A group of engineered strains for synthesizing l-isoleucine using methanol as raw material

Abstract

The application discloses a kind of or / and multiple construction methods of engineering strain capable of growing or synthesizing L-isoleucine using methanol and other one-carbon feedstocks.The engineering strain realizes target function by the following genetic modification: overexpressing key enzyme genes such as acetolactate synthase, acetohydroxy acid isomeroreductase, dihydroxy acid dehydrase, branched-chain amino acid transaminase and homoserine dehydrogenase in a specific strain with methanol tolerance characteristics.The modified strain can synthesize L-isoleucine using methanol as carbon source, and has important application prospects in the field of biological manufacturing, etc.

Description

Technical Field

[0001] This invention belongs to the field of synthetic biology technology, and more specifically, relates to engineered strains that synthesize L-isoleucine from one-carbon compounds and their applications. Background Technology

[0002] L-Isoleucine is an essential branched-chain amino acid for humans and animals, widely used in feed additives, food fortifiers, and pharmaceuticals and fine chemicals. With the large-scale development of animal husbandry and the continuous expansion of the functional food and pharmaceutical markets, the market demand for L-isoleucine continues to grow. Currently, industrially, L-isoleucine is mainly produced through microbial fermentation, typically using multi-carbon sugars such as glucose and starch hydrolysate as primary raw materials. High-efficiency synthesis is achieved through metabolic engineering of microorganisms such as *Escherichia coli* and *Corynebacterium glutamicum*.

[0003] However, traditional fermentation production routes using sugars as raw materials suffer from high raw material costs, competition with food resources, limited carbon utilization efficiency, and high greenhouse gas emissions, which are detrimental to the sustainable development of the biomanufacturing industry. Therefore, developing novel biomanufacturing technologies that synthesize L-isoleucine using non-food carbon sources, especially one-carbon compounds (such as methanol, methane, formic acid, or carbon dioxide), has significant economic and environmental value.

[0004] One-carbon compounds are widely available, inexpensive, and can be obtained through industrial byproducts or renewable energy sources, making them an important carbon source for future biomanufacturing. However, one-carbon compounds have low biological assimilation efficiency and complex metabolic pathways, placing higher demands on the metabolic regulation and reducing power balance of microorganisms.

[0005] Furthermore, the biosynthesis of L-isoleucine is highly coupled with the valine and leucine pathways, and is more susceptible to carbon flow limitations when using one-carbon compounds as raw materials. Therefore, there is an urgent need to construct an engineered strain capable of efficiently assimilating one-carbon compounds and achieving the directed synthesis of L-isoleucine, along with its application methods, to promote the development of green, low-carbon, and sustainable L-isoleucine production technologies. Summary of the Invention

[0006] The technical problem to be solved by this invention is: how to synthesize L-isoleucine from one-carbon compounds.

[0007] To solve the above-mentioned technical problems, the present invention provides the following technical solutions:

[0008] In a first aspect, the present invention provides a recombinant bacterium capable of synthesizing L-isoleucine from methanol. The recombinant bacterium is obtained by performing at least one of the following modifications (1)-(9):

[0009] (1) Enhance the gene expression level of homoserine dehydrogenase, and / or enhance its enzyme activity or content;

[0010] (2) Enhance the gene expression level of homoserine kinase and / or enhance its enzyme activity or content;

[0011] (3) Enhance the gene expression level of threonine synthase and / or enhance its enzyme activity or content;

[0012] (4) Enhance the gene expression level of acetolactate synthase and / or enhance its enzyme activity or content;

[0013] (5) Enhance the gene expression level of acetylhydroxy acid isomer reductase, and / or enhance its enzyme activity or content;

[0014] (6) Enhance the gene expression level of dihydroxy acid dehydratase, and / or enhance its enzyme activity or content;

[0015] (7) Enhance the gene expression level of branched-chain amino acid transaminases, and / or enhance their enzyme activity or content;

[0016] (8) Enhance the gene expression level of threonine deaminase, and / or enhance its enzyme activity or content;

[0017] (9) Introduce the NADH kinase gene and / or introduce a substance with the activity of the enzyme.

[0018] Furthermore, the starting strain is a strain with methanol tolerance characteristics.

[0019] Furthermore, the methanol-tolerant strain can be a recombinant *Escherichia coli*. Even further, the recombinant *Escherichia coli* can be an *Escherichia coli* strain that has been artificially modified to possess a methanol utilization metabolic pathway. In some specific embodiments of the present invention, the recombinant *Escherichia coli* is *Escherichia coli* strain GL05 (accession number: CGMCC No. 35139).

[0020] The specific modification of (1) above can be: knocking out the gene (yghX) encoding the hydrolase and replacing it with the expression cassette (ilvBN) of the acetolactate synthase gene.

[0021] The modifications described in (2)-(3) above can be as follows: knock out the gene (livH) encoding the branched-chain amino acid uptake protein and replace it with the expression frames of the acetylhydroxy acid isomer reductase gene (ilvC) and the dihydroxy acid dehydratase gene (ilvD);

[0022] The above (4) modification can specifically be to replace the promoter of branched-chain amino acid transaminase (ilvE) with P119;

[0023] The above (5) modification can specifically be to replace the promoter of L-threonine deaminase (ilvA) with P119;

[0024] The modification in (6) above can be specifically as follows: knock out the gene (lpxM) encoding myristyltransferase and replace it with the expression cassette of the NADH kinase gene (pos5).

[0025] The modifications described in (7)-(9) above can be as follows: the expression frames encoding the aspartate kinase / homoserine dehydrogenase gene (thrA), the homoserine kinase gene (thrB), and the threonine synthase gene (thrC) are introduced into biological cells in the form of plasmids.

[0026] Furthermore, the NADH kinase (pos5) is derived from Saccharomyces cerevisiae.

[0027] The nucleotide sequence of the P119 promoter is SEQ ID No. 2; the NCBI reference sequence number of the large subunit of acetolactate synthase (ilvB) is NP_418127.1, and the NCBI reference sequence number of its encoding gene is Gene ID: 948182 (2025.12.09); the NCBI reference sequence number of the small subunit of acetolactate synthase (ilvN) is NP_418126.1, and the NCBI reference sequence number of its encoding gene is Gene ID: 948183 (2025.12.09); the NCBI reference sequence number of acetylhydroxy acid isomer reductase (ilvC) is NP_418222.1, and the NCBI reference sequence number of its encoding gene is Gene ID: 948286 (2025.12.09); the NCBI reference sequence number of the dihydroxy acid dehydrase (ilvD) is YP_026248.1, and the NCBI reference sequence number of its encoding gene is Gene ID: 948182 (2025.12.09). The reference sequence number is Gene ID: 948277 (2025.12.09); the NCBI reference sequence number of the branched-chain amino acid transaminase (ilvE) is YP_026247.1, and the NCBI reference sequence number of its encoding gene is Gene ID: 948278 (2025.12.09); the NCBI reference sequence number of the L-threonine deaminase (ilvA) is NP_418220.1, and the NCBI reference sequence number of its encoding gene is Gene ID: 948287 (2025.12.09); the NCBI reference sequence number of the homoserine dehydrogenase (thrA) is NP_414543.1, and the NCBI reference sequence number of its encoding gene is Gene ID: 945803 (2025.12.09); the NCBI reference sequence number of the homoserine kinase (thrB) is... The reference sequence number is NP_414544.1, and the NCBI reference sequence number of its encoding gene is Gene ID: 947498 (2025.12.09); the NCBI reference sequence number of the threonine synthase (thrC) is NP_414545.1, and the NCBI reference sequence number of its encoding gene is Gene ID: 945198 (2025.12.09); the NADH kinase (pos5) is derived from Saccharomyces cerevisiae, and its NCBI reference sequence number is NP_015136.1, and the NCBI reference sequence number of its encoding gene is Gene ID: 855913 (2026.1.24).

[0028] Furthermore, the methanol-tolerant strain can also be a Bacillus. Even further, the Bacillus can be Bacillus methanolicus. It can also be other naturally occurring or artificially modified Bacillus strains that already possess methanol utilization metabolic responses. In some specific embodiments of the present invention, the Bacillus is Bacillus strain YW01 (accession number: CGMCC No. 37312).

[0029] The modifications described in (4)-(5) above can be as follows: integrating the expression frames of the branched-chain amino acid transaminase gene (BmilvE) and the L-threonine deaminase gene (BmilvA) into the pflB site of the gene encoding pyruvate formate lyase.

[0030] The modifications described in (1)-(3) above can be as follows: the expression frames encoding the acetolactate synthase gene (BmilvBH), acetylhydroxy acid isomer reductase gene (BmilvC), and dihydroxy acid dehydratase gene (BmilvD) are introduced into the host cell in the form of plasmids.

[0031] The modification in (6) above can be specifically as follows: knock out the gene (acsA1) encoding acetyl-CoA synthase 1 and replace it with the expression cassette of the NADH kinase gene (pos5).

[0032] The modifications described in (7)-(9) above can be as follows: knock out the gene (acsA2) encoding acetyl-CoA synthase 2 and replace it with the expression frames of the homoserine dehydrogenase gene (hom1), homoserine kinase (BmthrB), and threonine synthase gene (BmthrC).

[0033] Furthermore, the acetolactate synthase large subunit gene (BmilvB), acetolactate synthase small subunit gene (BmilvH), acetolactate isomer reductase gene (BmilvC), dihydroxy acid dehydrase gene (BmilvD), branched-chain amino acid transaminase gene (BmilvE), threonine deaminase gene (BmilvA), homoserine dehydrogenase gene (Bmhom1), homoserine kinase gene (BmthrB), and threonine synthase gene (BmthrC) are derived from Bacillus methanolicus; and the NADH kinase gene (pos5) is derived from Saccharomyces cerevisiae.

[0034] The NCBI reference sequence number for the large subunit of acetolactate synthase (BmilvB) is AIE60946.1, and the NCBI reference sequence number for its encoding gene is CP007739.1:2541922..2543637 (complement) (2023.11.09); the NCBI reference sequence number for the small subunit of acetolactate synthase (BmilvH) is AIE60945.1, and the NCBI reference sequence number for its encoding gene is CP007739.1:2541407..2541925 (complement) (2023.11.09); the NCBI reference sequence number for the acetolactate isomer reductase (BmilvC) is AIE60944.1, and the NCBI reference sequence number for its encoding gene is CP007739.1:2540349..2541371. (complement) (2023.11.09); The NCBI reference sequence number of the dihydroxy acid dehydratase (BmilvD) is AIE60451.1, and the NCBI reference sequence number of its encoding gene is CP007739.1:2038255..2039967 (complement) (2023.11.09); The NCBI reference sequence number of the branched-chain amino acid transaminase (BmilvE) is AIE60947.1, and the NCBI reference sequence number of its encoding gene is CP007739.1:2543986..2544891 (complement) (2023.11.09); The NCBI reference sequence number of the threonine deaminase (BmilvA) is AIE60442.1, and the NCBI reference sequence number of its encoding gene is CP007739.1:2031089..2032357 (complement) (2023.11.09); The NCBI reference sequence number of the homoserine dehydrogenase (Bmhom1) is AIE61203.1, and the NCBI reference sequence number of its encoding gene is CP007739.1:2812494..2813792 (2023.11.09); The NCBI reference sequence number of the homoserine kinase (BmthrB) is AIE61201.1, and the NCBI reference sequence number of its encoding gene is CP007739.1:2810522..2811439 (2023.11.09); The NCBI reference sequence number of the threonine synthase (BmthrC) is AIE61202.1, and the NCBI reference sequence number of its encoding gene is CP007739.1:2811436..2812497 (2023.11).09); The NADH kinase (pos5) is derived from *Saccharomyces cerevisiae*, with NCBI reference sequence number NP_015136.1, and its encoding gene has NCBI reference sequence number Gene ID: 855913 (2026.1.24).

[0035] Furthermore, the methanol-tolerant strain can also be a yeast. More specifically, the yeast can be *Pichia pastoris* (classified as *Komagataella phaffii*) or *Hansenula polymorpha* (classified as *Candida parapolymorpha*). It can also be other naturally occurring or artificially modified yeast strains that already possess methanol utilization metabolism. In some specific embodiments of the present invention, the yeast serving as the recipient strain is *Hansenula polymorpha* strain AP17 (accession number: CGMCC No. 39154).

[0036] The modification of (1) above can specifically be: inserting the expression cassette of the acetolactate synthase gene (Opals) into the integration site CIS1;

[0037] The modifications described in (2)-(3) above can be as follows: inserting expression frames of the acetylhydroxy acid isomer reductase gene (OpilvC) and dihydroxy acid dehydrase gene (OpilvD) into the integration site CIS2;

[0038] The modifications described in (4)-(5) above can specifically be: inserting the expression frames of branched-chain amino acid transaminase gene (OpilvE) and L-threonine deaminase gene (OpilvA) into the integration site CIS3;

[0039] The modification in (6) above can specifically be: inserting the expression cassette of the NADH kinase gene (pos5) into the integration site CIS5;

[0040] The modifications described in (7)-(9) above can specifically be: inserting expression frames of the homoserine dehydrogenase gene (OpHDH), homoserine kinase gene (OpHK), and threonine synthase gene (OpTS) into the integration site CIS4;

[0041] Furthermore, the NADH kinase (pos5) is derived from Saccharomyces cerevisiae.

[0042] The NCBI reference sequence number for the large subunit of acetolactate synthase (OpALS) is XP_013932258.1, and the NCBI reference sequence number for its encoding gene is Gene ID: 25771930 (2023.02.17); the NCBI reference sequence number for the small subunit is XP_013933317.1, and the NCBI reference sequence number for its encoding gene is Gene ID: 25770799 (2025.07.09); the NCBI reference sequence number for acetolactate isomer reductase (OpilvC) is XP_013932677.1, and the NCBI reference sequence number for its encoding gene is Gene ID: 25772325 (2025.07.09); the NCBI reference sequence number for dihydroxy acid dehydratase (OpilvD) is XP_013937362.1, and the NCBI reference sequence number for its encoding gene is Gene ID: 25771930 (2023.02.17); The reference sequence number is Gene ID: 25771717 (2025.07.09); the NCBI reference sequence number for the branched-chain amino acid transaminase (OpilvE) is XP_013932746.1, and the NCBI reference sequence number for its encoding gene is Gene ID: 25772389 (2025.07.09); the NCBI reference sequence number for the L-threonine deaminase (OpilvA) is XP_013933765.1, and the NCBI reference sequence number for its encoding gene is Gene ID: 25771226 (2025.07.09); the NCBI reference sequence number for the homoserine dehydrogenase (OpHDH) is XP_013932360.1, and the NCBI reference sequence number for its encoding gene is Gene ID: 25771717 (2025.07.09). ID: 25772026 (2025.07.09); The NCBI reference sequence number of the homoserine kinase (OpHK) is XP_013932987.1, and the NCBI reference sequence number of its encoding gene is Gene ID: 25772620 (2025.07.09); The NCBI reference sequence number of the threonine synthase (OpTS) is XP_013932758.1, and the NCBI reference sequence number of its encoding gene is Gene ID: 25772401 (2025.07.09); The NADH kinase (pos5) is derived from Saccharomyces cerevisiae, and its NCBI reference sequence number is NP_015136.1, and the NCBI reference sequence number of its encoding gene is Gene ID: 855913 (2026.1.24).

[0043] In a second aspect, the present invention provides a recombinant bacterium, wherein the recombination is obtained by further modifying the recombinant bacterium described in the first aspect by at least one of the following modifications (10)-(12):

[0044] (10) Introduce the 3-phosphoglycerate phosphatase gene (pgp) and / or introduce a substance with the activity of this enzyme;

[0045] (11) Introduce the hydroxypyruvate dehydrogenase (hpdA) gene and / or introduce a substance with the activity of this enzyme;

[0046] (12) Introduce the xylulose 5-phosphate synthase (xps) gene and / or introduce a substance with the activity of the enzyme.

[0047] In a specific embodiment of the present invention using Escherichia coli GL05 strain as the starting strain, the modifications described above (10)-(12) can specifically be: knocking out the gene encoding acetate kinase (ackA) and replacing it with expression frames for the gene encoding 3-phosphoglycerate phosphatase (pgp), hydroxypyruvate dehydrogenase (hpdA), and xylulose 5-phosphate synthase (xps).

[0048] The amino acid sequence of the 3-phosphoglycerate phosphatase gene (pgp) is shown in SEQ ID NO.24, and the encoding gene sequence is shown in SEQ ID NO.18; the amino acid sequence of the hydroxypyruvate dehydrogenase gene (hpdA) is shown in SEQ ID NO.25, and the encoding gene sequence is shown in SEQ ID NO.19; the amino acid sequence of the 5-phosphoxulose synthase gene (xps) is shown in SEQ ID NO.26, and the encoding gene sequence is shown in SEQ ID NO.20.

[0049] In a specific embodiment of the present invention using Bacillus strain YW01 as the starting strain, the modifications described above (10)-(12) can be as follows: In the modification using Bacillus strain YW01 as the starting strain, the gene encoding acetyl-CoA synthase 3 (acsA3) is further knocked out and replaced with expression frames of 3-phosphoglycerate phosphatase gene (pgp), hydroxypyruvate dehydrogenase gene (hpdA) and 5-phosphoxulose synthase gene (xps).

[0050] The amino acid sequence of the 3-phosphoglycerate phosphatase gene (pgp) is shown in SEQ ID NO.24, and the encoding gene sequence is shown in SEQ ID NO.18; the amino acid sequence of the hydroxypyruvate dehydrogenase gene (hpdA) is shown in SEQ ID NO.25, and the encoding gene sequence is shown in SEQ ID NO.19; the amino acid sequence of the 5-phosphoxulose synthase gene (xps) is shown in SEQ ID NO.26, and the encoding gene sequence is shown in SEQ ID NO.20.

[0051] In a specific embodiment of the present invention using Hansenula polymorpha AP17 strain as the starting strain, the modifications described above (10)-(12) can be as follows: In the modification using Hansenula polymorpha AP17 strain as the starting strain, the expression frames of the 3-phosphoglycerate phosphatase gene (pgp), hydroxypyruvate dehydrogenase gene (hpdA) and 5-phosphoxulose synthase gene (xps) are further inserted at the integration site CIS8.

[0052] The amino acid sequence of the 3-phosphoglycerate phosphatase gene (pgp) is shown in SEQ ID NO.24, and the encoding gene sequence is shown in SEQ ID NO.21; the amino acid sequence of the hydroxypyruvate dehydrogenase gene (hpdA) is shown in SEQ ID NO.25, and the encoding gene sequence is shown in SEQ ID NO.22; the amino acid sequence of the 5-phosphoxulose synthase gene (xps) is shown in SEQ ID NO.26, and the encoding gene sequence is shown in SEQ ID NO.23.

[0053] Thirdly, the present invention provides a method for constructing a recombinant bacterium that can increase L-isoleucine production, the method comprising the step of modifying the starting strain according to the modification (1)-(9) described in the first aspect.

[0054] Fourthly, the present invention provides a method for constructing a recombinant bacterium capable of increasing L-isoleucine production, the method comprising the steps of modifying the starting strain according to the modifications (1)-(9) of the first aspect, and the steps of modifying according to the modifications (10)-(12) of the second aspect.

[0055] Fifthly, the present invention provides the use of the recombinant bacteria described in any one of the first to fourth aspects in the production or improvement of L-isoleucine production.

[0056] In a sixth aspect, the present invention provides a method for producing or increasing the yield of L-isoleucine, comprising the following steps: using methanol or formaldehyde as raw material, culturing the recombinant bacteria described in any one of the first to fourth aspects, collecting the culture, and obtaining L-isoleucine.

[0057] In this invention, the methanol feedstock can be derived from carbon dioxide and carbon dioxide-containing gases. Specifically, hydrogen can be generated by electrolyzing water, and then methanol can be synthesized from hydrogen and carbon dioxide through a chemical reaction.

[0058] The above-mentioned products may be bacterial agents containing the recombinant bacteria or / and cultures of the recombinant bacteria.

[0059] The term "culture" refers to a liquid or solid product (i.e., fermentation product) that has grown a microbial community after artificial inoculation and cultivation. It is a product obtained by growing and / or amplifying microorganisms; it can be a biologically pure culture of microorganisms, or it can contain a certain amount of culture medium, metabolites, or other components produced during the cultivation process.

[0060] The beneficial technical effects achieved by this invention are as follows:

[0061] This invention provides a recombinant bacterium that can efficiently synthesize L-isoleucine using raw materials such as methanol and formaldehyde, and establishes a route for synthesizing L-isoleucine using carbon dioxide, methanol, formaldehyde, etc., which has great economic and social value. Preservation Instructions

[0062] (1) Strain name: Hansenula polymorpha

[0063] Latin name: Ogataea parapolymorpha

[0064] Strain number: AP17

[0065] Preservation Institution: CGMCC - China General Microbiological Culture Collection Center

[0066] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing

[0067] Deposit date: March 11, 2026

[0068] CGMCC Registration Number: CGMCC No. 39154

[0069] (2) Bacterial strain name: Escherichia coli

[0070] Latin name: Escherichia coli

[0071] Strain number: GL05

[0072] Preservation Institution: CGMCC - China General Microbiological Culture Collection Center

[0073] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing

[0074] Deposit date: July 8, 2025

[0075] CGMCC Registration Number: CGMCC No. 35139

[0076] (3) Strain name: Bacillus

[0077] Latin name: Bacillus sp.

[0078] Strain number: YW01

[0079] Preservation Institution: CGMCC - China General Microbiological Culture Collection Center

[0080] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing

[0081] Deposit date: January 7, 2026

[0082] CGMCC Registration Number: CGMCC No. 37312 Attached Figure Description

[0084] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0085] Figure 1 The HPLC elution chromatogram of L-isoleucine (sample). Detailed Implementation

[0086] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0087] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0088] In the following examples, the yeast used as the recipient strain can be *Pichia pastoris* GS115, *Pichia pastoris* PP208, *Hansenula polymorpha* DL-1, or *Hansenula polymorpha* AP17. *Pichia pastoris* GS115 can be purchased from Invitrogen (catalog number C18100); *Hansenula polymorpha* DL-1 can be obtained from the American Type Culture Collection (ATCC) (number 26012); *Pichia pastoris* PP208 is described in patent CN119040152A, which is further derived from *Pichia pastoris* GS115, and can be constructed using *Pichia pastoris* GS115 as the starting strain according to patent CN119040152A. The PP208 strain already exhibits the following characteristics: enhanced expression of the alcohol oxidase (AOX) gene, dihydroxyacetone synthase (DAS) gene, dihydroxyacetone kinase (DAK) gene, and triose phosphate isomerase (TPI) gene. The *Hansenula polymorpha* AP17 strain is further derived from the *Hansenula polymorpha* DL-1 strain. The AP17 strain already exhibits the following characteristics: enhanced expression of the alcohol oxidase (AOX) gene, dihydroxyacetone synthase (DAS) gene, dihydroxyacetone kinase (DAK) gene, and triose phosphate isomerase (TPI) gene. *Hansenula polymorpha* AP17 is deposited at the China General Microbiological Culture Collection Center (CGMCC) (accession number CGMCC No. 39154). For specific construction methods, please refer to the applicant's patent application (application number: 202610482275.6; application date: April 13, 2026).

[0089] In the following examples, the *Escherichia coli* strain used as the recipient bacterium may be GL05. The *E. coli* GL05 strain is further derived from the *E. coli* MG1655 strain. The GL05 strain already includes the following characteristics: the introduction of the methanol dehydrogenase (MDH) gene, 3-hexylose-6-phosphate synthase (HPS), and 6-phosphate-3-hexose isomerase (PHI). *E. coli* GL05 is deposited at the China General Microbiological Culture Collection Center (CGMCC) (accession number CGMCC No. 35139). For specific construction methods, please refer to the applicant's patent application (application number: 202610394842.2; application date: March 29, 2026).

[0090] In the following examples, the Bacillus species used as recipient bacteria may be *Bacillus methanolica* PB1, *Bacillus methanolica* MGA3, *Bacillus methanolica* YL23, or *Bacillus methanolica* YW01. *Bacillus methanolica* PB1 can be obtained from the American Type Culture Collection (ATCC) (No. 51375). *Bacillus methanolica* MGA3 can be obtained from the American Type Culture Collection (ATCC) (No. 53907). *Bacillus methanolica* strain YL23 is described in patent CN120519332A. Strain YL23 already includes the following characteristics: presence of the methanol dehydrogenase (MDH) gene, 3-hexylose-6-phosphate synthase (HPS), and 6-phosphate-3-hexose isomerase (PHI). *Bacillus methanolica* YL23 is deposited at the China General Microbiological Culture Collection Center (CGMCC) (accession number CGMCC No. 29579). Strain YW01 is further derived from *Bacillus methanolica* strain YL23. Bacillus YW01 is deposited at the China General Microbiological Culture Collection Center (CGMCC) (accession number CGMCC No. 37312). For the specific construction method, please refer to the applicant's patent application (application number: 202610394839.0; application date: March 29, 2026).

[0091] In the following examples, plasmid pKD46 (CGSC#: 7739) is a product of the E. coli Genetic Depository, Yale University, USA (CGSC). The sequence information of plasmid pYB1k is described in patent CN119799606A. The sequence information of plasmid pSCre is described in patent CN120485085A. The sequence information of plasmid pPCCas is described in patent CN119040152A. The sequence of plasmid pYWCC12 is as shown in SEQ ID NO.46, and the specific construction method can be found in the applicant's patent application (application number: 202610394839.0; application date: March 29, 2026). Plasmid pYB1k contains an arabinose promoter for the expression of exogenous genes. The sequence of plasmid pUC57 can be found in GenBank: Y14837.1 (February 11, 1999) in the NCBI database. The pUC57 plasmid is a cloning vector; during gene synthesis, the synthesized gene is directly inserted into the EcoRV site of the pUC57 plasmid. The pKD46 and pSCre plasmids contain the temperature-sensitive origin of replication oriR101, which replicates normally at 30°C but is automatically lost at temperatures above 37°C. The pKD46 plasmid contains Gam, Exo, and Beta proteins, used to mediate syngenomic replication, while the pSCre plasmid contains Cre recombinase, used for the elimination of selectable marker genes. The pPCCas plasmid is used as a tool plasmid for gene editing in *Hansenula polymorpha*. The pYWCC12 plasmid is used as a tool plasmid for gene editing in *Bacillus*.

[0092] T4 DNA Ligase (Catalog No. M0202V), BbsⅠ-HF (Catalog No. R3539S), and DpnⅠ (Catalog No. R0176L) were purchased from NEB. The DNA gel rapid purification kit (Catalog No. EG101-02) was purchased from TransGen.

[0093] The sequences of the DNA fragments and primers involved in each embodiment of the present invention are detailed in Tables 1 and 2, respectively.

[0094] Table 1. List of Sequence Fragments

[0095] LKL SEQ ID NO.1 P119 SEQ ID NO.2 Ptrc SEQ ID NO.3 RBS1 SEQ ID NO.4 TrrnB SEQ ID NO.5 ilvEup SEQ ID NO.6 ilvEdown SEQ ID NO.7 ilvAup SEQ ID NO.8 ilvAdown SEQ ID NO.9 yghXup SEQ ID NO.10 yghXdown SEQ ID NO.11 livHup SEQ ID NO.12 livHdown SEQ ID NO.13 lpxMup SEQ ID NO.14 lpxMdown SEQ ID NO.15 ackAup SEQ ID NO.16 ackAdown SEQ ID NO.17 pgp1 SEQ ID NO.18 hpdA1 SEQ ID NO.19 xps1 SEQ ID NO.20 pgp2 SEQ ID NO.21 hpdA2 SEQ ID NO.22 xps2 SEQ ID NO.23 Pmdh SEQ ID NO.27 Tmdh SEQ ID NO.28 pflB_HRup SEQ ID NO.29 pflB_HRdw SEQ ID NO.30 RBS2 SEQ ID NO.31 acsA1_HRup SEQ ID NO.32 acsA1_HRdw SEQ ID NO.33 acsA2_HRup SEQ ID NO.34 acsA2_HRdw SEQ ID NO.35 acsA3_HRup SEQ ID NO.36 acsA3_HRdw SEQ ID NO.37 gpflB SEQ ID NO.38 gacsA1 SEQ ID NO.39 gacsA2 SEQ ID NO.40 gacsA3 SEQ ID NO.41 PMOX SEQ ID NO.42 TMOX SEQ ID NO.43 SgCIS1 SEQ ID NO.44 CIS1up SEQ ID NO.45 CIS1down SEQ ID NO.46 SgCIS2 SEQ ID NO.47 CIS2up SEQ ID NO.48 CIS2down SEQ ID NO.49 SgCIS3 SEQ ID NO.50 CIS3up SEQ ID NO.51 CIS3down SEQ ID NO.52 SgCIS4 SEQ ID NO.53 CIS4up SEQ ID NO.54 CIS4down SEQ ID NO.55 SgCIS5 SEQ ID NO.56 CIS5up SEQ ID NO.57 CIS5down SEQ ID NO.58 SgCIS8 SEQ ID NO.59 CIS8up SEQ ID NO.60 CIS8down SEQ ID NO.61 pYWCC12 SEQ ID NO.62 pos5 Gene ID: 855913 leuE Gene ID: 946157 ilvB Gene ID: 948182 ilvN Gene ID: 948183 ilvC Gene ID: 948286 ilvD Gene ID: 948277 ilvE Gene ID: 948278 thrA Gene ID: 945803 thrB Gene ID: 947498 thrC Gene ID: 945198 BmilvB CP007739.1:2541922..2543637(complement) BmilvH CP007739.1:2541407..2541925(complement) BmilvC CP007739.1:2540349..2541371(complement) BmilvD CP007739.1:2038255..2039967(complement) BmilvA CP007739.1:2031089..2032357(complement) Bmhom1 CP007739.1:2812494..2813792 BmthrB CP007739.1:2810522..2811439 BmthrC CP007739.1:2811436..2812497 BmilvE CP007739.1:2543986..2544891(complement) Opals1 Gene ID: 25771930 Opals2 Gene ID: 25770799 OpilvC Gene ID: 25772325 OpilvD Gene ID: 25771717 OpilvE Gene ID: 25772389 OpleuA Gene ID: 25771685 Ophdh Gene ID: 25772026 Ophk Gene ID: 25772620 Opts Gene ID: 25772401

[0096] Table 2 Primer Sequences

[0097] <![CDATA[ kan-R ]]> <![CDATA[ tcgtcaagaaggcgatagaa ]]> ilvE-1 taaactggtggacgtcgcacacgt ilvE-2 gcaccttcgcgtcttcccagc ilvE-3 cttactgtttagtcagttaaa ilvA-1 cttatgccagcctggcaacc ilvA-2 gcgcgcgcagcactgctctta ilvA-3 gtcaggtctcctttgccctgcg yghX-1 cagtgtcctttgccaggca yghX-2 gctcaagccaaattatgcgct yghX-3 caggagagatatttatcgaaccattt livH-1 gttcatccacggcagccaagtgatca livH-2 cccataaagacgcccgccag livH-3 ggtgtcttccagtggcacgccgacg lpxM-1 agttcaacagatttcgaatattctgaagca lpxM-2 ccggtacgcagtcagtaccggcttttttta lpxM-3 aacgccacatccggcctacagttcaatgat thrA-F aatttcacacaggaaacagaatgcgagtgttgaagttcggcgg thrC-R cttgcatgcctgcaggtcgactcttactgatgattcatca pTrc99a-01F gagtcgacctgcaggcatgcaagcttggct pTrc99a-01R tctgtttcctgtgtgaaattgttatccgct RV-M ttatgaatcgtcgtgcagatctggttcata pTrcHis-R attctgttttatcagaccgcttctgcgttc pYW_F tgtgaaaattgcgttgcgct pYW_R caggaaacagctatgaccatgattacg gpflB_F gtagatcttgaaggtccgactgaagctaca gpflB_R attgactgtagcttcagtcggaccttcaag pflB-F atggtcatagctgtttcctgggcatatgcttgtaatgg pflB-R agcgcaacgcaattttcacacgatgttcattgtcaatac pflB-U ggggatttcccaacacatg pflB-D cattggtcattcgtttctcc gacsA1_F gtagatgatgacaatggagcaccgcttcctc gacsA1_R attgacgaggaagcggtgctccattgtcatc acsA1-F atggtcatagctgtttcctgcttggactgggatggatgtttgttgtcgcc acsA1-R agcgcaacgcaattttcacattgaacatcttcgacatgaaataatggatg acsA1-U agtcggaatccgcagcggt acsA1-D tctgcatcgatggaaacagcatt gacsA2_F gtagataccctgaaacgtggtacaaaatgat gacsA2_R attgacatcatttgtaccacgtttcagggt acsA2-F atggtcatagctgtttcctggccttgctatgattctctccttc acsA2-R agcgcaacgcaattttcacaatcttatgattcctggtttg acsA2-U cctacaattgtttgccttt acsA2-D gaaagactggaacaggaaat gacsA3_F agattaccgggatggttcccgcaatga gacsA3_R tgactcattgcgggaaccatcccggtaa acsA3-F atggtcatagctgtttcctgacaagctctccataatttccggaaaaagc acsA3-R agcgcaacgcaatttcacaaaaaattttagttctgagaataagcttgc acsA3-U tggattcttatttgctgaaatggtgcttg acsA3-D ttacagcggaatgttatcatgttttttgcg <![CDATA[ pNW_F ]]> <![CDATA[ aagcttgcatgcctgcag ]]> <![CDATA[ pNW_R ]]> <![CDATA[ cgttgcgctcactgcccg ]]> <![CDATA[ PmdhF ]]> <![CDATA[ ctgcaggcatgcaagctttcttttatatgaaaaaataaa ]]> <![CDATA[ BmilvDR ]]> <![CDATA[ agcgggcagtgagcgcaacgttagagcttcgatgtttc ]]> AI1-1 acaaaacttgatgtcaataagtg AI1-2 agaagacagaacatctacaac AI1-F gatatatgtaatatgggtcgggg AI1-R cgttgagctaaaaggtttc AI2-1 ccacaggctttattggcag AI2-2 cggacgtggatgaaggtct AI2-F aaaagcgctcgtggtctaca AI2-R aaggcggcacgatcattgg AI3-1 gtgccgtgatcacagtcg AI3-2 acgatcgtgtctggcgtag AI3-F gagtatgcagtgctggtgc AI3-R ccaccacgcacaaccagg AI4-1 ttcaaactctagttcaagcga AI4-2 aggaaaatatcgatcatgtatagac AI4-F ggctcaacgagaatagctcc AI4-R caaaaagtgaaggatagaggc AI5-1 cactttcaaaaacgtagaattag AI5-2 ggatatgtgtttatgcttggc AI5-F gtactacagcatataacgtatg AI5-R ggatatacagatgcagattgg AI8-1 ttctctctcgaaacgtcgc AI8-2 ccagatctacatgcttgttgatc AI8-F aacttgtacggtgtgagc AI8-R cagcatatagaccagctgc

[0098] Example 1: Construction of Escherichia coli strain EMILE00-06

[0099] The relevant strains were prepared according to the following steps (1)-(2):

[0100] (1) Construction of strain EMILE01

[0101] Starting with Escherichia coli GL05, the promoter of the branched-chain amino acid transaminase gene ilvE (GenBank: NC_000913.3 (3952465-3952483) 09-DEC-2025) in this strain was replaced with the P119 promoter to obtain the EMILE01 strain.

[0102] The specific steps are as follows:

[0103] (1-a) Preparation of the target fragment EMILE-1

[0104] The synthesized DNA fragment is as follows: from 5' to 3', it consists of ilvEup, LKL (from 5' to 3', it consists of lox66, the Kan resistance gene, and lox71), and ilvEdown. Using ilvE-1 / ilvE-2 as primers, PCR amplification was performed with the synthesized DNA fragment as a template to obtain the targeting fragment EMILE-1.

[0105] (1-b) Preparation of host bacteria containing pKD46 plasmid

[0106] The pKD46 plasmid was transformed into the originating *E. coli* GL05 via calcium chloride conversion. After overnight incubation on LB agar plates containing ampicillin at 30°C, clones were selected to obtain recombinant *E. coli* GL05 / pKD46 containing plasmid pKD46. Upon induction with arabinose, GL05 / pKD46 expressed three recombinant proteins of λ phage, thus endowing the host bacteria with homologous recombination capabilities. GL05 / pKD46 competent cells were then prepared by washing with 10% glycerol.

[0107] (1-c) Homologous recombination

[0108] The targeting fragment EMILE-1 prepared in (1-a) was electroporated into GL05 / pKD46 competent cells prepared in (1-b). Cells were incubated overnight at 37°C on LB plates containing kanamycin (50 µg / mL). Genomic DNA was extracted from selected clones, and PCR amplification was performed using ilvE-3 / Kan-R primers. A positive result was indicated by the amplification of a target band of approximately 1000 bp. The positive clone was named EMILE01-kan. Sequencing analysis showed that the relevant target sequence on the genome of EMILE01-kan was correct, and the promoter region of the ilvE gene was replaced with the P119 promoter. EMILE01-kan was cultured overnight at 42°C to eliminate the temperature-sensitive plasmid pKD46.

[0109] (1-d) Elimination of resistance

[0110] The pSCre plasmid was transformed into the EMILE01-kan strain, which had pKD46 eliminated, using the calcium chloride transformation method. The strain was incubated overnight at 30°C on LB agar plates containing 50 mg / L streptomycin and 0.2% L-arabinose. The kanamycin resistance fragment was eliminated using the Cre recombinase on the pSCre plasmid. The strain was then incubated overnight at 42°C to eliminate the temperature-sensitive pSCre plasmid. The resulting strain was named EMILE01.

[0111] (2) Construction of strain EMILE02-06

[0112] Using the same method as in Example 1 (1), strains EMLEU02-EMLEU06 were obtained from strain EMLEU01. The construction process for each strain was exactly the same as in Example 1 (1), except that different starting strains, targeting fragments, amplification primers, and identification primers were used. For details of the starting strains, targeting fragments, amplification primers, identification primers, and obtained strains involved in each step of the construction process from GL05 to EMLEU06, please refer to Table 3. The fragment sequences and primer sequences are shown in Tables 1 and 2, respectively.

[0113] Table 3. Construction process of EMILE01-EMILE06

[0114] 1 GL05 EMILE-1 ilvEup, LKL, P119, ilvEdown Replace the promoter of the branched-chain amino acid transaminase gene (ilvE) with the P119 promoter. ilvE-1 / ilvE-2 ilvE-3 / KanR EMILE01 2 EMILE01 EMILE-2 ilvAup, LKL, P119, ilvAdown Replace the promoter of the L-threonine deaminase protein gene (ilvA) with the P119 promoter. ilvA-1 / ilvA-2 ilvA-3 / KanR EMILE02 3 EMILE02 EMILE-3 yghXup, LKL, P119, ilvBN, TrrnB, yghXdown The hydrolase gene (yghX) was knocked out and replaced with the expression cassette of the acetolactate synthase gene (ilvBN). yghX-1 / yghX-2 yghX-3 / KanR EMILE03 4 EMILE03 EMILE-4 livHup, LKL, P119, ilvC, RBS, ilvD, TrrnB, livHdown The branched-chain amino acid uptake protein gene (livH) was knocked out and replaced with expression cassettes of the acetylhydroxy acid isomer reductase gene (ilvC) and the hydroxy acid dehydratase gene (ilvD). livH-1 / livH-2 livH-3 / KanR EMILE04 5 EMILE04 EMILE-5 lpxMup, LKL, Ptrc, pos5, TrrnB, lpxMdown The gene encoding myristyltransferase (lpxM) was knocked out and replaced with the expression cassette of the NADH kinase gene (pos5). lpxM-1 / lpxM-2 lpxM-3 / KanR EMILE05 4 EMILE05 EMILE-6 ackAup, LKL, P119, pgp1, RBS, hpdA1, TrrnB, Ptrc, xps1, TrrnB, ackAdown The gene encoding acetate kinase (ackA) was knocked out and replaced with expression cassettes for the genes encoding 3-phosphoglycerate phosphatase (pgp), hydroxypyruvate dehydrogenase (hpdA), and xylulose 5-phosphate synthase (xps). ackA-1 / ackA-2 ackA-3 / KanR EMILE06

[0115] (3) Construction of production strains EMILE07 and 08

[0116] The specific steps are as follows:

[0117] (3-a) Construction of plasmid pTrc99a-ile

[0118] Construct plasmids overexpressing the aspartate kinase / homoserine dehydrogenase thrA gene, the homoserine kinase thrB gene, and the threonine synthase thrC gene.

[0119] A synthetically produced DNA fragment, with its 5' to 3' sequence being thrA, RBS1, thrB, RBS1, and thrC, was amplified by PCR using high-fidelity TransStart FastPfu DNA polymerase as primers thrA-F and thrC-R. The PCR product was denoted as E-ile. The target fragment E-ile was obtained by agarose gel electrophoresis and recovered. Using primers pTrc99a-01F and pTrc99a-01R, and plasmid pTrc99a (Beijing Zhuangmeng International Biotechnology Co., Ltd., catalog number ZK1610) as a template, the large vector fragment pTrc was amplified by PCR and recovered. The above fragments pTrc and E-ile were ligated using the Gibson assembly method (Gibson DG, Young L, et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat.methods. 2009; 6(5):343-345), and transformed into E. coli DH5α competent cells (purchased from Beijing Qingke Biotechnology Co., Ltd., product catalog TSC-C01). After recovery, the cells were evenly plated onto the corresponding antibiotic LB plates and cultured overnight at 37°C. Clones were picked, and PCR amplification using primers RV-M and pTrcHis-R was used to verify successful assembly, followed by sequencing. Positive clones were finally screened, and the plasmid was extracted and named pTrc99a-ile.

[0120] (3-b) Construction of production strains EMILE07 and 08

[0121] The plasmid pTrc99a-ile was transferred into the recombinant strain EMILE05 obtained in step (2) of Example 1 by calcium chloride conversion. After overnight culture at 37°C on LB plates containing 100 µg / mL ampicillin, clones were selected to obtain the production strain containing plasmid pTrc99a-ile, which was named EMILE07.

[0122] Following the steps above, starting from Escherichia coli EMILE06, plasmid pTrc99a-ile was introduced to obtain the EMILE08 strain.

[0123] Following the steps above, starting from Escherichia coli MG1655, plasmid pTrc99a-ile was introduced to obtain the EMILE00 strain.

[0124] Example 2: Production of L-Isoleucine using Recombinant Escherichia coli EMILE07,08

[0125] The test bacteria were recombinant Escherichia coli EMILE07 and EMILE08; the control bacteria was EMILE00.

[0126] The methanol culture medium used and its final concentrations are as follows: Na₂HPO₄: 25 mM, KH₂PO₄: 25 mM, NH₄Cl: 50 mM, Na₂SO₄: 5 mM, MgSO₄: 2 mM, methanol: 5 g / L, yeast extract: 0.5% (g / 100 mL). During the transformation process, methanol can be added to a final concentration of 5 g / L.

[0127] (1) Inoculate the overnight cultured strain into a shake flask containing 200 mL of LB medium at a 1% inoculation rate and incubate at 37°C for 3-4 h until OD. 600 After the concentration of nm was 0.6-0.8, arabinose was added to a final concentration of 0.2 g / L, and the cells were cultured at 37°C for 12 h. The cells were then collected by centrifugation at 8000 rpm for 10 min.

[0128] (2) The collected bacterial cells were resuspended in shake flasks containing 10 mL of methanol conversion medium and converted at 200 rpm and 37 °C for 24 h. The supernatant was then collected by centrifugation. High performance liquid chromatography (HPLC) was used, and the specific method is as follows (2,4-dinitrofluorobenzene pre-column derivatization HPLC): 50 μL of the supernatant was placed in a 2 mL centrifuge tube, and 200 μL of NaHCO3 aqueous solution (0.5 mol / L, pH 9.0) and 100 μL of 1% 2,4-dinitrofluorobenzene-acetonitrile solution (volume ratio) were added. The mixture was heated in a 60 °C water bath in the dark for 60 min, then cooled to 25 °C. 650 μL of KH2PO4 aqueous solution (0.01 mol / L, pH 7.2 ± 0.05, pH adjusted with NaOH aqueous solution) was added. After standing for 15 min, the mixture was filtered and injected. The injection volume was 15 μL.

[0129] Testing instrument: SHIMADZU LC-20AT

[0130] Detection conditions: Mobile phase A: 10 mM KH2PO4; Mobile phase B: Acetonitrile-methanol-water solution (volume ratio 45:45:10); Detection wavelength: 360 nm; Detection time: 35 min; Detection temperature: 40 ℃; Flow rate: 1 mL / min; Column: Extnd-C18 (5 μm, 4.6 mm i.d. × 250 mm); Gradient elution: 1 min 12% B; 2.5 min 12% B; 2.51 min 16% B; 13 min 36% B; 13.01 min 38% B; 25 min 100% B; 28 min 100% B; 28.01 min 10% B; 35 min controller stops.

[0131] The results showed that the L-isoleucine yield of the control strain EMILE00 was 0 g / L, that of strain EMILE07 was 0.25 ± 0.10 g / L, and that of strain EMILE08 was 0.44 ± 0.08 g / L. The constructed strains were able to effectively utilize methanol to synthesize xylitol.

[0132] The production characteristics of the relevant strains are shown in Table 4.

[0133] Table 4 Comparison of yields of different strains

[0134] EMILE00 0 EMILE07 0.25±0.10 EMILE08 0.44±0.08

[0135] Example 3: Construction of Bacillus YMILE00-04

[0136] The relevant strains were prepared according to the following steps (1)-(3):

[0137] (1) Construction of strain YMILE01

[0138] Starting with Bacillus YW01, pflB was knocked out and replaced with expression cassettes of branched-chain amino acid transaminase gene BmilvE and L-threonine deaminase gene ilvA.

[0139] The specific steps are as follows:

[0140] (1-a) Construction of sequence substitution tool plasmid pYWCC12_pflB

[0141] Primers gpflB_F and gpflB_R were synthesized at a concentration of 10 μM. The primers were mixed at a volume ratio of 1:1, then boiled in a boiling water bath for 5 min and allowed to cool naturally to room temperature. This mixture was named gpflB_F / R.

[0142] Take the mixture gpflB_F / R and plasmid pYWCC12, and prepare the reaction solution according to the following system (the same applies below), where T4 DNA Ligase was purchased from NEB (catalog number M0202V), and BbsⅠ-HF was purchased from NEB (catalog number R3539S). The reaction system is as follows: T4 DNA Ligase Buffer (10×) 1μL, rCutSmart (10×) 1μL, T4 DNA Ligase (400U / μL) 0.65μL, BbsⅠ-HF (20U / μL) 1μL, gpflB_F / R 1μL, pYWCC12 20ng, and ddH2O to make up to 10μL.

[0143] After preparation and mixing, the mixture was incubated at 37°C for 1 hour, followed by incubation at 60°C for 5 minutes. After cooling on ice, it was transformed into *E. coli* DH5α competent cells. Positive clones were screened and sent to Qingke Biotechnology for sequencing verification, ultimately yielding the correct plasmid pYWCC12_pflB. pYWCC12_pflB is a recombinant vector obtained by replacing the nucleotide sequence between positions 8879 and 8910 of pYWCC12 with the nucleotide sequence gpflB (CTTGAAGGTCCGACTGAAGCTACA). pYWCC12_pflB expresses the Cas12a protein and sgRNA targeting the *Bacillus* YW01 pflB gene.

[0144] (1-b) Construction of plasmid pYWCC12_pflB&BmilvE-ilvA

[0145] Using pYWCC12_pflB plasmid as a template and pYW_F and pYW_R as primers, the PCR product pYWCC12_pflB_BB was obtained by PCR amplification. Dpn I (NEB, catalog number R0176L) was added to the PCR product for digestion for 4 hours, and then the PCR product was recovered using a gel extraction kit to obtain the purified fragment pYWCC12_pflB_BB.

[0146] The DNA fragments synthesized by the gene are as follows: from 5' to 3', they are composed of the following: pflB_HRup, Pmdh, BmilvE, RBS2, ilvA, and pflB_HRdw.

[0147] Fragments pflB_HRup, Pmdh, BmilvE, RBS2, ilvA, pflB_HRdw, and pYWCC12_Ppdh_BB were ligated using 2× MultiF Seamless Assembly Mix via Gibson assembly. DH5α competent cells were transformed, positive clones were screened, and sent to Qingke Biotechnology for sequencing verification. The correct plasmid pYWCC12_pflB&BmilvE-ilvA was finally obtained.

[0148] (1-c) Preparation of competent cells

[0149] Bacillus YW01 was streaked on a nutrient medium plate and incubated overnight at 42°C. Freshly activated single colonies of YW01 were picked and placed in 10 mL of nutrient medium + 250 mM sucrose and incubated in a shaker at 42°C and 220 rpm for 16 h.

[0150] Take 1 mL of culture medium and inoculate it into an Erlenmeyer flask containing 50 mL of nutrient medium + 250 mM sucrose. Incubate at 42℃ and 220 rpm for 6-8 hours until OD (October Expiratory Response) occurs. 600 Approximately 0.8, then add glycine to a final concentration of 1% and continue culturing for 2 hours;

[0151] Incubate the bacterial culture on ice for 10 min, then centrifuge at 3000g to collect the bacterial cells. Resuspend the bacterial cells in 25 mL of buffer A (0.5 M D-sorbitol, 0.5 M D-mannitol, 10% glycerol), centrifuge at 3000g to collect the bacterial cells, and repeat this step twice. Finally, centrifuge and discard the supernatant. Resuspend the bacterial cells in 1 mL of buffer A and aliquot into 100 μL tubes for subsequent transformation experiments or freeze at -80℃ for later use.

[0152] (1-d) Transformation and positive clone screening

[0153] The competent cells were thawed on ice, and 1 μg of plasmid pYWCC12_pflB&BmilvE-ilvA was added and transferred to an electroporation cuvette for 10 min on ice. Then, the cells were placed in an electroporator for electroporation (2.5 kV, 25 μF, 200 Ω).

[0154] The cells were then resuspended in 1 mL of preheated nutrient medium and revived at 42°C and 220 rpm for 6 h. After revival, the bacterial solution was centrifuged at 3000 g for 5 min at room temperature. The bacterial cells were collected and spread on nutrient medium plates containing chloramphenicol and incubated at 42°C for 2-3 days.

[0155] Clones were selected, and clones that could amplify the target fragment (approximately 4000 bp) were identified using primers pflB-F / pflB-R and sequenced. The positive strain was named YW01_pflB&BmilvE-ilvA.

[0156] (1-e) Edit plasmid deletion

[0157] Single clones of YW01_pflB&BmilvE-ilvA were picked and placed in nutrient medium, and cultured at 42℃ and 220 rpm for 16-24 h. Then, they were transferred to fresh nutrient medium at a 1% inoculum rate and cultured at 50℃ and 220 rpm until OD. 600 The nm value was 1.5. The culture was subcultured 5 times at 50℃, and then streaked onto solid nutrient medium plates and cultured at 42℃ for about 36 hours.

[0158] Single colonies were selected and spotted onto solid nutrient media containing and without chloramphenicol, respectively. They were incubated at 42°C for 36 hours. Colonies that did not grow on chloramphenicol-containing plates but grew on non-chloramphenicol-containing plates were selected and preserved. This bacterium was named YMILE01. This bacterium is the engineered bacterium YW01 with the pyruvate-formate lyase gene pflB knocked out and replaced with the branched-chain amino acid transaminase gene BmilvE and the L-threonine deaminase gene ilvA.

[0159] (2) Construction of strain YMILE02-04

[0160] Table 5. Construction process of YMILE01-YMILE04

[0161]

[0162] (3) Construction of production strains YMILE05 and 06

[0163] (3-a) Construction of plasmid pNW33N-ile

[0164] A synthetic DNA fragment was used, with the sequence from 5' to 3' being: Pmdh, BmilvB, RBS2, BmilvH, Tmdh, Pmdh, BmilvC, RBS2, BmilvD. Using the DNA fragment as a template, PCR amplification was performed using PmdhF and BmilvDR as primers to obtain the B-ile fragment. The B-ile fragment was recovered by gel agarose gel electrophoresis.

[0165] Using pNW33N (purchased from Solarbio) plasmid as a template and pNW_F and pNW_R as primers, the PCR product pNW33N_BB was obtained by PCR amplification. Dpn I was added to the PCR product for digestion for 4 hours, and then the PCR product was recovered using a gel extraction kit to obtain the purified fragment pNW33N_BB.

[0166] Fragments B-ile and pNW33N_BB were ligated using 2× MultiF Seamless Assembly Mix via Gibson assembly, transformed into DH5α competent cells, screened for positive clones, and sent to Qingke Biotechnology for sequencing verification, finally obtaining the correct plasmid pNW33N-ile.

[0167] (3-b) Construction of production strains YMILE05 and YMILE06

[0168] The plasmid pNW33N-ile was transformed into strain YMILE03 using the transformation method described in Example 3 (1) to obtain strain YMILE05.

[0169] This transformation plasmid is a replication plasmid that can be stably replicated directly in YMILE03 and its derived engineered bacteria and overexpress acetolactate synthase, acetylhydroxy acid isomer reductase, and dihydroxy acid dehydratase under methanol-induced conditions.

[0170] Following the steps above, starting with YMILE04, the plasmid pNW33N-ile was introduced to obtain strain YMILE06.

[0171] Following the steps above, starting with YW01, the plasmid pNW33N-ile was introduced to obtain strain YMILE00.

[0172] Example 4: Production of L-Isoleucine using Bacillus strains YMILE05 and YMILE06

[0173] The overnight cultured YW01, YMILE05, YMILE06 and YMILE00 were inoculated at a rate of 1% into 200 mL of basal medium (pH=6.5) containing 10 g / L methanol and cultured at 42°C for 36 hours. The culture products were then collected.

[0174] The culture product was centrifuged, and the supernatant was collected. After derivatization, the content of L-isoleucine was determined by HPLC. The derivatization and analytical methods for L-isoleucine were the same as in Example 2.

[0175] The results showed that the supernatant yields of L-isoleucine produced by YW01, YMILE00, YMILE05, and YMILE06 were 0.05±0.02 g / L, 0.38±0.06 g / L, 1.25±0.49 g / L, and 1.41±0.66 g / L, respectively.

[0176] The production characteristics of the relevant strains are shown in Table 6.

[0177] Table 6. Comparison of yields of different strains

[0178] YW01 0.05±0.02 YMILE00 0.38±0.06 YMILE05 1.25±0.49 YMILE06 1.41±0.66

[0179] Example 5: Construction of yeast OPAILE01-06

[0180] The relevant strains were prepared according to the following steps (1)-(2):

[0181] (1) Enhance the expression of the acetolactate synthase (Opals) gene by increasing the gene copy number.

[0182] (1-a) Construction of plasmid pPCCas-gCIS1:

[0183] The opaCIS1 was chosen as the insertion site, its position on the chromosome of *Hansenula polymorpha* strain AP17 corresponding to the HPODL_01995 and HPODL_01996 genes on the chromosome of the initial strain DL-1. A synthetic DNA fragment (Kangwei Century Company) was used: the recognition fragment SgCIS1. Bases 62-81 of this fragment correspond to the N20 sequence (5'-accaacacaccttcatatc-3') at the opaCIS1 insertion site, and the remaining bases are the sgRNA backbone sequence. The synthesized recognition fragment was directly cloned into the pUC57 vector to obtain the plasmid pUC57-SgCIS1.

[0184] The construction of the tool plasmid pPCCas-CIS1 was performed using the following ligation reaction system: 1 μL T4 DNA Ligase Buffer (10×), 1 μL rCutSmart (10×), 0.65 μL T4 DNA Ligase, 1 μL BBSI-HF, 20 ng pPCCas plasmid, 140 ng pUC57-gCIS plasmid, and ddH2O to a final volume of 10 μL. The reaction was carried out at 37°C for 1 h, followed by 60°C for 5 min. The cells were then transformed into *E. coli* DH5α competent cells, plated on LB agar plates containing ampicillin, and incubated overnight at 37°C. Positive clones were selected and directly sequenced to verify their identity. The plasmid sequence of the positive clone was obtained by replacing positions 7012-7090 of the pPCCas plasmid with positions 13-83 of the recognition fragment SgCIS1. The positive clone plasmid was named pPCCas-CIS1.

[0185] (1-b) Preparation of the target fragment OPAILE-1

[0186] The artificially synthesized DNA fragment (Kangwei Century Company) consists of the following sequences from 5' to 3': CIS1up, PMOX, Opals1, TMOX, PMOX, Opals2, TMOX, and CIS1down. PMOX is the strong promoter Pmox gene sequence, and TMOX is the termination regulatory region Tmox gene sequence. Using AI1-1 / AI1-2 as amplification primers and the synthesized DNA fragment as a template, PCR amplification was performed to obtain the targeted fragment CIS1-ALS, which was then recovered via agarose gel.

[0187] (1-c) Transformation and identification of recombinant strains

[0188] The *Hansenula polymorpha* AP17 strain was transferred to 100 mL of liquid YPD medium and cultured at 37°C and 220 r / min until OD200. 600 The nm value was 1.3-1.5. The cells were then collected by centrifugation at 1500g and 4℃ for 5 min. After resuspending in 40 mL of pre-cooled sterile water, the cells were centrifuged again. The cells were washed twice with 20 mL of pre-cooled 1 M sorbitol and finally resuspended in 600 μL of pre-cooled 1 M sorbitol to prepare competent cells.

[0189] 50 ng of plasmid pPCCas-CIS1 and 100 ng of the targeting fragment OPAILE-1 were added to 80 μL of the above competent cells, and electroporation was performed using a suitable electroporator. Immediately afterward, 1 mL of YPD medium was added, and the cells were incubated statically at 37°C for 2 h. The cells were then plated on YPD agar plates containing bleomycin and incubated at 37°C for 2 days. Single clones were picked from the plates, transferred to YPD medium, and cultured with shaking at 37°C. PCR amplification was performed using the identification primers AI1-F / AI1-R. The PCR products were directly sequenced for identification; clones containing the complete targeting fragment sequence were considered positive.

[0190] Positive clones were streaked onto antibiotic-free YPD plates. Single colonies were picked and inoculated into YPD liquid medium, incubated at 37°C, and subcultured for three generations. The colonies were then streaked again onto YPD plates. Single colonies were selected, and strains that could not grow on YPD medium containing bleomycin were selected and named OPAILE01. This strain is a recombinant Hansenula polymorpha with acetolactate synthase (ALS) inserted at the opaCIS1 site on the chromosome.

[0191] (2) Construction of strain OPAILE02-OPAILE06

[0192] Using the exact same method as in Example 5(1), strains OPAILE02-OPAILE06 were obtained sequentially from strain OPAILE01. The construction process for each strain was exactly the same as in Example 5(1), except that different starting strains, recognition fragments, tool plasmids, amplification primers, targeting fragments, and identification primers were used. The construction process from strain AP17 to strain OPAILE06, including the starting strain, recognition fragment, tool plasmid, amplification primers, targeting fragment, identification primers, and information on the obtained strains at each step, is detailed in Table 7. The fragment sequences and primer sequences are shown in Tables 1 and 2, respectively.

[0193] Table 7. Construction process of OPAILE01-OPAILE06

[0194]

[0195] Example 6: Production of L-Isoleucine using yeasts OPAILE05 and OPAILE06

[0196] (1) Preparation of culture medium

[0197] The culture medium formula for growth is as follows: 26.7 mL phosphate, 0.93 g calcium sulfate, 18.2 g potassium sulfate, 14.9 g magnesium chloride heptahydrate, 4.13 g potassium hydroxide, 20.0 g glycerol, 12 mL trace elements, and distilled water to a final volume of 1 L.

[0198] Trace element formula: 6.0 g copper sulfate pentahydrate, 0.08 g sodium iodide, 3.0 g manganese sulfate monohydrate, 0.2 g sodium molybdate dihydrate, 0.02 g boric acid, 0.5 g cobalt chloride, 20.0 g zinc chloride, 65.0 g ferrous sulfate heptahydrate, 0.2 g biotin, 5.0 mL sulfuric acid, and distilled water to a final volume of 1 L.

[0199] The conversion medium formula is: disodium hydrogen phosphate 25 mM, potassium dihydrogen phosphate 25 mM, ammonium chloride 100 mM, methanol 5%, and trace elements 12 mL / L.

[0200] (2) Culture of bacterial cells and induction of enzymes

[0201] Overnight cultured Hansenula polymorpha AP17 cells (recipient yeast), engineered strains OPAILE05 and OPAILE06 were inoculated at a rate of 1% into shake flasks containing 200 mL of growth medium and cultured at 30°C for 1 day to obtain fermentation broth. The cells were then collected by centrifugation.

[0202] (3) Whole-cell catalysis of L-isoleucine

[0203] The experiment was repeated three times, with the following steps repeated each time: Bacterial cell treatment: OD 600 20 μL of *Hansenula polymorpha* AP17 cells were suspended in a 100 mL Erlenmeyer flask containing 20 mL of transformation medium and cultured at 30°C for 72 h. The supernatant was collected by centrifugation, derivatized, and then subjected to HPLC to determine the L-isoleucine content. The derivatization and analytical methods for L-isoleucine were the same as in Example 2.

[0204] The results are shown in Table 8. The L-isoleucine yield of AP17 was 0.02±0.04 g / L, the L-isoleucine yield of OPAILE05 was 0.69±0.10 g / L, and the L-isoleucine yield of OPAILE06 was 1.04±0.10 g / L.

[0205] Table 8 Comparison of yields of different strains

[0206] strain Yield (g / L) AP17 0.02±0.04 OPAILE05 0.69±0.10 OPAILE06 1.04±0.10

Claims

1. A recombinant bacterium, characterized in that: The recombinant bacteria can synthesize L-isoleucine using methanol as a raw material.

2. The recombinant bacteria according to claim 1, characterized in that: The recombinant bacteria were obtained by modifying the starting strain by at least one of the following methods: A1) Enhance the gene expression level of homoserine dehydrogenase, and / or enhance its enzyme activity or content; A2) Enhance the gene expression level of homoserine kinase, and / or enhance its enzyme activity or content; A3) Enhance the gene expression level of threonine synthase, and / or enhance its enzyme activity or content; A4) Enhance the gene expression level of acetolactate synthase, and / or enhance its enzyme activity or content; A5) Enhance the gene expression level of acetylhydroxy acid isomer reductase, and / or enhance its enzyme activity or content; A6) Enhance the gene expression level of dihydroxy acid dehydratase, and / or enhance its enzyme activity or content; A7) Enhance the gene expression level of branched-chain amino acid transaminases, and / or enhance their enzyme activity or content; A8) Enhance the gene expression level of threonine deaminase, and / or enhance its enzyme activity or content; A9) Introduce the NADH kinase gene and / or introduce a substance with the activity of this enzyme.

3. The recombinant bacteria according to claim 1 or 2, characterized in that: The recombinant bacteria also include at least one of the following operations performed on the starting strain: B1) Introduce the 3-phosphoglycerate phosphatase gene and / or introduce a substance with the activity of this enzyme; B2) Introduce the hydroxypyruvate reductase gene and / or introduce a substance with the activity of this enzyme; B3) Introduce the xylulose 5-phosphate synthase gene and / or introduce a substance with the activity of this enzyme.

4. The recombinant bacteria according to any one of claims 1 to 3, characterized in that: The starting strain is a strain with methanol tolerance characteristics; the strain with methanol tolerance characteristics is selected from at least one of the following strains: Ogataea parapolymorpha AP17 (CGMCC No. 39154); Escherichia coli GL05 (CGMCC No. 35139); Bacillus sp. YW01 (accession number: CGMCC No. 37312).

5. The use of the recombinant bacteria according to any one of claims 1 to 4 in the preparation of L-isoleucine.

6. A method for preparing L-isoleucine, characterized in that: The method includes using the recombinant bacteria as any one of claims 1 to 4 as the fermentation strain, and using methanol as the raw material to ferment and prepare L-isoleucine.

Images