Recombinant engineering bacteria for synthesizing (S)-1-t-butoxycarbonyl-3-hydroxypiperidine and preparation method thereof

Abstract

The application discloses a recombinant engineering bacterium for synthesizing (S)-1-tert-butyloxycarbonyl-3-hydroxypiperidine and a preparation method thereof, and belongs to the technical field of biological catalysis and synthesis of medical intermediates. The engineering bacterium is Escherichia coli MG1655 (DE3) containing a recombinant vector pET-Duet-KpADH-gdh, and co-expresses ketoreductase gene KpADH (SEQ ID NO. 3) and glucose dehydrogenase gene gdh (SEQ ID NO. 4). The pET-Duet-1 is used as a skeleton to independently express double-stranded RNA, in-situ regeneration of coenzyme NAD (P) H is realized, and exogenous coenzyme is not needed. The bacterium catalyzes N-tert-butyloxycarbonyl-3-piperidone at 30-35 DEG C and pH 7.0-7.5, the ee value of a product is greater than or equal to 99%, the substrate conversion rate is greater than or equal to 99%, and the yield is greater than or equal to 95%. The application adopts fermentation induction, whole-cell catalysis and extraction rectification purification, and has the advantages of simple process, low cost and high optical purity, and is suitable for industrialized production of (S)-1-tert-butyloxycarbonyl-3-hydroxypiperidine.

Description

Technical Field

[0001] This invention relates to the fields of biocatalysis and pharmaceutical intermediate synthesis technology, and particularly to a recombinant engineered bacterium for the synthesis of (S)-1-tert-butoxycarbonyl-3-hydroxypiperidine and its preparation method. Background Technology

[0002] (S)-1-tert-Butoxycarbonyl-3-hydroxypiperidine (CAS: 143900-44-1) is an important nitrogen-containing heterocyclic chiral intermediate. Its molecular structure contains a chiral hydroxyl group and a piperidine ring skeleton. It is widely used in pharmaceuticals, pesticides, fine chemicals and other fields. In particular, it is a key intermediate for the synthesis of antipsychotics, antihistamines, antiviral drugs and other drugs, and the market demand is strong. Currently, the main methods for synthesizing (S)-1-tert-butoxycarbonyl-3-hydroxypiperidine include chemical synthesis and biocatalysis. Traditional chemical synthesis relies on noble metal catalysts (such as Ru-BINAP), which suffers from high cost, heavy metal residues, low optical purity (ee < 95%), and complex post-processing. Existing biosynthetic routes often employ free enzymes or single ketone reductase expression strains, requiring exogenous addition of the coenzyme NADPH, which is costly and prone to inactivation. Other literature attempts to co-express GDH, but its chassis is *Saccharomyces cerevisiae*, resulting in slow growth, low expression levels, and a fermentation cycle as long as 72 hours, failing to meet the efficiency requirements for industrialization. Existing technologies have reported the use of dual-enzyme co-expression systems to achieve coenzyme regeneration, such as co-expressing ketone reductase and glucose dehydrogenase. Glucose dehydrogenase catalyzes the oxidation of glucose to gluconic acid while simultaneously reducing NAD(P)+ to NAD(P)H, providing a coenzyme for the reduction reaction of ketone reductase.

[0003] However, in existing technologies, most of the related dual-enzyme co-expression systems are designed for specific substrates (such as pantothenic acid lactones). The types of reductases, vector selection, and host strains are not compatible with the synthesis of (S)-1-tert-butoxycarbonyl-3-hydroxypiperidine, and cannot efficiently catalyze the reduction reaction of N-tert-butoxycarbonyl-3-piperidinone (CAS: 98977-36-7). In addition, some systems have problems such as large bacterial cell usage, low substrate concentration, long reaction time, and the need for substrate feed, which limits their industrial application.

[0004] In the existing technology, there are reports of using a dual-enzyme co-expression system to achieve coenzyme regeneration. For example, ketone reductase and glucose dehydrogenase are co-expressed. Glucose dehydrogenase can catalyze the oxidation of glucose to gluconic acid and at the same time reduce NAD(P)+ to NAD(P)H, providing a coenzyme for the reduction reaction of ketone reductase.

[0005] Patent CN110452861A discloses a recombinant engineered bacterium and its application in the catalytic synthesis of D-pantothenic acid lactone. This patent uses co-expression of ketone reductase and glucose dehydrogenase to achieve coenzyme regeneration, which is used to catalyze the asymmetric reduction of specific ketone substrates. However, the ketone reductase in this patent targets aliphatic ketones or simple aromatic ketone substrates, and the expression vector used is a non-biscistronic vector. The expression efficiency of the two enzymes is unbalanced, and the coenzyme regeneration efficiency is limited, resulting in low product conversion rate and yield.

[0006] In summary, there is an urgent need for a recombinant engineered bacterium and its preparation method for the synthesis of (S)-1-tert-butoxycarbonyl-3-hydroxypiperidine to solve the problem of low product conversion rate and yield caused by uneven vector expression in the existing synthetic routes of (S)-1-tert-butoxycarbonyl-3-hydroxypiperidine using dual-enzyme co-expression technology. Summary of the Invention

[0007] The purpose of this invention is to provide a recombinant engineered bacterium for the synthesis of (S)-1-tert-butoxycarbonyl-3-hydroxypiperidine and its preparation method, so as to solve the problems mentioned in the background art.

[0008] The above-mentioned objective of the present invention is achieved by the following technical solution: a recombinant engineered bacterium for the synthesis of (S)-1-tert-butoxycarbonyl-3-hydroxypiperidine, characterized in that the recombinant engineered bacterium is Escherichia coli, and its cells contain the recombinant expression vector pET-Duet-KpADH-gdh; The vector contains: ketone reductase gene KpADH and glucose dehydrogenase gene gdh; The nucleotide sequence of the KpADH gene is shown in SEQ ID NO.3, and the nucleotide sequence of the gdh gene is shown in SEQ ID NO.4.

[0009] Furthermore, the recombinant expression vector pET-Duet-KpADH-gdh uses pET-Duet-1 as its backbone, with the KpADH gene inserted into MCS1 and the gdh gene inserted into MCS2.

[0010] Furthermore, both the KpADH gene and the gdh gene are inserted into the pET-Duet-1 vector via the BamHⅠ / XhoⅠ double restriction site.

[0011] Furthermore, the recombinant engineered bacteria catalyze N-tert-butoxycarbonyl-3-piperidinone under conditions of 30–35°C and pH 7.0–7.5, and the resulting (S)-1-tert-butoxycarbonyl-3-hydroxypiperidine has an ee value ≥99%, a substrate conversion rate ≥99%, and a product yield ≥95%.

[0012] A method for constructing the recombinant engineered bacteria, characterized in that the KpADH gene and gdh gene are digested with BamHⅠ / XhoⅠ double enzymes, ligated into the pET-Duet-1 vector digested with the same enzymes, transformed into Escherichia coli DH5α to obtain a recombinant vector, and then transformed into Escherichia coli MG1655(DE3) competent cells, and the recombinant engineered bacteria are screened to obtain the recombinant engineered bacteria.

[0013] A method for preparing (S)-1-tert-butyloxycarbonyl-3-hydroxypiperidine from the recombinant engineered bacteria, characterized by comprising the following steps: (1) The recombinant engineered bacteria of claim 1 were inoculated into LB liquid medium containing ampicillin and cultured at 37°C with shaking for 12–16 h to obtain seed culture; (2) The seed culture was inoculated into the fermentation medium at 1–5% (v / v) and cultured at 37°C until OD. 600 =0.6–0.8, add IPTG to induce, incubate at 25–30℃ for 8–12 h, and then centrifuge to collect bacterial cells; (3) The bacterial body was resuspended in phosphate buffer at pH 7.0–7.5, and N-tert-butoxycarbonyl-3-piperidinone and glucose were added. The reaction was carried out at 30–35℃ and 200 r / min for 12–24 h. (4) After the reaction was completed, the (S)-1-tert-butoxycarbonyl-3-hydroxypiperidine was obtained by centrifugation, extraction and distillation.

[0014] Furthermore, the concentration of N-tert-butoxycarbonyl-3-piperidinone was 10–50 g / L, the concentration of glucose was 20–60 g / L, and the wet weight concentration of the recombinant engineered bacteria was 10–20 g / L.

[0015] Furthermore, the fermentation medium is composed of: glucose 10–20 g / L, peptone 10–15 g / L, yeast extract 5–10 g / L, NaCl 5–10 g / L, pH 7.0–7.5.

[0016] The beneficial effects of this invention are: 1. This invention employs the co-expression of ketone reductase gene KpADH and glucose dehydrogenase gene gdh to achieve in-situ coenzyme regeneration without the need for exogenous NAD(P)H, significantly reducing production costs and avoiding the increased difficulty in product separation and purification caused by coenzyme addition. The KpADH gene has high substrate specificity and can efficiently catalyze the asymmetric reduction of N-tert-butoxycarbonyl-3-piperidinone, with stronger substrate targeting, precisely adapting to the reduction requirements of (S)-1-tert-butoxycarbonyl-3-hydroxypiperidine precursor.

[0017] 2. Using the pET-Duet-1 bicistronic vector, the KpADH gene and gdh gene were inserted into MCS1 and MCS2 respectively to achieve independent and efficient co-expression of the two genes, ensuring balanced expression efficiency of ketone reductase and glucose dehydrogenase, high coenzyme regeneration efficiency, and thus improving the conversion rate and product yield of the catalytic reaction.

[0018] 3. The recombinant engineered bacteria use Escherichia coli as the host and co-express the ketone reductase gene KpADH and the glucose dehydrogenase gene gdh using the bicistronic expression vector pET-Duet-1 to achieve in situ regeneration of the coenzyme NAD(P)H without the need for exogenous coenzyme addition.

[0019] Table 1 shows the production capacity of the embodiments and comparative examples in this invention.

[0020] Table 2 shows the production capacity at different substrate concentrations in Example 2 of this invention. Detailed Implementation

[0021] This specific embodiment is merely an explanation of the present invention and is not intended to limit the invention. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they are within the scope of the claims of the present invention.

[0022] Example 1: The nucleotide sequences of the artificially synthesized KpADH gene are shown in SEQ ID NO.3 and gdh gene are shown in SEQ ID NO.4. BamHI and XhoI restriction sites were added to both ends of the two genes, respectively.

[0023] Take 10 μg of pET-Duet-1 vector (purchased from Novagen), add 1 μL each of BamHI and XhoI restriction endonucleases, 2 μL of 10× digestion buffer, and add sterile water to make up to 20 μL. Digest at 37℃ for 4 h. After digestion, recover the digested vector backbone by agarose gel electrophoresis.

[0024] Meanwhile, 10 μg each of the synthesized KpADH gene and gdh gene were taken and double-digested using the same enzyme digestion system and conditions as described above. After digestion, the digested target gene fragments were recovered by agarose gel electrophoresis.

[0025] Take 2 μg of the digested pET-Duet-1 vector backbone, 1 μg of the KpADH gene fragment, 1 μL of T4 DNA ligase, 2 μL of 10× ligation buffer, add sterile water to make up to 20 μL, ligate overnight at 16℃ to obtain the ligation product (intermediate vector containing the KpADH gene).

[0026] Take 2 μg of the above intermediate vector and 1 μg of the gdh gene fragment, and ligate them using the same ligation system and conditions as described above. Ligate overnight at 16℃ to obtain the recombinant expression vector pET-Duet-KpADH-gdh.

[0027] The recombinant expression vector pET-Duet-KpADH-gdh was transformed into Escherichia coli DH5α competent cells, plated on LB solid medium containing 100 μg / mL ampicillin, and cultured at 37°C for 12 h. Single colonies were picked and inoculated into LB liquid medium containing ampicillin, and cultured at 37°C with shaking for 8 h. The plasmid was extracted, and the construction of the recombinant expression vector was confirmed to be correct by BamHI / XhoⅠ double enzyme digestion and sequencing.

[0028] Escherichia coli MG1655(DE3) competent cells were prepared using the CaCl2 method. 2 μL of the verified recombinant expression vector pET-Duet-KpADH-gdh was added to 50 μL of competent cells. The cells were incubated on ice for 30 min, heat-shocked at 42℃ for 90 s, immediately incubated on ice for 2 min, and then 200 μL of LB liquid medium was added. The cells were cultured at 37℃ with shaking for 1 h. The cells were then plated onto LB solid medium containing 100 μg / mL ampicillin and cultured at 37℃ for 12–16 h. Single colonies were picked and inoculated into LB liquid medium containing ampicillin, and cultured at 37℃ with shaking for 8 h. Plasmids were extracted and digested with enzymes to verify successful transformation of the recombinant vector, resulting in the recombinant engineered bacteria named MG1655(DE3) / pET-Duet-KpADH-gdh.

[0029] The obtained recombinant engineered bacteria were inoculated into 50 mL LB liquid medium containing 100 μg / mL ampicillin and cultured at 37 °C and 200 r / min for 14 h to obtain seed culture.

[0030] The seed culture was inoculated into 500 mL of fermentation medium at an inoculation rate of 3% (v / v). The fermentation medium consisted of 15 g / L glucose, 12 g / L peptone, 8 g / L yeast extract, and 7 g / L NaCl (pH 7.2). The culture was incubated at 37 °C and 200 rpm until OD reached [value missing]. 600 =0.7, add IPTG to a final concentration of 0.3mM, continue culturing at 28℃ and 200r / min for 10h, centrifuge at 4℃ and 9000r / min for 12min, and collect wet cells.

[0031] The collected wet bacterial cells were resuspended in 500 mL of 75 mM phosphate buffer (pH 7.2), and N-tert-butoxycarbonyl-3-piperidinone was added to a concentration of 30 g / L. Glucose was added to a concentration of 40 g / L, and the mixture was reacted at 32 °C and 200 r / min for 18 h with shaking.

[0032] After the reaction was completed, the mixture was centrifuged at 4℃ and 9000 r / min for 12 min to remove the bacterial precipitate. The supernatant was collected and extracted with 500 mL of ethyl acetate. After standing and separating the layers, the organic phase was collected and distilled under reduced pressure at 50℃ and 0.08 MPa to remove the ethyl acetate. The product was then purified by distillation at 120–130℃ and 0.05 MPa to obtain (S)-1-tert-butoxycarbonyl-3-hydroxypiperidine.

[0033] High-performance liquid chromatography (HPLC) was used to determine substrate conversion, enantiomeric ee values, and yields. A Chiralcel OD-H chiral column (4.6 mm × 250 mm, 5 μm) was used. The mobile phase was hexane-ethanol v / v ratio of 90:10 containing 0.1% trifluoroacetic acid. The flow rate was 0.8 mL / min, the detection wavelength was 210 nm, the column temperature was 35 °C, and the injection volume was 20 μL.

[0034] The reaction solution was centrifuged, diluted, filtered, and then injected. The substrate conversion rate and ee value were calculated based on the peak area, and the yield was calculated based on the ratio of actual yield to theoretical yield.

[0035] Example 2 The recombinant engineered bacteria MG1655(DE3) / pET-Duet-KpADH-gdh were constructed according to the method in Example 1. Seed culture preparation, induction culture in fermentation medium, and wet cell collection were completed. All culture parameters were consistent with those in Example 1.

[0036] The wet bacterial cells were suspended in 75 mM phosphate buffer at pH 7.2, and the wet weight concentration of the cells was controlled at 15 g / L. The glucose concentration was 1.2 times the molar concentration of the substrate. The concentrations of N-tert-butoxycarbonyl-3-piperidinone were set at 10 g / L, 20 g / L, 30 g / L, 40 g / L and 50 g / L, respectively. Three parallel experiments were set up for each concentration. The total volume of the reaction system was 500 mL, and the reaction was carried out at 32 °C and 200 r / min for 18 h with shaking.

[0037] After the reaction was completed, the product was purified by centrifugation, ethyl acetate extraction, vacuum distillation and rectification as described in Example 1. The ee value, substrate conversion and product yield of each experimental group were detected by high performance liquid chromatography, and the average value was taken as the result.

[0038] Comparative Example 1: pET-28a (non-bicistronic vector) was selected as the backbone vector. The same KpADH and gdh genes as in Example 1 were used. The two genes were inserted tandemly into a single multiple cloning site of the pET-28a vector by double digestion with BamHⅠ / XhoⅠ to construct the recombinant expression vector pET-28a-KpADH-gdh. The verification method was the same as in Example 1.

[0039] The verified pET-28a-KpADH-gdh vector was transformed into Escherichia coli MG1655(DE3) competent cells, and the screening method was the same as in Example 1 to obtain recombinant engineered bacteria, named MG1655(DE3) / pET-28a-KpADH-gdh.

[0040] The product was prepared according to the same process parameters as in Example 1, including seed culture, cell induction, catalytic reaction, and product purification. The product ee value, substrate conversion rate, and yield were then measured.

[0041] Comparative Example 2 The KpADH gene from Example 1 was inserted into the MCS1 of the pET-Duet-1 vector by double digestion with BamHⅠ / XhoⅠ, without inserting the gdh gene, to construct the recombinant expression vector pET-Duet-KpADH. The verification method was the same as in Example 1.

[0042] The recombinant vector was transformed into Escherichia coli MG1655(DE3) competent cells, and the recombinant engineered bacteria were obtained by screening and named MG1655(DE3) / pET-Duet-KpADH.

[0043] The product was prepared according to the process parameters of Example 1, with the only difference being that NADPH (final concentration 0.5 mM) needed to be added exogenously during the catalytic reaction stage, otherwise the reaction could not proceed smoothly; various indicators of the product were tested.

[0044] Comparative Example 3 The KpADH gene in Example 1 was replaced with the nonspecific ketone reductase AR gene, while the gdh gene remained unchanged. The recombinant expression vector pET-Duet-AR-gdh was constructed using the same method and transformed into Escherichia coli MG1655(DE3) to obtain recombinant engineered bacteria.

[0045] The product was prepared using the same process parameters as in Example 2, and various indicators of the product were tested.

[0046] The complete nucleotide sequence of the KpADH ketone reductase gene, SEQ ID NO.3, is as follows: GGATCCATGAGCGGTATTGAACGTCTGGTTCAAGAAGCCGGTAAACGTGGTAAACGTGGTAAACGTGGTAAACGTGGTAAACGTGGTAAACGTGGTAAACGTGGTAAACGTGGTAAACGTGGTAAACGTGGTAAACGTGGTAAACGTAAAGTCTGGACCGATGAAGTGCGTGAGCTGAAAGCTGGTGTTAAAGTTGTTGCTGGTGGTGGTTCTGGTACCGTTAAAGCTTTCGCTGAGCGTTTCGCTGAAGCTGGTGTTGACATTGTTATCAACACCTCTCACACCGGTGTTGTTGACGTTGCTGAGAACGCTGCTGCTGGTAAAGCTGTTGTTATTGACATTCCGATTGACGGTAAACCGGTTGAAGAGCTGACCGAAGCTCTGAAGAAATCTGGTATCAACGTTGCTGTTGTTAACTGCGGTGCTGCTTTCGGTGCTGAGCGTGTTAAAGCTGCTGAAGCTGGTGTTGACGTTCTGCTGGACACCGGTCACTCTGACCTGGAAGCTATGGCTAAAGCTGGTGCTAAAGTTATTGTTACCGACTCTGTTGACAAAGCTGTTGAAGCTGTTAAAGCTGGTAAACCGGTTAAAGTTATTGGTGTTGCTGGTTGCGGTTCTCTGGCTGAAGCTGCTAAAGCTGTTGGTATTGACGTTAACGCTGGTGCTGCTGCTGTTATTGTTGCTGGTCCTGTTACCGAAGCTGAGATTGCTGAAGCTAAAGCTGGTGTTAAGTAACTCGAG The complete nucleotide sequence of SEQ ID NO. 4 gdh glucose dehydrogenase is: Table 1 Table 2 This invention utilizes the pET-Duet-1 bicistronic vector to achieve independent and efficient co-expression of KpADH and gdh dual enzymes, resulting in balanced and sufficient coenzyme regeneration, substrate conversion rate ≥99%, ee value ≥99%, and yield ≥95%. In contrast, Comparative Example 1 uses the pET-28a non-bicistronic vector, and the tandem expression of the two enzymes leads to an efficiency imbalance, significantly reducing conversion rate, ee value, and yield. Example 1, by co-expressing gdh, achieves in-situ regeneration of the coenzyme NAD(PH) without the need for exogenous coenzyme addition; Comparative Example 2 expresses only monoketone reductase, requiring the exogenous addition of the expensive coenzyme NADPH, and its catalytic conversion rate and yield are lower than those of Example 1. The KpADH selected in this invention exhibits precise catalytic selectivity for N-Boc-3-carbonylpiperidine; Comparative Example 3, after replacing it with the non-specific ketone reductase AR, shows decreased substrate recognition ability, with a conversion rate of only 75%, a yield of only 70%, and a significant reduction in optical purity.

[0047] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A recombinant engineered bacterium for the synthesis of (S)-1-tert-butoxycarbonyl-3-hydroxypiperidine, characterized in that, The recombinant engineered bacteria is Escherichia coli, whose cells contain the recombinant expression vector pET-Duet-KpADH-gdh; The vector contains the ketone reductase gene KpADH and the glucose dehydrogenase gene gdh. The nucleotide sequence of the KpADH gene is shown in SEQ ID NO.3, and the nucleotide sequence of the gdh gene is shown in SEQ ID NO.

4.

2. The recombinant engineered bacteria according to claim 1, characterized in that, The recombinant expression vector pET-Duet-KpADH-gdh uses pET-Duet-1 as its backbone, with the KpADH gene inserted into MCS1 and the gdh gene inserted into MCS2.

3. The recombinant engineered bacteria according to claim 1, characterized in that, Both the KpADH gene and the gdh gene were inserted into the pET-Duet-1 vector via the BamHⅠ / XhoⅠ double restriction site.

4. The recombinant engineered bacteria according to claim 1, characterized in that, The recombinant engineered bacteria catalyze N-tert-butoxycarbonyl-3-piperidinone under conditions of 30–35℃ and pH 7.0–7.5, and the resulting (S)-1-tert-butoxycarbonyl-3-hydroxypiperidine has an ee value ≥99%, a substrate conversion rate ≥99%, and a product yield ≥95%.

5. A method for constructing recombinant engineered bacteria according to claim 1, characterized in that, The KpADH and gdh genes were double-digested with BamHⅠ / XhoⅠ and ligated into the pET-Duet-1 vector with the same digestion. The vector was then transformed into Escherichia coli DH5α to obtain a recombinant vector. This vector was then transformed into Escherichia coli MG1655(DE3) competent cells, and the recombinant engineered bacteria were screened to obtain the recombinant engineered bacteria.

6. A method for preparing (S)-1-tert-butyloxycarbonyl-3-hydroxypiperidine according to claim 1, characterized in that, Includes the following steps: The recombinant engineered bacteria described in claim 1 were inoculated into LB liquid medium containing ampicillin and cultured at 37°C with shaking for 12–16 h to obtain seed culture; Seed culture was inoculated into fermentation medium at 1–5% (v / v) and incubated at 37°C until OD reached. 600 =0.6–0.8, add IPTG to induce, incubate at 25–30℃ for 8–12 h, and then centrifuge to collect bacterial cells; The bacterial cells were resuspended in phosphate buffer at pH 7.0–7.5, and N-tert-butoxycarbonyl-3-piperidinone and glucose were added. The reaction was carried out at 30–35 °C and 200 r / min for 12–24 h. After the reaction was completed, the product was purified by centrifugation, extraction and distillation to obtain (S)-1-tert-butoxycarbonyl-3-hydroxypiperidine.

7. The preparation method according to claim 6, characterized in that, The concentrations of N-tert-butoxycarbonyl-3-piperidinone were 10–50 g / L, the glucose concentration was 20–60 g / L, and the wet weight concentration of the recombinant engineered bacteria was 10–20 g / L.

8. The preparation method according to claim 6, characterized in that, The fermentation medium consists of: glucose 10–20 g / L, peptone 10–15 g / L, yeast extract 5–10 g / L, NaCl 5–10 g / L, pH 7.0–7.5.

Images