A sugar-containing high molecular polymer, a preparation method thereof and application thereof in prevention and treatment of monochamus alternatus

Abstract

The application discloses a sugar-containing high-molecular polymer and a preparation method and application thereof, and the structural formula of the polymer is wherein n=40 and m=20. The hydrophobic cavity of cyclodextrin of the polymer has certain inclusion and hydrophobic interaction with the base and hydrophobic region of dsRNA, and forms a nanoparticle structure. Amino groups are introduced through polymerization, so that the polymer as a whole is positively charged, and through strong electrostatic attraction, the polymer is combined with negatively charged dsRNA, so that the dsRNA loading rate is ensured to be higher than 90%, and the dsRNA is promoted to enter cells; trehalose is a non-reducing disaccharide, has excellent biocompatibility, stability and unique ability of protecting biological macromolecules, can maintain the structural integrity of dsRNA, and prevents nuclease degradation; and through the loading of the sugar-containing high-molecular nanocarrier, it is ensured that sufficient and structurally complete dsRNA can be successfully cut into functional siRNA by Dicer enzyme, so as to silence target genes and enhance RNAi.

Description

Technical Field

[0001] This invention relates to the field of polymer nanocarrier technology, specifically to a sugar-containing polymer, its preparation method, and its application in the control of pine sawyer beetles. Background Technology

[0002] Pine wilt disease is one of the most dangerous and devastating diseases in global forest ecosystems. The pine wilt nematode is the pathogen of pine wilt disease, and the pine sawyer beetle is the main vector of the pine wilt nematode. Therefore, blocking the spread of the pine sawyer beetle is an effective means of controlling pine wilt disease.

[0003] Current control measures for the pine sawyer beetle involve methods such as hormone trapping, trunk injection, and pesticide application. These methods are extremely costly, and long-term use of chemical pesticides may lead to a series of problems, including pesticide resistance in the target organisms, toxic side effects of pesticides on non-target organisms, and environmental pollution.

[0004] Gene blocking is a highly conserved post-transcriptional gene silencing mechanism in eukaryotes. It specifically induces the silencing of target genes through double-stranded RNA (dsRNA) and is characterized by being green, safe, efficient, and easily degradable, enabling sustainable pest management. However, in the practical application of RNA interference (RNAi) technology for pest control, challenges such as the instability of dsRNA in the environment, its susceptibility to degradation by RNA-degrading enzymes, ultraviolet light, and high temperatures, and its difficulty in effectively entering the target organism limit the practical application effectiveness of RNAi technology for pest management.

[0005] Cyclodextrin, a natural cyclic oligosaccharide, exhibits low toxicity and immunogenicity. Its primary and secondary hydroxyl groups are located on the narrower and wider edges of a truncated cone-shaped structure, respectively. In aqueous solution, this structure forms a stable barrel-like structure through intramolecular hydrogen bonding, with a hydrophilic outer layer and a hydrophobic interior cavity. This amphiphilic structure allows for interactions with a wide range of molecules, including ions, proteins, and nucleotides, to form inclusion complexes. Although natural cyclodextrin is hydrophilic, its water solubility is limited. Furthermore, dsRNA itself is highly hydrophilic, thus limiting the efficiency of natural cyclodextrin in delivering dsRNA. Summary of the Invention

[0006] The technical problem to be solved by this invention is how to prepare nanocarriers of double-stranded RNA.

[0007] The present invention solves the above-mentioned technical problems through the following technical means:

[0008] A sugar-containing polymer has the following structural formula: Where n=40, m=20.

[0009] This invention also proposes a method for preparing the aforementioned sugar-containing polymer, comprising the following steps: S1. β-Cyclodextrin, triphenylphosphine and iodine are reacted in a solvent, and sodium methoxide methanol solution is added for treatment. The precipitate is washed and dried to obtain iodo-β-cyclodextrin (β-CD-I). S2, iodine-substituted β-cyclodextrin Using undecanoic acid as a raw material, the reaction is carried out under elevated temperature in the presence of alkaline substances and solvents to obtain β-cyclodextrin molecules containing long-chain alkyl groups (β-CD-I-ACID). S3. Mix β-cyclodextrin molecules containing long-chain alkyl groups, base and solvent, add 2-bromoisobutyryl bromide under an inert gas environment, and heat to react to obtain β-cyclodextrin macromolecular initiator (CD-BiBB). S4. Mix β-cyclodextrin macromolecular initiator, hydroxyethyl methacrylate, 2-aminoethyl ester hydrochloride, solvent and catalyst, then perform freeze-thaw cycles, and heat under inert gas protection to carry out polymerization reaction to obtain polymer CD-MA. S5. The polymer CD-MA, 2-iminothionecyclopentane hydrochloride, and trehalose monomer are added. The sugar-containing polymer (CD-MA-Tre) was obtained by reacting triethylamine with a solvent at room temperature.

[0010] Preferably, in step S1, sodium methoxide is added to a methanol solution for treatment, and then the solution is poured into a methanol solution and stirred until a precipitate appears.

[0011] Preferably, in S1, the reaction temperature is 70°C and the time is 24 h; in S2, the reaction temperature is 70°C and the time is 24 h; in S3, the reaction temperature is 50°C and the time is 24 h; in S4, the reaction temperature is 55~60°C and the time is 12 h; and in S5, the reaction time is 24 h.

[0012] Preferably, in S1, the molar ratio of β-cyclodextrin, triphenylphosphine, and iodine is 1:13.99:13.99.

[0013] Preferably, in S1, the mass ratio of β-cyclodextrin, triphenylphosphine, and iodine is 5.68:18.36:17.77.

[0014] Preferably, in S2, the molar ratio of iodoβ-cyclodextrin to undecanoic acid is 1:10.5.

[0015] Preferably, in S3, the molar ratio of the β-cyclodextrin molecule containing a long-chain alkyl group to 2-bromoisobutyryl bromide is 1:35.

[0016] Preferably, in S4, the molar ratio of the β-cyclodextrin macromolecular initiator, hydroxyethyl methacrylate, and 2-aminoethyl ester hydrochloride is 1:560:269-280.

[0017] Preferably, in S5, the molar ratio of the polymer CD-MA, 2-iminothiacyclopentane hydrochloride, and trehalose monomer is 1:1:3.

[0018] Preferably, in S2, the molar ratio of the iodo-β-cyclodextrin to the basic substance is 1:1.9-2.

[0019] Preferably, in S3, the molar ratio of the long-chain alkyl β-cyclodextrin molecule (β-CD-I-ACID) to the base is 1:27-30.

[0020] Preferably, in S1, the solvent is DMF.

[0021] Preferably, in S1, the β-cyclodextrin and triphenylphosphine are β-cyclodextrin and triphenylphosphine dried at 100°C for 24 h; the drying temperature of the precipitate is 40°C and the drying time is 2 h.

[0022] Preferably, in S1, the concentration of the sodium methoxide methanol solution is 1.83 mol / L.

[0023] Preferably, in S1, the cleaning solution is methanol.

[0024] Preferably, in S2, the alkaline substance is K2CO3 and the solvent is DMF.

[0025] Preferably, in S3, the base is triethylamine, the solvent is DMF, and the inert gas is nitrogen.

[0026] Preferably, in S4, the solvent is DMF.

[0027] Preferably, in S5, the solvent is DMSO.

[0028] Preferably, in S4, the molar ratio of the β-cyclodextrin macromolecular initiator to the catalyst is 1:2.8.

[0029] Preferably, in S4, the catalyst is a mixture of cuprous bromide and pentamethyldiethylenetriamine.

[0030] Preferably, in S4, the catalyst is a mixture of 6 mg / mL cuprous bromide and pentamethyldiethylenetriamine.

[0031] Preferably, in S4, hydroxyethyl methacrylate is filtered with alkaline alumina to remove the polymerization inhibitor before use.

[0032] Preferably, in steps S2-S5, after the reaction is completed, water dialysis is also included. The dialysis bag used for dialysis has a molecular weight cutoff of 3500~4000 Da, the dialysis time is 24 h, and the water is changed at least six times during the dialysis process.

[0033] Preferably, in step S5, the polymer CD-MA, 2-iminothiacyclopentane hydrochloride, trehalose monomer, and triethylamine are dissolved in DMSO, wherein the triethylamine is used to provide an alkaline environment and act as a catalyst. The reaction is carried out at room temperature for 24 hours, and the reaction product is purified by dialysis to obtain the sugar-containing polymer.

[0034] Preferably, in S5, the molar ratio of the polymer CD-MA to triethylamine is 1:1.5.

[0035] Preferably, in S5, the room temperature is 25-30°C.

[0036] This invention also proposes an application of the aforementioned sugar-containing polymer as a double-stranded RNA carrier.

[0037] Preferably, the double-stranded RNA is dsRNA; the dsRNA is encapsulated by a sugar-containing polymer to enhance the RNAi effect.

[0038] Preferably, the mass ratio of dsRNA to sugar-containing polymer is 1:0.625-40; more preferably, it is 1:5-40.

[0039] The present invention also proposes a nanocomposite containing the aforementioned sugar-containing polymer and double-stranded RNA.

[0040] Preferably, the concentration of double-stranded RNA in the nanocomposite is 0.2 μg / μL.

[0041] The present invention also proposes an application of the aforementioned nanocomposite in the control of the pine sawyer beetle.

[0042] Preferably, during application, each pine beetle is injected with 10 μL of the complex.

[0043] To further improve the solubility, inclusion, and controllable delivery capabilities of natural cyclodextrins, we introduced amino groups through polymerization, giving the polymer a positive overall charge. This enhances the loading efficiency of negatively charged nucleic acid molecules and promotes their entry into cells. We also grafted a non-reducing disaccharide, trehalose, which possesses excellent biocompatibility, stability, and a unique ability to protect biomolecules. During delivery, trehalose maintains the structural integrity of double-stranded RNA and prevents degradation by nucleases. This designed polymer solves the challenges of cellular uptake and environmental stability in nucleic acid delivery using RNAi technology for pest control, providing a breakthrough solution for the agricultural application of RNAi technology.

[0044] The advantages of this invention are: (1) This invention utilizes atom transfer radical polymerization to polymerize hydroxyethyl methacrylate monomer, 2-aminoethyl methacrylate hydrochloride monomer, and β-cyclodextrin macromolecules to prepare an amphiphilic sugar-containing polymer. Using natural cyclic oligosaccharide cyclodextrin as raw material, positively charged amino groups are introduced through ATRP to construct a positively charged polymer, which is tightly bound to the phosphate backbone (negatively charged) of dsRNA through electrostatic interactions. Trehalose is grafted as its hydrophilic block, forming a hydrogen bond network with the phosphate groups of dsRNA to further enhance the binding and form a stable nanocomposite.

[0045] (2) In the practical application of RNAi technology to control the pine sawyer beetle, the amphiphilic sugar-containing polymer material of the present invention forms a stable nanocomposite with dsRNA through hydrophilic-hydrophobic interactions. The hydrophobic cavity of cyclodextrin undergoes a certain inclusion and hydrophobic interaction with the bases and hydrophobic regions of dsRNA to form a nanoparticle structure. By introducing amino groups through polymerization, the polymer as a whole becomes positively charged, and binds to the negatively charged dsRNA through strong electrostatic attraction, ensuring that the dsRNA loading rate exceeds 90% and promoting its entry into cells; trehalose is a non-reducing disaccharide with excellent biocompatibility, stability and unique ability to protect biomacromolecules, which can maintain the structural integrity of dsRNA and prevent nuclease degradation; the loading of sugar-containing polymer nanocarriers ensures that sufficient and structurally intact dsRNA can be cleaved into functional siRNA by Dicer enzyme to silence target genes and enhance RNAi.

[0046] (3) Using sugar-containing polymer nanocomposite materials as dsRNA carriers to encapsulate dsRNA shows promise in protecting dsRNA, promoting cellular uptake and ensuring precise release. Attached Figure Description

[0047] Figure 1 The above is the 1H NMR spectrum of the β-cyclodextrin molecule (β-CD-I-ACID) containing long-chain alkyl groups in Example 1 of this invention; Figure 2 The 1H NMR spectrum of the β-cyclodextrin macromolecular initiator (CD-BiBB) in Example 1 of this invention; Figure 3 The 1H NMR spectrum of the glycosyl polymer (CD-MA) in Example 1 of this invention; Figure 4 This is a gel permeation chromatogram of the glycosyl polymer (CD-MA) in Example 1 of the present invention; Figure 5 The 1H NMR spectrum of the amphiphilic sugar-containing polymer (CD-MA-Tre) in Example 1 of this invention; Figure 6 This is a gel permeation chromatogram of the amphiphilic sugar-containing polymer (CD-MA-Tre) in Example 1 of the present invention; Figure 7 The Fourier transform infrared spectra of the glycosyl polymer (CD-MA) and the amphiphilic sugar-containing polymer (CD-MA-Tre) in Example 1 of this invention are shown. Figure 8 The graphs show the dsRNA integrity and loading effect of the sugar-containing polymers in Examples 2-9 of this invention verified by agarose gel retardation experiments. Figure 9 The insecticidal effect of the sugar-containing polymer prepared in Example 1 of this invention on the pine sawyer beetle by delivering dsIAP. Detailed Implementation

[0048] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0049] Unless otherwise specified, all test materials and reagents used in the following examples are commercially available.

[0050] Unless otherwise specified in the embodiments, the techniques or conditions described in the literature in this field or in accordance with the product manual may be followed.

[0051] The trehalose monomer described below was prepared according to the reference [Y. Wang, M. Milewska, H. Foster, et al. The Core-Shell Structure, Not Sugar, Drives the Thermal Stabilization of Single-Enzyme Nanoparticles[J]. BIOMACROMOLECULES, 2021, 22 (11):4569–4581.].

[0052] The dsIAP described below was obtained by performing a local BLAST analysis on the RNAi target gene sequence of *Anoplophora alabripennis* and the whole genome sequence of *Anoplophora alabripennis*, as used in [Dhandapani, RK, Gurusamy, D., Duan, JJ, Palli, SR, 2020. RNAi for management of Asian long-horned beetle, *Anoplophora alabripennis*: identification of target genes. Journal of Pest Science 93, 823-832.]. The dsIAP of *Anoplophora alabripennis* was obtained; the gene sequence of the target gene IAP is: (SEQ ID NO) .1)AAAGTGAAAACAGAAACCAGTATTGTAAATGCTTCACAATCAAATTTAGAGGCCACAGAAACGTCTGACCCAGAATTAGAAACGAGACTCCAAACGTTTGAACATTGGCCCAATCCCTATATATCTAAGAGAAGCCTAGCAGAGGCGGGATTTATTTATACCGGCGAAGATGACATT GTTCAGTGCCCGTTATGCAGCATAGAGGGATATCGCTGGGTAGCTGGCGATATTCCAATGGAGGACCACAGGGTTTGGAGTCCAAATTGCCCCTTTGTAAGACGGAATATTGAACACGATCATTCCGAAAGCAATGCCATAGGATTAGACACTTGCGGCAATTACGGCATTGAAATCCTC.

[0053] The sequence of dsRNA (i.e., dsIAP) is: (SEQ ID NO. 2) AAAGUGAAAACAGAAACCAGUAUUGUAAAUGCUUCACAAUCAAAUUUAGAGGCCACAGAAACGUCUGACCCAGAAUUAGAAACGAGACUCCAAACGUUUGAACAUUGGCCCAAUCCCUAUAUAUCUAAGAGAAGCCUAGCAGAGGCGGGAUUUAUUUAUACCGGCGAAGAUGACAUUGU UCAGUGCCCGUUAUGCAGCAUAGAGGGAUAUCGCUGGGUAGCUGGCGAUAUUCCAAUGGAGGACCACAGGGUUUGGAGUCCAAAUUGCCCCUUUGUAAAGACGGAAUAUUGAACACGAUCAUUCCGAAAGCAAUGCCAUAGGAUUAGACACUUGCGGCAAUUACGGCAUUGAAAUCCUC.

[0054] Example 1 This embodiment provides a method for synthesizing an amphiphilic sugar-containing polymer, the route of which is shown below:

[0055] Includes the following steps: (1) Take 5.68 g of β-cyclodextrin and 18.36 g of triphenylphosphine respectively, and dry them in a vacuum drying oven at 100℃ for 24 hours; take out the dried β-cyclodextrin and dissolve it in DMF (30 ml) to obtain a β-cyclodextrin solution, take out the dried triphenylphosphine and dissolve it in DMF (100 ml) to obtain a triphenylphosphine solution; add 17.77 g of I2 to the triphenylphosphine solution in three portions, and then add the β-cyclodextrin solution. The above mixed solution is reacted in an oil bath at 70℃ for 24 h. Weigh 3 g of sodium methoxide and add it to 30 ml of methanol solution. Add the sodium methoxide methanol solution dropwise to the solution after the reaction, and then pour the solution into 500 ml of methanol solution. Stir until a precipitate appears. Filter the solution through a Buchner funnel to obtain the precipitate. Wash the precipitate with methanol solution, repeat 3 times, take out the precipitate and dry it in a vacuum drying oven at 40℃ for 2 hours to obtain iodo-β-cyclodextrin (β-CD-I); (2) Weigh out iodo-β-cyclodextrin in a molar ratio of 1:10.5:2 0.974 g (0.000511 mol), undecanoic acid (1 g, 0.005368 mol), and K2CO3 (0.141 g, 0.001 mol) were dissolved in DMF (25 mL) and reacted in an oil bath at 70 °C for 24 h. The reaction product was dialyzed for 24 h using a dialysis bag with a molecular weight cutoff of 3.5 kDa, with the water being changed six times during the dialysis process, to obtain β-cyclodextrin molecules containing long-chain alkyl groups (β-CD-I-ACID). (3) Dissolve 0.000216 mol of β-cyclodextrin molecules containing long-chain alkyl groups (β-CD-I-ACID, 0.5 g) and 0.006 mol of triethylamine (0.61 g) in DMF (6 mL), and add 0.00757 mol of 2-bromoisobutyryl bromide (1.74 g) dropwise under nitrogen atmosphere. After the reaction mixture is completely added, react the mixture in an oil bath at 50 °C for 24 h. Dialyze the reaction product using a dialysis bag with a molecular weight cutoff of 3.5 kDa for 24 h, and change the water six times during the dialysis process to obtain purified β-cyclodextrin macromolecular initiator (CD-BiBB). (4) Filter hydroxyethyl methacrylate (HEMA) with alkaline alumina to remove the polymerization inhibitor. Then, add 0.0114 mmol of β-cyclodextrin macromolecular initiator (CD-BiBB, 50 mg), 3.074 mmol of 2-aminoethyl methacrylate hydrochloride (AEMA, 510 mg), and 6.385 mmol of hydroxyethyl methacrylate (HEMA, 831 mg) to an ampoule and dissolve in 10 mL of DMF. Add 763 μL of a mixture of cuprous bromide and pentamethyldiethylenetriamine (wherein the cuprous bromide concentration is 6 mg / mL) to the ampoule and mix well. Seal the ampoule.

[0056] (5) The mixed solution sealed in the ampoule was subjected to three freeze-thaw cycles, and then the polymerization reaction was carried out at 55°C in a nitrogen atmosphere for 12 h. The polymerization product was then dialyzed for 24 h using a dialysis bag with a molecular weight cutoff of 3.5 kDa, and the water was changed six times during the dialysis process to obtain the purified polymerization product, namely the glycosyl polymer (CD-MA).

[0057] (6) Weigh the synthesized glycosyl polymer CD-MA (50 mg), 2-iminothiacyclopentane hydrochloride (4.4 mg), and trehalose monomer in a molar ratio of 1:1:3:1.5. (51.742 mg), triethylamine (6.605 mg), wherein the triethylamine is used to provide an alkaline environment and act as a catalyst. The polymer CD-MA, 2-iminothiacyclopentane hydrochloride, trehalose monomer, and triethylamine were dissolved in DMSO (4 mL) and reacted at room temperature (25°C) for 24 hours. The reaction product was dialyzed for 24 hours using a dialysis bag with a molecular weight cutoff of 3.5 kDa, with six water changes during the dialysis process, to obtain the sugar-containing polymer nanocarrier (CD-MA-Tre), i.e., the amphiphilic sugar-containing polymer, with the following structural formula: Where n=40, m=20.

[0058] In this embodiment, during the synthesis of the amphiphilic sugar-containing polymer nanocarrier, the β-cyclodextrin molecule (β-CD-I-ACID) containing long-chain alkyl groups in step (2) was characterized by NMR analysis. The obtained 1H NMR spectrum is shown below. Figure 1 As shown, this indicates that the product (β-CD-I-ACID) was successfully synthesized. The β-cyclodextrin macromolecular initiator (CD-BiBB) from step (3) was characterized by NMR, and the 1H NMR spectrum is shown below. Figure 2 As shown, this indicates that the product (CD-BiBB) was successfully synthesized. The glycopolymer (CD-MA) prepared in step (5) was characterized by NMR, and the 1H NMR spectrum is shown below. Figure 3 As shown, this indicates that the polymer (CD-MA) was successfully synthesized. The prepared polymer (CD-MA) was analyzed by gel permeation chromatography, and the gel permeation chromatogram results are shown below. Figure 4 As shown, the peak molecular weight of CD-MA is Mn=41.4 kDa, the polydispersity index PD=2.8, and the molecular weight distribution is relatively narrow. The sugar-containing polymer nanocarrier (CD-MA-Tre) prepared in step (6) was characterized by NMR, and the 1H NMR spectrum was obtained as shown below. Figure 5 As shown, this indicates that the polymer was successfully synthesized. The prepared polymer was analyzed by gel permeation chromatography, and the gel permeation chromatogram results are shown below. Figure 6 As shown, the peak molecular weight of CD-MA-Tre is Mn = 43.9 kDa, and the polydispersity index (PD) is 3.2. Infrared analysis of the glycosyl polymer (CD-MA) and the glycosyl polymer nanocarrier (CD-MA-Tre) yielded the following Fourier transform spectra: Figure 7 As shown, 1625 cm -1 The presence of characteristic peaks for carbon-nitrogen bonds further confirms the synthesis of the sugar-containing polymer nanocarrier (CD-MA-Tre).

[0059] Example 2 The integrity and loading effect of dsRNA were verified by agarose gel retardation assay, and the results are as follows: Figure 8As shown in 1 / 0.

[0060] When an aqueous solution is prepared without the addition of sugar-containing polymer nanocarriers, i.e., when the mass ratio of dsRNA to sugar-containing polymer nanocarriers is 1:0, bands can be observed.

[0061] Example 3 A complex was prepared by mixing dsRNA with the glycosylated polymer nanocarrier prepared in Example 1 at a mass ratio of 1:0.625. The complex was then tested using an agarose gel retardation assay to verify the integrity and loading effect of the dsRNA. The results are as follows: Figure 8 As shown.

[0062] When the mass ratio of dsRNA to glycosylated polymer nanocarrier is 1:0.625, bands can be observed.

[0063] Example 4 A complex was prepared by mixing dsRNA and the glycosylated polymer nanocarrier prepared in Example 1 at a mass ratio of 1:1.25. The integrity and loading effect of the dsRNA were verified by agarose gel retardation assay. The results are as follows: Figure 8 As shown.

[0064] When the mass ratio of dsRNA to glycosylated polymer nanocarrier is 1:1.25, bands can be observed, and their brightness decreases.

[0065] Example 5 A complex was prepared by mixing dsRNA and the glycosylated polymer nanocarrier prepared in Example 1 at a mass ratio of 1:2.5. The integrity and loading effect of the dsRNA were verified by agarose gel retardation assay. The results are as follows: Figure 8 As shown.

[0066] When the mass ratio of dsRNA to glycosylated polymer nanocarrier is 1:2.5, bands can be observed, and their brightness decreases.

[0067] Example 6 A complex was prepared by mixing dsRNA and the glycosylated polymer nanocarrier prepared in Example 1 at a mass ratio of 1:5. The integrity and loading effect of the dsRNA were verified by agarose gel retardation assay. The results are as follows: Figure 8 As shown.

[0068] When the mass ratio of dsRNA to sugar-containing polymer nanocarrier is 1:5, the bands disappear.

[0069] Example 7 A complex was prepared by mixing dsRNA and the glycosylated polymer nanocarrier prepared in Example 1 at a mass ratio of 1:10. The integrity and loading effect of the dsRNA were verified by agarose gel retardation assay. The results are as follows: Figure 8 As shown.

[0070] When the mass ratio of dsRNA to sugar-containing polymer nanocarrier is 1:10, the band disappears.

[0071] Example 8 A complex was prepared by mixing dsRNA with the glycosylated polymer nanocarrier prepared in Example 1 at a mass ratio of 1:20. The integrity and loading effect of the dsRNA were verified by agarose gel retardation assay. The results are as follows: Figure 8 As shown.

[0072] When the mass ratio of dsRNA to sugar-containing polymer nanocarrier is 1:20, the band disappears.

[0073] Example 9 A complex was prepared by mixing dsRNA with the glycosylated polymer nanocarrier prepared in Example 1 at a mass ratio of 1:40. The integrity and loading effect of the dsRNA were verified by agarose gel retardation assay. The results are as follows: Figure 8 As shown.

[0074] When the mass ratio of dsRNA to sugar-containing polymer nanocarrier is 1:40, the band disappears.

[0075] In Examples 2-9, as the mass ratio of dsRNA to glycosylated polymer nanocarriers increased from 1:0 to 1:40, the intensity of the migrating dsRNA band gradually decreased. This demonstrates the ability of the glycosylated polymer nanocarriers to bind negatively charged dsRNA (purchased from Shanghai Zhisheng Yougu Biotechnology Co., Ltd.). The results are as follows: Figure 8 As shown, the marker is used as a standard for RNA molecular weight during gel electrophoresis.

[0076] Example 10 The complex was prepared by mixing dsIAP with the sugar-containing polymer nanocarrier prepared in Example 1 at a mass ratio of 1:5, achieving a final dsIAP concentration of 0.2 μg / μL. Healthy adult pine sawyer beetles were used as test insects. Ten insects were treated with 10 μL of the complex, and the mortality rate was observed. The results are as follows: Figure 9 As shown in the figure, the results demonstrate that the sugar-containing polymer nanocarrier encapsulates and delivers dsIAP with good insecticidal effect.

[0077] The principle of this invention is as follows: This invention utilizes atom transfer radical polymerization (ATRP) to polymerize hydroxyethyl methacrylate monomer, 2-aminoethyl methacrylate hydrochloride monomer, and β-cyclodextrin macromolecules to prepare a high molecular weight polymer. Trehalose molecules are then grafted onto this polymer to prepare an amphiphilic sugar-containing high molecular weight polymer. The natural cyclic oligosaccharide cyclodextrin is used as a raw material. Positively charged amino groups are introduced through ATRP to construct a positively charged polymer, which tightly binds to the negatively charged phosphate backbone of dsRNA through electrostatic interactions. The grafted trehalose molecules form a hydrophilic block, creating a hydrogen bond network with the phosphate groups of dsRNA, further enhancing the binding and forming a stable nanocomposite.

[0078] In practical applications of RNAi technology for controlling the pine sawyer beetle, the amphiphilic glycopolymer material of this invention forms a stable nanocomposite with dsRNA through hydrophilic-hydrophobic interactions. The hydrophobic cavity of cyclodextrin undergoes inclusion and hydrophobic interactions with the bases and hydrophobic regions of dsRNA, forming a nanoparticle structure. The introduction of amino groups through polymerization makes the polymer positively charged, which binds to the negatively charged dsRNA through strong electrostatic attraction, ensuring a dsRNA loading rate exceeding 90% and promoting its entry into cells. Trehalose, a non-reducing disaccharide, possesses excellent biocompatibility, stability, and a unique ability to protect biomolecules, maintaining the structural integrity of dsRNA and preventing nuclease degradation. The loading of the glycopolymer nanocarrier ensures that sufficient, structurally intact dsRNA can be cleaved into functional siRNA by Dicer enzyme to silence target genes and enhance RNAi.

[0079] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A sugar-containing polymer, characterized in that: Its structural formula is shown below: Where n=40, m=20.

2. A method for preparing the sugar-containing polymer as described in claim 1, characterized in that: Includes the following steps: S1. β-Cyclodextrin, triphenylphosphine and iodine are reacted in a solvent, and sodium methoxide methanol solution is added for treatment. The precipitate is washed and dried to obtain iodo-β-cyclodextrin. S2. Using iodo-β-cyclodextrin and undecanoic acid as raw materials, the reaction is carried out under elevated temperature in the presence of alkaline substances and solvents to obtain β-cyclodextrin molecules containing long-chain alkyl groups. S3. Mix β-cyclodextrin molecules containing long-chain alkyl groups, base and solvent, add 2-bromoisobutyryl bromide under an inert gas environment, and heat to react to obtain β-cyclodextrin macromolecular initiator; S4. Mix β-cyclodextrin macromolecular initiator, hydroxyethyl methacrylate, 2-aminoethyl ester hydrochloride, solvent and catalyst, then perform freeze-thaw cycles, and heat under inert gas protection to carry out polymerization reaction to obtain polymer CD-MA. S5. The polymer CD-MA, 2-iminothionecyclopentane hydrochloride, and trehalose monomer are added. The sugar-containing polymer was obtained by reacting triethylamine with a solvent at room temperature.

3. The method for preparing the sugar-containing polymer according to claim 2, characterized in that: In S1, the reaction temperature is 70°C and the time is 24 h; in S2, the reaction temperature is 70°C and the time is 24 h; in S3, the reaction temperature is 50°C and the time is 24 h; in S4, the reaction temperature is 55~60°C and the time is 12 h; in S5, the reaction time is 24 h.

4. The method for preparing the sugar-containing polymer according to claim 2, characterized in that: In S2, the molar ratio of iodoβ-cyclodextrin to undecanoic acid is 1:10.

5.

5. The method for preparing the sugar-containing polymer according to claim 2, characterized in that: In S3, the molar ratio of the β-cyclodextrin molecule containing a long-chain alkyl group to 2-bromoisobutyryl bromide is 1:

35.

6. The method for preparing the sugar-containing polymer according to claim 2, characterized in that: In S4, the molar ratio of the β-cyclodextrin macromolecular initiator, hydroxyethyl methacrylate, and 2-aminoethyl ester hydrochloride is 1:560:269-280.

7. The method for preparing the sugar-containing polymer according to any one of claims 2-6, characterized in that: In S5, the molar ratio of the polymer CD-MA, 2-iminothiacyclopentane hydrochloride, and trehalose monomer is 1:1:

3.

8. The application of the sugar-containing polymer as described in claim 1 as a double-stranded RNA carrier.

9. A nanocomposite, characterized in that: It contains the sugar-containing polymer and double-stranded RNA as described in claim 1.

10. The application of the nanocomposite as described in claim 9 in the control of the pine longhorn beetle.

Images