phages were panned a second time using the method described above, with the number of washes increased to 15. After elution, they were infected with TG1 cells, and 50 single clones were selected for sequencing. The results showed that the antibody sequence diversity was low. Therefore, 33 positive clones from the first round of panning were selected for sequencing. Sequence alignment analysis revealed multiple candidate antibody clones with different VH CDR3 sequences, providing a sequence basis for subsequent antibody expression and functional evaluation.

[0056] Example 5: Eukaryotic Expression and Activity Identification of Monoclonal Antibodies 1. Construction of eukaryotic expression plasmids Based on the 18 unique positive clone antibody sequences (KL1-5, KL1-12, KL1-97, KL1-102, KL1-105, KL1-106, KL1-107, KL1-108, KL1-111, KL1-119, KL1-121, KL1-125, K1, K22, K23, K24, K31, K40) obtained from sequencing in Example 4, light chain and heavy chain genes were synthesized and inserted into the pcDNA3.1 eukaryotic expression vector to construct recombinant expression plasmids, as shown in Table 2. The plasmids were confirmed to be correctly constructed by enzyme digestion identification and sequencing verification.

[0057] Table 2

[0058] 2. Antibody Expression and Purification The recombinant expression plasmid was co-transfected into HEK293T cells at a light chain:heavy chain ratio of 1:1. The culture supernatant was collected 48 h post-transfection, and the antibody was purified using a Protein A affinity chromatography column. The purification procedure was as follows: equilibrate the column with equilibration buffer (20 mMPB, pH 7.0), load the culture supernatant, wash with equilibration buffer until the baseline stabilizes, elute with elution buffer (0.1 M glycine-HCl, pH 2.7), collect the 280 nm absorption peak, dialyze overnight with PBS buffer, and determine the antibody concentration using the BCA method. The purity was verified by SDS-PAGE electrophoresis as ≥90%.

[0059] 3. Antibody binding activity assay (ELISA) Coating: 1 μg / mL antigen protein, coated overnight at 4℃, washed 3 times with PBST, and blocked with 5% skim milk at 37℃ for 1 h.

[0060] Primary antibody incubation: The purified antibody was serially diluted at 1 μg / mL, 0.33 μg / mL, 0.11 μg / mL, 0.037 μg / mL, 0.012 μg / mL and 0.004 μg / mL, 100 μL per well, and incubated at room temperature for 2 h. The antibody was then washed 5 times with PBST.

[0061] Secondary antibody incubation: Add 100 μL of HRP-labeled goat anti-human IgG secondary antibody (1:5000 dilution) to each well, incubate at room temperature for 1 h, and wash 5 times with PBST.

[0062] Color development and reading: Add 100 μL of TMB color development solution, incubate at room temperature in the dark for 15 min, add 100 μL of 2 M H2SO4 to stop the reaction, read the OD value at 450 nm using a microplate reader, and calculate the EC50. 50 value.

[0063] The results showed that all 18 antibodies could specifically bind to human α-Klotho extracellular domain protein or KL1 domain protein, among which KL1-5, KL1-97, KL1-102, and KL1-106 EC56 were most effective. 50 The values ​​were 0.01023 μg / mL, 0.0156 μg / mL, 0.01707 μg / mL, and 0.01043 μg / mL, respectively, indicating excellent binding activity.

[0064] Example 6: Antibody Affinity Determination The affinity between antibodies and antigens was determined using Forte BioOctet, and the specific steps are as follows: The antigen was labeled with biotin and immobilized on the SA sensor. After equilibration, it was immersed in antibody solutions of different concentration gradients (500 nM, 250 nM, 125 nM, 62.5 nM, 31.25 nM) to carry out the binding reaction. Subsequently, it was immersed in PBS buffer to carry out the dissociation reaction, and the binding and dissociation curves were recorded.

[0065] Curve fitting was performed using Octet software, and the dissociation constant (KD value) was calculated. The results showed that the KD value of the KL1-5 antibody was 4.2 × 10⁻⁶. -10 The KD value of the M,KL1-106 antibody is 5.7×10. -10 M values ​​all reached sub-nanomolar levels, indicating that the obtained antibodies possess excellent antigen-binding ability.

[0066] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A monoclonal antibody against human α-Klotho protein and the KL1 domain, characterized in that, The monoclonal antibody comprises: heavy chain complementarity-determining regions VH CDR1, VH CDR2, and VH CDR3, and light chain complementarity-determining regions VL CDR1, VL CDR2, and VLCDR3; The amino acid sequence of the monoclonal antibody VH CDR1 is selected from the sequence shown in SEQ ID NO.1 or SEQ ID NO.2, the amino acid sequence of VH CDR2 is selected from the sequence shown in SEQ ID NO.3 or SEQ ID NO.4, the amino acid sequence of VH CDR3 is selected from the sequences shown in SEQ ID NO.5-19, the amino acid sequence of VL CDR1 is selected from the sequence shown in SEQ ID NO.20, the amino acid sequence of VL CDR2 is selected from the sequence shown in SEQ ID NO.21, and the amino acid sequence of VL CDR3 is selected from the sequence shown in SEQ ID NO.

22.

2. The monoclonal antibody according to claim 1, characterized in that, The amino acid sequence of the heavy chain complementarity-determining region is shown in SEQ ID NO.23, and the amino acid sequence of the light chain complementarity-determining region is shown in SEQ ID NO.

24.

3. The monoclonal antibody according to claim 1, characterized in that, The antibody or its antigen-binding fragment is selected from IgG, IgM, IgA, Fab, Fab', F(ab')2, scFv, single-domain antibody, bispecific antibody or its derivatives.

4. A method for preparing the monoclonal antibody according to any one of claims 1 to 3, characterized in that, Includes the following steps: (1) Antigen preparation: Based on the structural sequence of human α-Klotho protein, α-Klotho extracellular domain protein and / or KL1 domain protein were designed and expressed by CHO cells and E. coli expression system, respectively, and the antigen protein was purified. (2) Immunization of mice: Eight-week-old Balb / c mice were initially immunized by intraperitoneal injection of 90-110 μg of antigen. Three booster immunizations were performed on the 10th, 20th and 30th day after the initial immunization by intraperitoneal injection of 90-110 μg of antigen per mouse. On the 7th day after the final immunization, tail blood was collected from the mice and antibody titers were detected by ELISA. (3) Construction of immune antibody library: Total RNA was extracted from mouse spleen tissue in step (2), cDNA was obtained by reverse transcription, the antibody heavy chain variable region gene VH and light chain variable region gene VL were amplified, and the scFv gene was formed by splicing them together with linker peptides. (4) Construction of phage display library: The scFv gene is inserted into the phage display vector and transformed into host bacteria to construct an immune phage display antibody library; (5) Antibody panning: Using recombinant human α-Klotho extracellular domain protein and / or KL1 domain protein as screening targets, specific binding phages are enriched by affinity panning; (6) Identification of positive clones: Sequencing analysis and binding activity identification of positive clones were performed to obtain the anti-human α-Klotho monoclonal antibody.

5. The preparation method according to claim 4, characterized in that, The antigen protein is purified by nickel column affinity chromatography, ion exchange chromatography, or gel filtration chromatography.

6. The preparation method according to claim 4, characterized in that, The antibody panning was performed by conjugating biotin-labeled α-Klotho extracellular domain protein and / or KL1 domain protein with streptavidin magnetic beads, and the bound phages were recovered by acid elution.

7. A nucleic acid molecule encoding the amino acid sequence of the monoclonal antibody according to claims 1-2.

8. An expression vector for inserting the nucleic acid molecule of claim 7.

9. A host cell carrying the expression vector of claim 8.

10. The use of the monoclonal antibody according to any one of claims 1 to 3, the nucleic acid molecule according to claim 7, the expression vector according to claim 8, or the host cell according to claim 9 in the preparation of a human α-Klotho protein detection reagent.

Images