Pseudomonas huannanensis strain Q02, wastewater treatment agent and application thereof
Patent Information
- Application Number
- CN202611190732.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-08-06
- Publication Date
- 2026-09-25
AI Technical Summary
现有的这些微生物在实际应用中存在毒害抗性差、降解效率低、环境适应性差等问题
提供一株能够高效处理甲醛废水的菌株——湖南假单胞菌(Pseudomonashunanensis)Q02及其应用,并通过筛选和优化湖南假单胞菌的培养条件,显著提高其对甲醛的降解效率,拓宽其应用范围。
Smart Images

Figure CN122811049A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of environmental engineering technology, specifically relating to a strain of Pseudomonas hunanensis Q02 that can degrade formaldehyde pollutants in wastewater and its application in treating formaldehyde-containing wastewater. Background Technology
[0002] Formaldehyde (HCHO) is a colorless volatile organic compound (VOC) with a strong, pungent odor. It is an indispensable raw material and byproduct in many industrial production processes, such as resin, plastics, textiles, and preservative manufacturing. The International Agency for Research on Cancer of the World Health Organization has long classified formaldehyde as a Group 1 human carcinogen. Exposure to formaldehyde is closely associated with an increased risk of serious diseases such as nasopharyngeal carcinoma and leukemia. It can also cause a range of acute and chronic health problems, including eye and respiratory irritation, allergic reactions, and damage to the nervous system, with water pollution being the most typical example.
[0003] Currently, most formaldehyde wastewater treatment methods are physical or chemical, such as adsorption, combustion, and Fenton oxidation. These methods are simple to operate but costly. Biological methods, on the other hand, utilize the metabolic decomposition capabilities of microorganisms to convert formaldehyde into carbon dioxide and water, which is not only highly efficient but also economical and environmentally friendly. However, high concentrations of formaldehyde can inhibit the growth of microorganisms or even kill them, thus affecting the treatment effect of formaldehyde wastewater.
[0004] Currently, various microorganisms (non-mutant strains) have been used for the degradation of formaldehyde, such as Methylobacterium ( Methylobacterium ), Bacillus cereus ( Bacillus cereus ), Achromobacterium martensii ( Achromobacter ), Pseudomonas ( Pseudomonas These microorganisms include deep-sea bacteria (unidentified species). In high-concentration formaldehyde environments (≥200 mg / L), the growth and degradation ability of these microorganisms are inhibited, with varying degrees of degradation capacity. Among them, deep-sea bacteria are currently known to have the highest tolerance concentration, reaching 4000 mg / L. Existing microorganisms exhibit problems in practical applications, such as poor toxicity resistance, low degradation efficiency, and poor environmental adaptability. Furthermore, the currently known *Pseudomonas aeruginosa* (…) Pseudomonas hunanensis Its main uses are agricultural growth promotion and degradation of phenolic acid autotoxins (such as CN111690562A). Summary of the Invention
[0005] To address the shortcomings of existing technologies, the present invention aims to provide a strain of *Pseudomonas hunanensis* capable of degrading formaldehyde pollutants in wastewater. Pseudomonas hunanensis ) and its application in the treatment of formaldehyde-containing wastewater.
[0006] To achieve the above objectives, the solution adopted by the present invention is as follows: In a first aspect, the present invention provides a strain of *Pseudomonas hunanensis* capable of degrading formaldehyde pollutants in wastewater, wherein the *Pseudomonas hunanensis* is isolated from activated sludge. Pseudomonas hunanensis Q02, with accession number CCTCC M 20252492.
[0007] Preferably, the *Pseudomonas hunanense* ( Pseudomonas hunanensis The 16S rDNA gene sequence of Q02 is shown in SEQ ID NO.1.
[0008] Secondly, the present invention provides a wastewater treatment agent, wherein the effective components of the wastewater treatment agent include the Hunan Pseudomonas strain Q02 and / or Hunan Pseudomonas strain Q02 preparation as described above.
[0009] Preferably, the preparation of Hunan Pseudomonas strain Q02 is one or more of the following: Hunan Pseudomonas strain Q02 culture, lyophilized powder, fermentation broth, fermentation broth supernatant, and fermentation broth precipitate.
[0010] Thirdly, the present invention also provides the application of the Hunan Pseudomonas strain Q02 or the wastewater treatment agent as described above in the degradation of formaldehyde.
[0011] Preferably, the application is for removing formaldehyde from wastewater.
[0012] Preferably, the degradation is carried out under aerobic conditions.
[0013] Fourthly, the present invention provides a method for degrading formaldehyde in wastewater, the degradation method comprising the following steps: mixing the Hunan Pseudomonas strain Q02 or the wastewater treatment agent as described above with formaldehyde-containing wastewater for degradation treatment.
[0014] Preferably, the pH value of the degradation treatment is 4 to 9.
[0015] According to the present invention, the preservation information of a strain of *Pseudomonas hunanensis* that can degrade formaldehyde pollutants in wastewater is as follows: *Pseudomonas hunanensis* (… Pseudomonas hunanensis Q02 is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC M 20252492 and deposit date November 10, 2025.
[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: We provide a strain of Pseudomonas hunanense that can efficiently treat formaldehyde wastewater. Pseudomonas hunanensisThe study investigated Q02 and its applications, and through screening and optimization of the culture conditions of Hunan Pseudomonas, significantly improved its formaldehyde degradation efficiency and broadened its application scope.
[0017] The strain provided by this invention can grow in a culture environment where formaldehyde is the sole carbon source under acidic or alkaline stress, tolerates a pH range of 4–9, significantly reducing the cost of acid-base adjustment. It can tolerate high concentrations of formaldehyde and degrades it, with the final degradation products being CO2 and H2O. Therefore, this strain can achieve efficient, clean, and pollution-free bioremediation treatment. Its core advantages lie in its environmental friendliness, low operating costs, and high specific degradation capabilities, further enhancing its stability and large-scale application potential in complex industrial scenarios, and providing a new strain resource for environmental pollution remediation. Attached Figure Description
[0018] The present invention will be further described below with reference to the accompanying drawings and specific embodiments.
[0019] Figure 1 This is a colony morphology diagram of Pseudomonas hunanensis Q02, which is involved in this invention.
[0020] Figure 2 This invention relates to a phylogenetic tree of Pseudomonas hunanensis Q02 strain based on its 16S rDNA sequence.
[0021] Biological Preservation Information Hunan Pseudomonas ( Pseudomonas hunanensis Q02 was deposited on November 10, 2025 at the China Center for Type Culture Collection, located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, China (with accession number CCTCC M 20252492) and postal code 430072. Detailed Implementation
[0022] To make the technical means, creative features, objectives and effects of this invention easier to understand, the invention will be further explained below with reference to specific examples.
[0023] In this invention, "formaldehyde wastewater" refers to industrial wastewater, domestic sewage, or other water bodies containing formaldehyde.
[0024] In this invention, "culture" refers to the product prepared by inoculating the strain into any suitable culture medium. The type of culture medium can be replaced according to different needs, including the optimization of the composition of commonly used culture media.
[0025] In this invention, "preparation" refers to the product prepared by the strain of this invention. The preparation method can be any existing method or any possible future method. The characteristic is that it is prepared by the strain of this invention, and the preparation method can be diverse.
[0026] In this invention, "OD" 600 "" refers to the optical density value measured at a wavelength of 600 nm, used to indicate the concentration of bacteria in a bacterial suspension.
[0027] Example 1: Screening and identification of degrading strains 1.1 Materials and Methods 1.1.1 Culture Media and Reagents (1) LB solid medium: Weigh 10 g of peptone, 5 g of yeast powder and 10 g of NaCl, 2% (w / v) agar, add water to make up to 1000 mL, autoclave at 121℃ for 30 min, cool the sterilized medium to 50℃, mix well and pour into petri dishes, cool and set aside.
[0028] (2) Inorganic salt culture medium composition: NaCl 1.0 g / L, (NH4)2SO4 1.0 g / L, K2HPO4 1.5 g / L, KH2PO4 0.5 g / L, MgSO4·7H2O 0.2 g / L and water 1 L, pH 7.0, culture medium sterilized at 121℃ for 30 min.
[0029] (3) Initial screening medium: Inorganic salt medium is prepared by adding 2% (w / v) agar and 500 mg / L formaldehyde to form a solid medium.
[0030] (4) Formaldehyde wastewater with pH 6.5 to pH 7.5 and concentrations of 500 mg / L, 1000 mg / L, 1500 mg / L and 2000 mg / L.
[0031] 1.1.2 Determination of formaldehyde content Formaldehyde solutions of 1 mg / L, 2 mg / L, 5 mg / L, 10 mg / L, 20 mg / L, 50 mg / L, 100 mg / L, 200 mg / L, 500 mg / L, 1000 mg / L, 1500 mg / L, and 2000 mg / L were prepared, and the absorbance was measured using a UV-Vis spectrophotometer to plot a formaldehyde concentration standard curve.
[0032] After the formaldehyde wastewater inoculated with Q02 was cultured, the bacterial cells in the culture medium were filtered through a 0.22 μm filter membrane, and the formaldehyde concentration of the filtrate was determined using the acetylacetone method.
[0033] The degradation rate is calculated using the following formula: Degradation rate (%) = (Residual concentration of control sample - Residual concentration of treated sample) / Residual concentration of control sample × 100%.
[0034] 1.2 Initial screening of degrading strains 10.00 g of activated sludge sample was weighed to prepare a sludge-water mixture solution. 100 μL of the solution was spread onto the surface of a primary screening solid culture medium and incubated at 28℃ for 48 h. After single colonies grew on the surface of the culture medium, they were selected based on colony morphology, color, and size, purified, and preserved on solid culture medium to finally obtain strain Q02, which can utilize formaldehyde as the sole carbon source for growth.
[0035] 1.3 Secondary screening of degrading strains After the strain Q02, which had been grown and purified on the initial screening medium, was inoculated into LB liquid medium and cultured for 24 h, the bacterial cells were obtained by centrifugation and OD was calculated. 600 A bacterial suspension with a concentration of 0.2 mg / L was inoculated into formaldehyde wastewater at concentrations of 500 mg / L, 1000 mg / L, 1500 mg / L, and 2000 mg / L. The wastewater was cultured under aerobic conditions at pH 6.5–7.5, 25–35°C, and a rotation speed of 180 rpm. Samples were taken every 24 hours to determine the formaldehyde content.
[0036] 1.4 Identification of degrading strains 1.4.1 Morphological identification The isolated and purified strain was inoculated onto LB solid medium using the four-zone streak method and incubated at 28°C for 24 hours. The colony morphology of Q02 was as follows: milky white, round, smooth surface, neat edges, and relatively large colonies. Figure 1 As shown.
[0037] 1.4.2 Molecular biological identification The Q02 strain obtained by screening and purification was inoculated into LB liquid medium and cultured for 24 h. Bacterial genomic DNA was extracted and PCR amplified using the universal primers 27F and 1492R for bacterial 16S rDNA. The primer sequences are shown in Table 1.
[0038] Table 1 Primer Design
[0039] The PCR reaction system is shown in Table 2.
[0040] Table 2 PCR amplification reaction system
[0041] The PCR reaction procedure is shown in Table 3.
[0042] Table 3 PCR amplification reaction procedure
[0043] The PCR amplification products were subjected to agarose gel electrophoresis, and the gel was recovered and purified. The purified products were then subjected to Sanger sequencing to obtain forward and reverse sequencing results. The 16S rDNA sequence is shown in SEQ ID NO.1.
[0044] The obtained data were assembled using DNAMAN software and compared with the 16S rDNA sequence in the EzBioCloud database. A phylogenetic tree was constructed using MEGA 5.0 software with the Neighbor-Joining method, bootstrap confidence values estimated at 1000 replicates, to determine the position of strain Q02 within the phylogenetic tree. Figure 2 As shown. The identification and comparison results indicate that strain Q02 is *Pseudomonas hunanense* (…). Pseudomonas hunanensis ).
[0045] 1.5 Conclusion A highly efficient strain of bacteria, Q02, capable of treating formaldehyde-containing wastewater, was isolated from activated sludge of a company in Changchun City, Jilin Province. Its preservation number is CCTCC M 20252492. 16S rDNA identification confirmed it as *Pseudomonas hunanense*. Pseudomonas hunanensis ).
[0046] Example 2: Treatment performance of strain Q02 on formaldehyde wastewater This invention obtained a strain of *Pseudomonas hunanensis* capable of degrading formaldehyde in wastewater through screening and purification. Pseudomonas hunanensis Q02 has the function of efficiently degrading formaldehyde in wastewater.
[0047] OD was prepared from strain Q02 according to the method in Example 1.3. 600 A bacterial suspension with a concentration of 0.2 mg / L was inoculated at a rate of 2% (v / v) into inorganic salt media (pH 7.0) containing formaldehyde at concentrations of 500 mg / L, 1000 mg / L, 1500 mg / L, 2000 mg / L, 2500 mg / L, and 3000 mg / L. After aerobic incubation at 30°C and 180 r / min for 24 h, samples were taken, and the residual formaldehyde concentration was determined using the acetylacetone spectrophotometric method to calculate the degradation rate. The same culture medium without inoculation served as a blank control.
[0048] Each group had three parallel samples, and the experimental results are expressed as averages. The experimental results are shown in Table 4.
[0049] Table 4. Degradation rate of Q02 at different initial formaldehyde concentrations over 24 hours
[0050] As shown in Table 4, the degradation rate can reach over 99% after 24 hours when the formaldehyde concentration is 2000 mg / L; over 90% after 24 hours when the formaldehyde concentration is 2500 mg / L; and over 80% after 24 hours when the formaldehyde concentration is 3000 mg / L.
[0051] Q02 bacterial suspension (OD) 600 =0.2) The strain was inoculated at a rate of 2% (v / v) into an inorganic salt medium (pH 7.0) containing 4000 mg / L formaldehyde. After aerobic incubation at 30℃ and 180 r / min for 24 h, samples were taken for analysis. The results showed that the strain maintained its activity and demonstrated formaldehyde degradation even at a formaldehyde concentration of 4000 mg / L.
[0052] Example 3: Degradation effect of strain Q02 on complex industrial wastewater A complex industrial wastewater containing multiple toxic components was collected, with a COD of 5000 mg / L, a polyoxymethylene concentration of 2000 mg / L, and a formaldehyde concentration of 1200 mg / L. A Q02 bacterial suspension (OD200 mg / L) was prepared. 600 =0.2) Inoculate the wastewater at a rate of 2% (v / v), and incubate aerobically at 30℃ and 180 r / min for 24 h. After incubation, take samples and determine the formaldehyde residual concentration using the acetylacetone spectrophotometric method to calculate the degradation rate. Use the same wastewater without inoculation as a blank control. Set up 3 parallel samples for each group.
[0053] Experimental results show that Q02 can maintain high degradation activity in complex wastewater containing multiple toxic components (COD 5000 mg / L, polyoxymethylene 2000 mg / L, formaldehyde 1200 mg / L), and the formaldehyde degradation rate can reach more than 98% in 24 h, making it suitable for the treatment of complex industrial wastewater.
[0054] Example 4: pH tolerance of strain Q02 Q02 bacterial suspension (OD) 600 =0.2) Inoculate 2% (v / v) into an inorganic salt culture medium containing 2000 mg / L formaldehyde. Adjust the initial pH to 4.0, 5.0, 6.0, 7.0, 8.0, and 9.0 with 1 mol / L HCl solution or 1 mol / L NaOH solution, respectively. After aerobic incubation at 30℃ and 180 r / min for 24 h, samples were taken, and the residual formaldehyde concentration was determined by acetylacetone spectrophotometry to calculate the degradation rate. Three replicates were set up for each group, and the experimental results are expressed as average values.
[0055] The experimental results are shown in Table 5.
[0056] Table 5 Effect of initial pH on the degradation of formaldehyde (2000 mg / L) by Q02
[0057] Table 5 shows that strain Q02 maintains high formaldehyde degradation activity (degradation rate ≥85%) within an initial pH range of 4 to 9, indicating that this strain has a wide pH adaptability. During the degradation process, the pH of the reaction system can rapidly drop to around 4, and strain Q02 can still maintain its activity and continue to complete the degradation of formaldehyde under acidic conditions. This characteristic can significantly reduce the cost of acid-base adjustment in industrial applications.
[0058] Example 5: Metabolic pathway analysis of formaldehyde degradation by strain Q02 Q02 bacterial suspension (OD) 600 =0.2) was inoculated into an inorganic salt medium containing 2000 mg / L formaldehyde (pH 7.0) and cultured aerobically at 30℃ and 180 r / min. Samples were taken at 0, 6, 12, and 24 h. After filtration through a 0.22 μm microporous membrane, the accumulation of formic acid in the culture medium was detected by high performance liquid chromatography (HPLC), and other possible organic metabolic byproducts were detected by gas chromatography-mass spectrometry (GC-MS).
[0059] The test results showed that formic acid and other organic metabolic byproducts besides formaldehyde and formic acid were not detected in the culture medium throughout the entire degradation process. Combined with the continuous decrease in formaldehyde concentration and the increase in bacterial biomass, this indicates that the metabolic pathway of formaldehyde by Q02 is: formaldehyde → formic acid → CO2. Formaldehyde is catalyzed and oxidized to formic acid by formaldehyde dehydrogenase, and formic acid is completely oxidized to carbon dioxide (CO2) by formic acid dehydrogenase, releasing electrons that are transferred to the respiratory chain to generate energy (ATP). The reaction equation is: HCOOH → CO2 + 2H+ + +2e - This degradation process does not produce secondary pollution and is environmentally friendly.
[0060] Basis for excluding other end products: (1) No formic acid accumulation: Formic acid dehydrogenase activity is high, and formic acid is oxidized immediately; (2) No C1 compound transformation: No methanogenic or acetic acid production ability (anaerobic pathway) has been reported in Hunan Pseudomonas. (3) Formaldehyde-free polymerization: Formaldehyde does not spontaneously form polymers (such as trioxymethylene) under physiological conditions.
[0061] Example 6: Comparative experiment between Q02 and existing formaldehyde-degrading bacteria To more intuitively demonstrate the superiority of the Q02 strain of this invention over the prior art, this embodiment conducted a parallel comparative experiment with several typical formaldehyde-degrading bacteria (or compound bacterial agents) currently reported under the same experimental conditions.
[0062] The sources and key information of each control strain are shown in Table 6. All strains were activated and prepared into bacterial suspensions according to their respective optimal culture conditions (temperature, pH, inoculum size, etc.), and then uniformly inoculated into inorganic salt culture medium containing the same initial formaldehyde concentration (2000 mg / L). Degradation experiments were carried out under aerobic conditions, and residual formaldehyde concentrations were measured periodically until the degradation rate no longer changed significantly. The treatment time required to reach the maximum degradation rate was recorded.
[0063] Table 6 Comparison of strain information
[0064] The results of the comparative experiments are shown in Table 7.
[0065] Table 7 Comparison of formaldehyde (2000 mg / L) degradation performance of different strains
[0066] *Note: The data for the comparative strains are derived from the best embodiments in their corresponding patent documents, and some data are estimated values from charts.
[0067] As shown in Table 7, under the same initial formaldehyde concentration (2000 mg / L), the Hunan Pseudomonas Q02 provided by this invention achieved a degradation rate of 99.2% in just 24 hours, with a final residual formaldehyde concentration as low as 16 mg / L. In contrast, *Rhodotorula glutinis* required up to 192 hours to achieve a degradation rate of approximately 90%; *Rhodotorula glutinis* required 52 hours to achieve a degradation rate of approximately 95%; although the comparative compound bacterial agent had a similar treatment time to Q02 (both 24 hours), its highest degradation rate was only about 92%, and its residual concentration was much higher than that of Q02.
[0068] The above comparative experiments clearly demonstrate that the Hunan Pseudomonas Q02 provided by this invention is significantly superior to similar formaldehyde-degrading microorganisms reported in the prior art in terms of degradation efficiency (rate and extent) and tolerance to high concentrations of formaldehyde, exhibiting outstanding substantive characteristics and significant progress.
[0069] sequence list SEQ ID NO.1 (16S rDNA sequence of Pseudomonas hunanense Q02): SEQ ID NO.2 (primer 27F): AGAGTTTGATCCTGGCTCAG SEQ ID NO.3 (primer 1492R): GGTTACCTTGTTACGACTT The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.
Claims
1. A strain of Hunan Pseudomonas hunanensis Q02, characterized in that, The Hunan pseudomonad strain Q02 has the accession number CCTCC M 20252492.
2. The Hunan Pseudomonas strain Q02 according to claim 1, characterized in that, The 16S rDNA sequence of the Hunan Pseudomonas strain Q02 is shown in SEQ ID NO.
1.
3. A wastewater treatment agent, characterized in that, The effective components of the wastewater treatment agent include the Hunan Pseudomonas strain Q02 and / or the Hunan Pseudomonas strain Q02 preparation as described in claim 1.
4. The wastewater treatment agent according to claim 3, characterized in that, The preparation of Hunan Pseudomonas strain Q02 is one or more of the following: Hunan Pseudomonas strain Q02 culture, lyophilized powder, fermentation broth, fermentation broth supernatant, and fermentation broth precipitate.
5. The application of the Hunan Pseudomonas strain Q02 or the wastewater treatment agent as described in any one of claims 1 to 4 in the degradation of formaldehyde.
6. The application according to claim 5, characterized in that, The degradation process involves degrading formaldehyde in the wastewater.
7. The application according to claim 5 or 6, characterized in that, The degradation was carried out under aerobic conditions.
8. A method for degrading formaldehyde in wastewater, characterized in that, The degradation method includes the following steps: mixing the Hunan Pseudomonas strain Q02 or the wastewater treatment agent as described in any one of claims 1 to 4 with formaldehyde-containing wastewater for degradation treatment.
9. The degradation method according to claim 8, characterized in that, The pH value of the degradation treatment is 4 to 9.
Citation Information
Patent Citations
Pseudomonas hunanensis with degradation effects on phenolic acid autotoxins, and application of pseudomonas hunanensis
CN111690562A