Kluyveromyces marxianus genetically engineered bacteria and application thereof

Abstract

The application discloses a genetically engineered strain of Kluyveromyces marxianus Y215Pr and an application thereof. The genetically engineered strain Y215Pr expresses an exogenous truncated HMG-CoA reductase, a bifunctional enzyme phytoene synthase / phytoene cyclase, a phytoene dehydrogenase and a geranyl diphosphate synthase. The genetically engineered strain has remarkable effects in promoting proliferation of keratinocytes, scavenging free radicals, resisting inflammation, repairing skin barrier and moisturizing, and can be applied to a cosmetic production field as a raw material.

Description

Technical Field

[0001] This invention relates to the field of microbial genetic engineering, specifically to the genetically engineered strain of *Kluyveromyces martensii* and its applications. Background Technology

[0002] Carotenoids are a class of naturally occurring, fat-soluble yellow, orange-red, or red pigments synthesized by plants, algae, and some bacteria and fungi. Due to their excellent antioxidant, coloring, and bioactivity, they are widely used in food and feed, pharmaceuticals, and cosmetics. Because of their significant applications, the production of these pigments based on metabolic engineering and synthetic biology techniques has attracted considerable attention in recent years; however, achieving efficient and low-cost production remains a challenge. Carotenoids are important pigments for photosynthesis in plants. Based on their chemical structure and functional groups, they can be divided into carotenes and lutein. Carotenes include hydrocarbon compounds such as β-carotene, α-carotene, and lycopene; lutein includes oxygenated hydrocarbon compounds such as zeaxanthin, astaxanthin, and oxalool. Carotenoids produced through oxidative cleavage (such as crocin, crocin, β-ionone, and retinol) are classified as apocarotenoids. Crocin is a water-soluble carotenoid, which is more easily absorbed than other common fat-soluble pigments and has better effects in anti-oxidation, anti-inflammation and neuroprotection.

[0003] Currently, carotenoids are mainly obtained through plant extraction or chemical synthesis. However, plant extraction suffers from problems such as unstable raw material supply and the use of toxic solvents, while chemical synthesis exacerbates environmental degradation and is also costly. In contrast, microbial synthesis offers a more promising alternative. Using synthetic biology techniques, β-carotene and its derivatives can be produced efficiently in engineered microbial hosts. Compared to traditional methods, microbial synthesis significantly reduces dependence on natural plant resources, enables continuous and stable production in bioreactors, lowers costs, reduces environmental pollution, and aligns with green chemistry principles and sustainable development trends.

[0004] Max Kluyveromycin ( Kluyveromyces marxianusAs an unconventional yeast, *Kluyveromyces martensii* is a promising cell factory for producing heterologous proteins. Unlike traditional *Saccharomyces cerevisiae*, it is a Crabtree-negative yeast, meaning it does not undergo aerobic ethanol fermentation, thus avoiding the formation of toxic byproducts of ethanol under aerobic conditions. Furthermore, it can grow rapidly even at high temperatures (>40°C), effectively reducing the cost of cooling bioreactors and mitigating contamination risks in industrial production. In addition, *Kluyveromyces martensii* has the ability to utilize various sugars such as lactose and inulin to produce high-value enzymes such as inulinase and β-galactosidase, as well as chemical products such as ethanol, lactic acid, and fatty acids. Due to its food safety status, clear genetic background, and abundant synthetic biology tools, it is considered an ideal heterologous expression host. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies by providing a strain of Kluyveromyces martensii (Kluyveromyces). Kluyveromyces marxianus Genetically engineered bacteria and their applications.

[0006] The genetically engineered bacterium was named Y215Pr in the laboratory. It expresses exogenously truncated HMG-CoA reductase (tHMG), bifunctional enzymes phytoene synthase / lycopene cyclase (CrtBY), phytoene dehydrogenase (CrtI), and geraniol pyrophosphate synthase (CrtE).

[0007] Kluyveromyces marxianus Y215Pr was deposited on March 23, 2026 at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M2026491, located at Wuhan University, Wuhan, China.

[0008] The preparation method of Y215Pr strain includes: integrating the codon-optimized exogenous genes tHMG and Y215CrtBY into the ADH2 site of the starting strain, and integrating the codon-optimized exogenous genes PrCrtE and Y215CrtI into the GPD1 site of the starting strain. All exogenous genes are prepared according to... Kluyveromyces marxianus Codon optimization was performed. The nucleotide sequences of the tHMG gene are shown in SEQ ID NO.1, the Y215CrtBY gene in SEQ ID NO.2, the PrCrtE gene in SEQ ID NO.3, and the Y215CrtI gene in SEQ ID NO.4. The tHMG gene originally originated from *Saccharomyces cerevisiae*, the CrtBY and CrtI genes originally originated from *Rhodotorula rubrum*, and after codon optimization, they were named Y215CrtBY and Y215CrtI genes, respectively. The CrtE gene originally originated from *Rhodotorula rubrum*, and after codon optimization, it was named PrCrtE gene. The starting strain was... Kluyveromyces marxianus NBRC1777.

[0009] The amino acid sequence of the tHMG gene is shown in SEQ ID NO.5, the amino acid sequence of the Y215CrtBY gene is shown in SEQ ID NO.6, the amino acid sequence of the PrCrtE gene is shown in SEQ ID NO.7, and the amino acid sequence of the Y215CrtI gene is shown in SEQ ID NO.8.

[0010] This invention provides a method for obtaining bacterial cells by fermentation of the Y215Pr strain. The Y215Pr strain is subjected to large-scale fermentation culture, and the bacterial cells are collected. These cells can be used as raw materials for pigment extraction or preparation of cosmetic ingredients. The fermentation medium may contain, but is not limited to, the following: glucose 80 g / L, glycerol 10 g / L, yeast extract 5 g / L, sodium chloride 20 g / L, potassium dihydrogen phosphate 0.8 g / L, magnesium sulfate heptahydrate 0.41 g / L, and calcium chloride dihydrate 0.66 g / L. As one embodiment, the Y215Pr strain is cultured at 30℃ and 200 rpm for 48 hours, and the bacterial cells are collected after the culture is completed.

[0011] This invention also provides the application of the constructed Y215Pr strain in the preparation of products that promote keratinocyte proliferation. The products are prepared using Y215Pr strain fermentation products as raw materials.

[0012] This invention also provides the application of the constructed Y215Pr strain in the preparation of products that scavenge free radicals. The products are prepared using Y215Pr strain fermentation products as raw materials.

[0013] This invention also provides the application of the constructed Y215Pr strain in the preparation of products with anti-inflammatory effects. The products are prepared using the fermentation product cells of the Y215Pr strain as raw material.

[0014] The anti-inflammatory effect includes at least one of the following: (1) Downregulate the expression level of IL-1β in keratinocytes; (2) Downregulate the expression level of IL-6 in keratinocytes; (3) Downregulate the expression of MMP1 in keratinocytes.

[0015] This invention also provides the application of the constructed Y215Pr strain in the preparation of skin barrier repair and moisturizing products. The products are prepared using the fermentation product cells of the Y215Pr strain as raw materials.

[0016] The skin barrier repair and moisturizing includes at least one of the following: (1) Maintaining the expression of FLG in keratinocytes; (2) Promotes the expression of IVL in keratinocytes; (3) Promotes the expression of AQP3 in keratinocytes; (4) Promotes the expression of TGM1 in keratinocytes; (5) Promotes the expression of CASP14 in keratinocytes.

[0017] The types of products mentioned above are not limited to cosmetics.

[0018] The advantages of this invention are: This invention constructs a genetically engineered *Kluyveromyces martensii* strain that expresses exogenously truncated HMG-CoA reductase, bifunctional enzymes including phytoene synthase / lycopene cyclase, phytoene dehydrogenase, and geraniol pyrophosphate synthase. The Y215Pr strain exhibits significant effects in promoting keratinocyte proliferation, scavenging free radicals, anti-inflammation, skin barrier repair, and moisturizing, demonstrating the industrial application potential of the Y215Pr strain. Attached Figure Description

[0019] Appendix Figure 1 The image shown is an electrophoresis diagram of the first round of gene integration verification.

[0020] Appendix Figure 2 The image shown is an electrophoresis diagram of the second round of gene integration verification.

[0021] Appendix Figure 3 This is a diagram showing the results of promoting keratinocyte proliferation.

[0022] Appendix Figure 4 This is a graph showing the DPPH removal rate.

[0023] Appendix Figure 5 This is an image of the ELISA results for IL-1β.

[0024] Appendix Figure 6 This is a graph showing the ELISA results for IL-6 and MMP-1.

[0025] Appendix Figure 7 It is the expression level of keratinocyte filogranin (FLG) mRNA.

[0026] Appendix Figure 8 It is the expression level of intracellular lecithin (IVL) mRNA in keratinocytes.

[0027] Appendix Figure 9 It is the expression level of aquaporin 3 (AQP3) mRNA in keratinocytes.

[0028] Appendix Figure 10 It is the expression level of transglutaminase 1 (TGM1) mRNA in keratinocytes.

[0029] Appendix Figure 11 It is the expression level of caspase 14 (CASP14) mRNA in keratinocytes. Detailed Implementation

[0030] The specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings. Unless otherwise specified, the methods described are conventional methods. Unless otherwise specified, the materials described are readily available from publicly available commercial sources. The illustrative embodiments and descriptions of the present invention are used to explain the present invention and do not constitute an undue limitation of the present invention. It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other.

[0031] The strains used in the examples include the starting strain. Kluyveromyces marxianus NBRC1777 (hereinafter referred to as 1777) and the genetically engineered bacteria constructed in this invention Kluyveromyces marxianus Y215Pr (hereinafter referred to as Y215Pr), among which, Kluyveromyces marxianus NBRC1777 is a commercially available wild-type strain, screened from soil. Both strains were preserved in glycerol tubes. Salmon sperm DNA: purchased from Solarbio, salmon sperm DNA 10 mg / mL (catalog number: H1060). The four genes tHMG (sequence shown in SEQ ID NO.1), Y215CrtBY (sequence shown in SEQ ID NO.2), PrCrtE (sequence shown in SEQ ID NO.3), and Y215CrtI (sequence shown in SEQ ID NO.4) with optimized codons were synthesized by Qingke Biosynthesis Co., Ltd. Keratinocytes: Shanghai Aiji Biotechnology Co., Ltd. CCK8 detection kit: purchased from Beyotime CellCounting Kit-8 (C0037). ELISA kit: purchased from Linko Biotechnology, IL-1β (EK1138), MMP1 (EK1M01), IL6 (EK206). Reagents and equipment not mentioned are all commercially available or general-purpose equipment, and preparation and detection methods not specified are all conventional experimental methods in this field.

[0032] Example 1: Preparation and genetic transformation of Kluyveromyces martensii competent cells Step 1: Cell activation and culture YPD liquid culture medium: yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L.

[0033] Seed culture medium: YPD liquid medium.

[0034] The *Kluyveromyces martensii* 1777 strain to be transformed was inoculated into seed culture medium and cultured overnight. Then, the seed culture was cultured according to OD... 600An initial inoculation density of 0.1 was used to inoculate the culture into centrifuge tubes containing 5 mL of YPD liquid medium. The inoculated culture system was then placed in a 37°C constant temperature shaker and cultured overnight at 200-250 rpm for 20 hours to obtain active cells in the late logarithmic growth phase. Each 1 mL of overnight culture can be used as an independent transformation unit.

[0035] Step 2: Bacterial cell collection and preliminary washing Take 1 mL of the overnight culture obtained in step one and transfer it to a 1.5 mL sterile EP tube. Place the EP tube containing the bacteria in a centrifuge and centrifuge at 8000 rpm for 30 seconds to allow the bacteria to settle completely. Carefully discard the supernatant, avoiding disturbing the bacterial precipitate. Add 1 mL of sterile deionized water to the bacterial precipitate and resuspend the bacteria by vortexing or gentle aspiration. Centrifuge again at 8000 rpm for 30 seconds, discard the supernatant, and complete the preliminary washing step.

[0036] Step 3: Washing with LiAc / TE buffer and preparation of competent cells Add 500 μL of pre-cooled 1×LiAc / TE buffer (containing 0.1 M lithium acetate, 10 mM Tris-HCl, 1 mM EDTA, pH 7.5) to the bacterial pellet treated in step two, and gently pipette to mix. Centrifuge at 8000 rpm for 30 seconds and discard the supernatant. Repeat the above LiAc / TE buffer washing step once, for a total of two washings. After the last centrifugation, use a pipette to thoroughly remove any remaining supernatant, ensuring that there is no liquid residue on the bacterial surface, to obtain a pure competent cell pellet.

[0037] Step 4: Preparation of the conversion mixture Perform the following operations in an ice environment: Add the following components sequentially to the competent cell pellet obtained in step three, with the following dosage per 1 mL of original bacterial culture: Vector DNA: 10 μL salmon sperm DNA, boiled in a boiling water bath for 5 minutes before use, and immediately cooled in an ice bath; Guide RNA (gRNA): 1-1.5 μg, preferably 100-150 ng / μL; Exogenous DNA fragment: 2-3 μg; Dithiothreitol (DTT): Add an appropriate volume of 1 M DTT stock solution to make the final concentration of DTT in the final conversion system reach 10 mM, preferably 4 μL. Polyethylene glycol (PEG) solution: 300 μL, wherein the PEG solution is composed of 40% (w / v) PEG 4000, 0.1 M lithium acetate, 10 mM Tris-HCl (pH 7.5), and 1 mM EDTA; Use a pipette to repeatedly blow and aspirate to thoroughly mix the above components with the competent cells, forming a homogeneous transformation mixture.

[0038] It should be noted that the exogenous DNA fragment described in this invention contains four genes: tHMG, Y215CrtBY, PrCrtE, and Y215CrtI, and undergoes two independent transformations. The first transformation involves converting the tHMG-Y215CrtBY fragment to the ADH2 site, using 2-3 μg of the tHMG-Y215CrtBY fragment and 1-1.5 μg of gRNA targeting the ADH2 site. The second transformation involves converting the PrCrtE-Y215CrtI fragment to the GPD1 site, using 2-3 μg of the PrCrtE-Y215CrtI fragment and 1-1.5 μg of gRNA targeting the GPD1 site. After successful genomic verification following the first transformation, passage and plasmid removal are required, which takes approximately 3-4 days, after which the second transformation can be performed.

[0039] The guide RNA (gRNA) was independently constructed. The gRNA sequence targeting the ADH2 site is: caacgtctccgtctccgaaa (SEQ ID NO.9); the gRNA sequence targeting the GPD1 site is: gttgccggtatttccgttgc (SEQ ID NO.10).

[0040] Step 5: Heat shock treatment and conversion induction The transformation mixture obtained in step four was transferred to a constant temperature metal bath and incubated at 30°C for 15 minutes to allow the cells to adapt. Then the transformation mixture was transferred to a 47°C water bath for heat shock treatment for 15 minutes to promote the entry of exogenous DNA into the cells. After the heat shock treatment, the transformation mixture was immediately placed on ice to cool for 2-3 minutes.

[0041] Step Six: Resuscitation, Culture, and Screening The heat-shocked transformation mixture was briefly centrifuged at 8000 rpm for 1 minute to allow the bacterial cells to settle. The supernatant was carefully discarded, and the bacterial pellet was retained. 1 mL of fresh YPD liquid medium was added to the bacterial pellet, and the bacterial cells were gently resuspended by aspiration. The resuspended bacterial cells were placed in a 30°C incubator and allowed to recover and culture for 1.5 hours to allow the cells to regain activity and express the resistance marker gene. After the recovery culture, the mixture was centrifuged at 8000 rpm, and the supernatant was discarded. 100 μL of sterile deionized water was added to the bacterial pellet, and the bacterial cells were gently resuspended by aspiration. The resuspended bacterial suspension was evenly spread on a YPD solid selection plate containing hygromycin B (concentration of 300 μg / mL). The plate was placed in a 37°C incubator and inverted for 48 hours. Positive transformants were observed and picked.

[0042] Step 7: Preliminary Culture and Validation Preparation of Positive Clones Single colonies were picked from the screening plate and inoculated into EP tubes containing 1 mL of YPD liquid medium (containing 300 μg / mL hygromycin B). The inoculated culture system was placed in a constant temperature shaker at 37°C and cultured with shaking. After the bacterial culture showed obvious turbidity, the genome was extracted for verification. Positive clones that were verified were then expanded and preserved.

[0043] Step 8: Extraction of Genomic DNA ① Take 100-200 μL of bacterial culture (OD200) 600 ≈0.4), centrifuge at 5000 rpm for 2 minutes, and collect the bacterial pellet; ② Add 100 μL of lysis buffer (containing 200 mM lithium acetate, 1% SDS) to the bacterial pellet, resuspend thoroughly, and then transfer to a 1.5 mL EP tube; ③ Incubate the EP tube in a 70°C metal bath for 15 minutes, then add 300 μL of anhydrous ethanol directly to the tube and gently invert to mix. ④ Centrifuge at 12000 rpm for 5 minutes, discard the supernatant, and retain the precipitate; ⑤ Add 200 μL of 70% ethanol to the precipitate, wash the precipitate, centrifuge at 12000 rpm for 2 minutes, and discard the supernatant; repeat the above washing steps once; open the EP tube and place it in an oven to dry for 15-30 minutes. ⑥ Add 100 μL of sterile deionized water to the dried precipitate and gently blow or aspirate to fully dissolve the DNA; use a NanoDrop spectrophotometer to determine the DNA concentration and purity. ⑦ Store the extracted genomic DNA at -20°C for later use.

[0044] Step 9: PCR Validation of Integration Site For integration events at the ADH2 and GPD1 sites, specific validation primers were designed in the upstream genomic sequence and inside the integration fragment, respectively, and PCR amplification was performed for validation. The primer sequences are shown in Table 1.

[0045] Table 1 Primer sequences used for PCR validation

[0046] The first round of integration verification of tHMG-Y215CrtBY was successful:

[0047] The electrophoresis image for the first round of gene integration verification is shown below. Figure 1 As shown.

[0048] The second round of integration verification showed that PrCrtE-Y215CrtI integration was successful:

[0049]

[0050] The electrophoresis image for the second round of gene integration verification is shown below. Figure 2 As shown.

[0051] Example 2: Microbial culture and fermentation This invention employs a graded culture medium preparation system, specifically including three types: resuscitation medium, fermentation medium, and digestion medium.

[0052] The resuscitation medium was based on YPD medium and consisted of 10 g / L yeast extract, 20 g / L peptone, and 20 g / L glucose. After being sterilized by autoclaving at 121°C for 20 minutes, it was cooled in a clean bench for later use.

[0053] The main components of the fermentation medium were glucose 80 g / L, glycerol 10 g / L, yeast extract 5 g / L, sodium chloride 20 g / L, and potassium dihydrogen phosphate 0.8 g / L.

[0054] The fermentation medium was prepared separately into two components, A and B. Component A contained 0.41 g / L magnesium sulfate heptahydrate, and component B contained 0.66 g / L calcium chloride dihydrate. Both components were sterilized at 121℃ for 20 minutes. After the fermentation medium cooled, they were added to the main culture medium in sequence to form a complete fermentation system.

[0055] The bacterial culture process is divided into two stages: (1) Resuscitation culture: The strain was taken out from the -80℃ freezer, placed in a 37℃ water bath for rapid thawing, and then a single colony was inoculated into 100 mL of resuscitation medium. The culture was carried out at 30℃ and 200 rpm for 48 hours until the bacterial culture OD reached the limit. 600Seed culture was obtained when the value reached 10.6 (strain 1777) or 12.7 (strain Y215Pr); (2) Shake flask expansion culture: The revived seed liquid was transferred to the fermentation medium. The culture temperature was adjusted according to the characteristics of the strain. The 1777 strain was cultured at 25℃ and 200 rpm, and the Y215Pr strain was cultured at 30℃ and 200 rpm. The culture period was 48 hours. After the culture was completed, the bacterial cells were collected for subsequent experimental treatment.

[0056] Example 3: Sample Processing Take 20 g each of two bacterial cells, Y215Pr and 1777, and perform the following operations respectively: ① The bacterial cells were homogenized under high pressure with ultrapure water as the solvent. The homogenization was performed three times at 1000 bar to prepare 185 mL of homogenized solution. ② Mix the homogenized solution in advance, take 30 mL of each suspension, and centrifuge the sample. Centrifugation parameters: 7000 rpm, 10 min, room temperature; ③ After centrifugation, obtain the supernatant and precipitate. Separate the supernatant and precipitate into 50 mL centrifuge tubes. ④ Use 10% citric acid to adjust the pH of the supernatant to 4.5 and mix thoroughly; ⑤ Centrifuge the pH-adjusted supernatant again. Centrifugation parameters: 7000 rpm, 10 min, room temperature; ⑥ Take the supernatant as the sample to be tested, Y215Pr-S, 1777-S; ⑦ Resuspend the precipitate obtained in step ③ with 3 mL DMSO, vortex the precipitate thoroughly using a vortex shaker to make it a suspension again, and let it stand at room temperature for 10 min. ⑧ Centrifuge again at 7000 rpm for 10 min at room temperature; ⑨ Collect the supernatant as the test sample Y215Pr-P, 1777-P.

[0057] The obtained samples Y215Pr-S, 1777-S, Y215Pr-P, and 1777-P were also used in subsequent embodiments.

[0058] Table 2 Sensory Record Sheet for Sample Preparation

[0059] The distinctive pale orange color of Y215Pr, compared to 1777, indicates that the strain was successfully constructed.

[0060] Example 4: The effect of Y215Pr on promoting epidermal cell proliferation To investigate the proliferative effect of Y215Pr on keratinocytes, Epilife+S7+ triple antibody was used as the culture medium (hereinafter referred to as KC complete medium). Cells were seeded at a density of 8000 cells / well in 96-well plates and cultured at 37°C under constant humidity with CO2 until 80% confluence. Y215Pr-S and 1777-S were used as detection groups at 0.5% (v / v) and 1% (v / v), while Y215Pr-P and 1777-P were used as detection groups at 0.05% (v / v) and 0.1% (v / v). KC complete medium was used as a blank control (NT), and 1777 was used as the type strain for comparative testing. Cell viability was detected using a CCK8 assay kit. 24 hours after sample addition, remove the 96-well plate from the incubator, aspirate the culture medium, rinse twice with 1X PBS, add CCK8 detection working solution, and incubate for 1 hour in a 37°C constant humidity carbon dioxide incubator. After the solution changes color, use an ELISA reader to read the absorbance at 450 nm.

[0061] Relative percentage = (Sample average OD value / NT average OD value) * 100%.

[0062] according to Figure 3 It can be seen that both Y215Pr-S and Y215Pr-P can effectively enhance the proliferation capacity of keratinocytes, and can significantly promote the proliferation of keratinocytes compared with group 1777.

[0063] Example 5: Scavenging effect of Y215Pr on free radicals Weigh 3 mg of DPPH powder, add 72 mL of anhydrous ethanol, shake thoroughly to dissolve completely, store in the dark, and use within 5 hours. Dilute the above DPPH solution with anhydrous ethanol at a 2:1 volume ratio, and adjust the absorbance to the range of 0.6–1.0 to obtain the DPPH working solution. Accurately transfer different volumes of the test sample solution (Y215Pr-P and 1777-P were set up as 0.1% (v / v) as the detection group) into reaction tubes, add an appropriate amount of DPPH working solution, shake well, and react at room temperature in the dark for 30 min. Measure the absorbance A of the reaction solution at a wavelength of 519 nm using a spectrophotometer; at the same time, set up a blank control group (no sample added, only DPPH working solution added), and measure its absorbance, which is recorded as A0. The free radical scavenging capacity of the sample was calculated using the formula: DPPH free radical scavenging rate = (A0-A) / A0 × 100%. Three parallel experiments were set up for each sample, and the average value was taken as the final result. VC (vitamin C) was used as a positive control.

[0064] according to Figure 4 It is known that Y215Pr-P can effectively remove DPPH, but 1777-P cannot remove DPPH.

[0065] Example 6: Anti-inflammatory effects of Y215Pr on epidermal cells A model was created using UVB stimulation of keratinocytes to simulate skin inflammation caused by ultraviolet radiation. Keratinocytes were then stimulated at 10... 6 Cells were seeded in six-well plates and cultured until 80% confluence. UVB was applied at 150 mJ / cm². 2 Keratinocytes were treated with appropriate doses. A no-irradiation group served as a negative control, and an irradiation-only group (without sample) served as a blank control. Y215Pr-S and 1777-S were treated with 0.5% (v / v) and 1% (v / v) doses, while Y215Pr-P was treated with 0.1% (v / v) and 0.5% (v / v) doses as detection groups. After stimulation, cells were returned to the incubator and incubated for 24 h. The cell supernatant was then collected. After centrifugation at 10000 g for 1 min to remove impurities, the supernatant was used as the test sample. Inflammatory factors were measured using an ELISA kit.

[0066] according to Figure 5 It can be seen that both Y215Pr-S and 1777-S can downregulate the expression level of IL-1β, and Y215Pr-S at both concentrations significantly reduced the expression level of IL-1β more than the 1777 group. Figure 6 Y215Pr also showed that it could downregulate the expression levels of IL-6 and MMP-1.

[0067] UVB irradiation can induce keratinocytes to release inflammatory factors such as IL-1β and IL-6, as well as MMP-1 collagenase. Among them, IL-1β and IL-6 can trigger acute inflammatory reactions in the skin, damage the skin barrier function, aggravate post-inflammatory hyperpigmentation, and induce skin redness and sensitivity. MMP-1 directly degrades dermal collagen fibers, leading to dermal structure damage, decreased skin elasticity, wrinkle formation, and accelerated photoaging. The three factors work together to cause multiple damages to the skin, including sunburn, barrier damage, pigmentation disorders, and photoaging.

[0068] Example 7: The effects of Y215Pr-S and 1777-S on the expression levels of keratinocyte barrier and moisturizing-related mRNAs were detected by qPCR. Y215Pr-S and 1777-S were set as detection groups at 0.5% (v / v) and 1% (v / v), respectively, with NT serving as the blank control group. The primer sequences used are shown in Table 3.

[0069] Table 3 qPCR Primer Design Table

[0070] Filagrin (FLG) is a key functional protein specifically expressed by epidermal keratinocytes. Primarily existing in the granular layer in its precursor form, filaggrinogen, it is processed into mature monomers via enzymatic cleavage. These monomers mediate the orderly assembly of keratin fibers, maintaining the structural integrity of the stratum corneum and the skin's physical barrier function. As an important precursor to natural moisturizing factor (NMF), its degradation products participate in skin hydration regulation, maintenance of a slightly acidic environment, and UV protection, playing a crucial role in resisting external stimuli and reducing transepidermal water loss. Abnormal FLG expression or functional defects are closely related to dry skin, impaired skin barrier function, and various inflammatory skin diseases, making it valuable for applications in skin repair, moisturizing, and the development of related pharmaceutical and skincare products.

[0071] Depend on Figure 7 It can be seen that both concentrations of Y215Pr-S can effectively maintain the expression of FLG in keratinocytes, while 1777-S will downregulate the expression of FLG and weaken the barrier maintenance ability.

[0072] Involucrin (IVL) is a structural protein specifically expressed in the late stage of epidermal keratinocyte differentiation. As a core component of the stratum corneum, it mainly participates in the terminal differentiation process of keratinocytes. Through transglutaminase-mediated cross-linking reactions, it forms a stable and tough cell capsule structure with lipoproteins, proline-rich proteins, etc., enhancing the mechanical strength and barrier density of the stratum corneum, effectively reducing transepidermal water loss and resisting external physical and chemical stimuli. Normal expression and assembly of IVL are important markers of skin barrier maturity and functional stability. Abnormal expression levels are accompanied by skin barrier damage, dryness, and inflammatory skin lesions, making it of significant application value in the development of skin repair and barrier function improvement products.

[0073] Depend on Figure 8 It can be seen that both concentrations of Y215Pr-S can effectively promote the expression of IVL in keratinocytes, while 1777-S will downregulate the expression of IVL and weaken the barrier maintenance ability.

[0074] Aquaporin 3 (AQP3) is a transmembrane channel protein widely expressed on the membranes of epidermal keratinocytes. It primarily mediates the osmotic transport of small molecules such as water, glycerol, and urea, playing a crucial role in maintaining skin hydration, promoting stratum corneum moisture retention, and maintaining cellular metabolic homeostasis. AQP3 can efficiently regulate the exchange of water between the inside and outside of the skin, increasing skin moisture content and elasticity. Its expression level directly affects skin barrier function and moisturizing ability; abnormal expression can easily lead to dry skin, roughness, and impaired barrier function. Therefore, AQP3 has become an important target for the development of moisturizing and repairing skincare products and skin barrier repair products.

[0075] Depend on Figure 9It can be seen that both concentrations of Y215Pr-S can significantly promote the expression of AQP3 in keratinocytes, and the effect is more significant than that of 1777-S.

[0076] Transglutaminase 1 (TGM1) is a key functional enzyme in the differentiation of epidermal keratinocytes. It primarily catalyzes the covalent cross-linking of ε-(γ-glutamyl)-lysine residues in structural proteins such as outer coat proteins and nacelles, participating in the formation of a stable and robust keratinized capsule. TGM1 plays a crucial role in maintaining the integrity of the stratum corneum structure, enhancing skin barrier density, reducing moisture loss, and resisting external stimuli. Abnormal TGM1 expression or activity can directly lead to skin barrier defects and related skin conditions, making it of significant application value in the development of skin repair and barrier function improvement products.

[0077] Depend on Figure 10 It can be seen that both concentrations of Y215Pr-S can effectively promote the expression of TGM1 in keratinocytes, while 1777-S downregulates the expression of TGM1 and weakens the barrier maintenance ability.

[0078] Caspase 14 (CASP14) is a non-apoptotic protease specifically expressed in the epidermis. It is activated during the terminal differentiation stage of keratinocytes and mainly mediates the degradation of filaggrin into natural moisturizing factor (NMF), participating in maintaining the hydration homeostasis of the stratum corneum and the integrity of the skin barrier. It can also enhance the skin's resistance to UV damage. Abnormal expression or activity of CASP14 can lead to dry skin, barrier damage, and related skin conditions, making it an important target for the development of skin moisturizing and barrier repair products.

[0079] Depend on Figure 11 It can be seen that both concentrations of Y215Pr-S can significantly promote the expression of CASP14 in keratinocytes, and the effect is more significant than that of 1777-S.

[0080] The experiment in Example 7 demonstrates that Y215Pr-S has good barrier maintenance, promotes keratinocyte differentiation and moisturizing effects, and has the potential to be developed into skin care, moisturizing products or color cosmetics.

[0081] In summary, the genetically engineered strain Y215Pr of Kluyveromyces martensii constructed in this invention shows certain improvements over the strain before modification in promoting epidermal cell proliferation, free radical scavenging, and anti-inflammatory effects. It also has good barrier maintenance, keratinocyte differentiation promotion, and moisturizing effects.

[0082] The above description is only a preferred embodiment of the present invention. It should be noted that those skilled in the art can make several improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention.

Claims

1. A strain of Kluyveromyces martensii ( Kluyveromyces marxianus The genetically engineered bacterium Y215Pr is characterized by, The genetically engineered bacterium Y215Pr expresses exogenously truncated HMG-CoA reductase (tHMG), bifunctional enzymes phytoene synthase / lycopene cyclase (CrtBY), phytoene dehydrogenase (CrtI), and geraniol pyrophosphate synthase (CrtE). The amino acid sequence of the truncated HMG-CoA reductase tHMG is shown in SEQ ID NO.5, the amino acid sequence of CrtBY is shown in SEQ ID NO.6, the amino acid sequence of CrtE is shown in SEQ ID NO.7, and the amino acid sequence of CrtI is shown in SEQ ID NO.

8. The genetically engineered bacterium Y215Pr was deposited at the China Center for Type Culture Collection (CCTCC) on March 23, 2026, with accession number CCTCC NO: M2026491, and deposit address: Wuhan University, Wuhan, China.

2. The Kluyveromyces martensii as described in claim 1 ( Kluyveromyces marxianus Application of genetically engineered bacterium Y215Pr in the preparation of products that promote the proliferation of keratinocytes.

3. The Kluyveromyces martensii as described in claim 1 ( Kluyveromyces marxianus Application of genetically engineered bacteria Y215Pr in the preparation of products that scavenge free radicals.

4. The Kluyveromyces martensii as described in claim 1 ( Kluyveromyces marxianus Application of genetically engineered bacteria Y215Pr in the preparation of products with anti-inflammatory effects.

5. The application according to claim 4, characterized in that, The anti-inflammatory effect includes at least one of the following: (1) Downregulate the expression level of IL-1β in keratinocytes; (2) Downregulate the expression level of IL-6 in keratinocytes; (3) Downregulate the expression of MMP1 in keratinocytes.

6. The Kluyveromyces martensii as described in claim 1 ( Kluyveromyces marxianus Application of genetically engineered bacteria Y215Pr in the preparation of skin barrier repair and moisturizing products.

7. The application according to claim 6, characterized in that, The skin barrier repair and moisturizing includes at least one of the following: (1) Maintaining the expression of FLG in keratinocytes; (2) Promotes the expression of IVL in keratinocytes; (3) Promotes the expression of AQP3 in keratinocytes; (4) Promotes the expression of TGM1 in keratinocytes; (5) Promotes the expression of CASP14 in keratinocytes.

8. The application according to any one of claims 2-7, characterized in that, The product is made from Max Kluyveromycin ( Kluyveromyces marxianus It was prepared using the fermentation product cells of the genetically engineered bacterium Y215Pr as raw material.

9. The application according to claim 8, characterized in that, The fermentation medium for the genetically engineered strain Y215Pr is as follows: glucose 80 g / L, glycerol 10 g / L, yeast extract 5 g / L, sodium chloride 20 g / L, potassium dihydrogen phosphate 0.8 g / L, magnesium sulfate heptahydrate 0.41 g / L, and calcium chloride dihydrate 0.66 g / L.

10. The application according to claim 8, characterized in that, The fermentation culture conditions for the genetically engineered strain Y215Pr were 30℃ and 200 rpm for 48 hours.

Images