Interferon gamma pre-conditioned mesenchymal stem cell aggregates and uses thereof in sjogren's syndrome

CN122811097APending Publication Date: 2026-09-25NANJING DRUM TOWER HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202611149436.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-07-31
Publication Date
2026-09-25

AI Technical Summary

Technical Problem

[0007]然而,现有技术中,上述预处理策略、三维聚集体培养方式及其他工程化改造手段多以单一策略形式分别提出,尚缺乏一种针对干燥综合征发病特点进行系统整合的工程化间充质干细胞构建方案

Benefits of technology

1、本发明通过构建间充质干细胞的三维聚集体结构,更好地模拟细胞在体内所处的微环境,增强了细胞在炎症微环境中的存活能力和体内潴留时间,从而有利于其持续发挥治疗作用。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122811097A_ABST
    Figure CN122811097A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to a mesenchymal stem cell aggregate pretreated by IFN-gamma and application thereof in Sjogren's syndrome. The aggregate is a cell aggregate with a three-dimensional aggregate structure constructed by culturing mesenchymal stem cells pretreated by interferon-gamma. The application realizes systematic improvement of the treatment efficiency of mesenchymal stem cells by combining functional pretreatment with structural engineering, is helpful to simultaneously taking into account immunoregulation and protection and repair of exocrine gland function, and the overall treatment effect is more stable and controllable.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to an aggregate of mesenchymal stem cells pretreated with IFN-γ and its application in Sjögren's syndrome. Background Technology

[0002] Sjögren's syndrome (SS) is a chronic inflammatory autoimmune disease of unknown etiology, with an incidence of approximately 0.3%-0.4%, predominantly affecting women and increasing with age. This disease can affect multiple tissues and organs throughout the body, causing systemic inflammatory responses, muscle and joint disorders, and digestive system complications. Its characteristic pathological changes are the progressive destruction of exocrine glands, with clinical manifestations primarily including dysfunction of the salivary and lacrimal glands, leading to symptoms such as dry mouth and dry eyes, severely impacting patients' quality of life.

[0003] According to current domestic and international guidelines for the diagnosis and treatment of Sjögren's syndrome (SS), medications are divided into two categories: local symptomatic treatment and systemic immune modulation. The core treatment goals are to relieve dryness symptoms and control systemic inflammation. Local treatment mainly uses saliva and tear substitutes and exocrine gland stimulants, which can relieve symptoms of dry mouth and eyes, but cannot fundamentally restore salivary gland function. Systemic immune modulation includes three main categories: glucocorticoids, immunosuppressants, and biologics, which slow disease progression by regulating overactive immune responses. However, to date, there are no specific drugs for Sjögren's syndrome with a clear indication, clinical efficacy remains limited, and long-term use carries certain risks of adverse reactions. Therefore, developing novel treatment strategies that can simultaneously address immune modulation and glandular function restoration remains a pressing technical challenge in the treatment of Sjögren's syndrome.

[0004] Mesenchymal stem cells (MSCs) have attracted widespread attention in the treatment of various autoimmune diseases due to their wide availability, low immunogenicity, strong proliferative capacity, and multiple biological functions, including anti-inflammatory, immunomodulatory, and tissue repair capabilities. Previous studies have shown that MSCs can alleviate disease symptoms to some extent in animal models and some clinical studies of Sjögren's syndrome by inhibiting inflammatory responses, regulating immune homeostasis, and improving salivary gland secretion. Their potential mechanisms of action include paracrine secretion of various immunomodulatory factors, improvement of the local tissue microenvironment, and interaction with salivary gland epithelial cells, participating in the repair of glandular structure and function. However, further research has revealed that MSCs cultured under traditional two-dimensional adherent conditions have limited survival time in the complex inflammatory microenvironment in vivo, making it difficult to sustain and stably exert their immunomodulatory and tissue repair functions. The lesion areas associated with Sjögren's syndrome are typically located in unfavorable microenvironments such as chronic inflammation, oxidative stress, insufficient nutrient supply, and local hypoxia. Exogenously introduced MSCs are susceptible to the influence of pro-apoptotic factors and inflammatory signals, leading to reduced in vivo survival and functional decline. Furthermore, current research largely focuses on the regulatory role of mesenchymal stem cells in the immune system, while comprehensive repair designs targeting damage to the intrinsic structure and dysfunction of salivary glands remain relatively insufficient. Therefore, exploring therapeutic approaches that can achieve multidimensional restoration of salivary gland function remains an open question.

[0005] To overcome the limitations of traditional mesenchymal stem cell (MSC) therapy, various engineering strategies have been proposed in recent years, including constructing MSC aggregates, employing three-dimensional culture systems, introducing cell adhesion-related molecules, and pretreatment with cytokines or inflammatory factors. Among these, MSC aggregates are three-dimensional spherical structures formed by the adhesion of numerous cells, exhibiting rich cell-cell and cell-extracellular matrix interactions, which can, to some extent, mimic the in vivo survival state of stem cells. Compared to two-dimensionally cultured MSCs, the aggregate structure helps improve cell viability, maintain stemness characteristics, and enhance their tolerance to adverse microenvironments. Furthermore, the relatively hypoxic microenvironment formed within the aggregates can induce the activation of cellular adaptive response pathways, thereby improving the survival and functional maintenance of MSCs after transplantation.

[0006] On the other hand, mesenchymal stem cells (MSCs) are not always in an activated state, but often require inflammatory signals or specific stimuli to be induced or enhanced. Therefore, pretreatment of MSCs with inflammatory factors or cytokines has become an important technique for improving their immunomodulatory capabilities and therapeutic potential. Current literature indicates that MSCs pre-stimulated with pro-inflammatory factors can retain their activity in response to external stimuli for a certain period, and are more easily reactivated after entering the in vivo inflammatory environment, thereby enhancing the secretion of anti-inflammatory and immunomodulatory factors.

[0007] However, in existing technologies, the aforementioned pretreatment strategies, three-dimensional aggregate culture methods, and other engineering modification techniques are mostly proposed as individual strategies, lacking a systematically integrated engineered mesenchymal stem cell construction scheme that addresses the pathogenesis of Sjögren's syndrome. In particular, existing technologies have yet to provide a clear solution on how to enhance the immunomodulatory capacity of mesenchymal stem cells while improving their functional stability in the inflammatory microenvironment, and synergistically protecting against salivary gland epithelial cell damage and restoring glandular structure and function. Summary of the Invention

[0008] Based on the shortcomings of the existing technology, the purpose of this invention is to provide an engineered mesenchymal stem cell construction strategy. By improving cell culture and tissue morphology, the survival ability and functional stability of mesenchymal stem cells in the inflammatory microenvironment of Sjögren's syndrome are enhanced. At the same time, by using appropriate stimulation or pretreatment methods to enhance their immunomodulatory capacity, the regulatory effect of mesenchymal stem cells on abnormal immune responses in vivo is improved, and they synergistically exert therapeutic effects on salivary gland epithelial cell damage and exocrine gland function recovery, so as to achieve a more effective and stable therapeutic effect on Sjögren's syndrome.

[0009] Therefore, the present invention provides the following technical solution.

[0010] One aspect of the present invention provides an aggregate of mesenchymal stem cells pretreated with IFN-γ, the aggregate being a cell aggregate with a three-dimensional aggregate structure constructed by culturing mesenchymal stem cells pretreated with interferon-γ.

[0011] In a preferred embodiment of the present invention, the mesenchymal stem cells are selected from one or more of human umbilical cord-derived mesenchymal stem cells, bone marrow-derived mesenchymal stem cells, adipose-derived mesenchymal stem cells, and dental pulp-derived mesenchymal stem cells.

[0012] In a preferred embodiment of the present invention, the mesenchymal stem cells are human umbilical cord mesenchymal stem cells.

[0013] In a preferred embodiment of the present invention, the concentration of IFN-γ pretreatment is 10-80 ng / mL, and the pretreatment time is 12-48 hours.

[0014] In a preferred embodiment of the present invention, the concentration of IFN-γ pretreatment is 40 ng / mL, and the pretreatment time is 24 hours.

[0015] In a preferred embodiment of the present invention, the culture method is selected from any one of the following: 3D cell culture plate method, low adhesion culture plate method, hanging drop method, microcarrier rotation culture method, or bioreactor culture method.

[0016] In a preferred embodiment of the present invention, the aggregate has at least one of the following biological characteristics: (1) The expression levels of immune regulation-related factors are significantly increased, including at least one of TSG6, PGE2, TGF-β, HGF, EGF or IL-6; (2) It significantly enhances the inhibitory effect on the proliferation of human peripheral blood mononuclear cells; (3) It significantly enhances the inhibitory effect on the pro-inflammatory subsets Th1 and / or Th17 in human CD4 positive T lymphocytes.

[0017] A second aspect of the present invention provides a method for preparing mesenchymal stem cell aggregates, the method comprising the following steps: (1) Mesenchymal stem cells were incubated in a medium containing interferon-γ to obtain pretreated mesenchymal stem cells; (2) The pretreated mesenchymal stem cells are seeded into a culture system and cultured to obtain cell aggregates with a three-dimensional aggregate structure.

[0018] In a preferred embodiment of the present invention, in step (1), the final concentration of IFN-γ in the culture medium is 10-80 ng / mL, preferably 40 ng / mL; In a preferred embodiment of the present invention, the incubation time is 12-48 hours, preferably 24 hours.

[0019] In a preferred embodiment of the present invention, in step (2), the culture system is selected from any one of a low-adhesion culture plate, a microporous array culture plate, a hanging drop culture plate, or a rotating bioreactor.

[0020] A third aspect of the present invention provides the following application of mesenchymal stem cell aggregates: (i) Application in the preparation of immunosuppressive products; (ii) Application in the preparation of products that reduce inflammatory damage; (iii) Application in the preparation of products for the repair of exocrine function; (iv) Application in the preparation of products for treating Sjögren's syndrome; The products include drugs or vaccines.

[0021] In a preferred embodiment of the present invention, the drug is used to improve the salivary gland secretion function of patients with Sjögren's syndrome, manifested as an increase in salivary flow rate.

[0022] In a preferred embodiment of the invention, the drug is used to reduce inflammatory cell infiltration in the salivary gland tissue of patients with Sjögren's syndrome.

[0023] In a preferred embodiment of the present invention, the drug is used to inhibit apoptosis of salivary gland epithelial cells in patients with Sjögren's syndrome.

[0024] In a preferred embodiment of the present invention, the drug is used to regulate the systemic immune imbalance in patients with Sjögren's syndrome, including inhibiting the proliferation or proportion of Th1 cells and / or Th17 cells in the spleen and / or peripheral blood.

[0025] In a preferred embodiment of the present invention, the drug is an injectable preparation, administered to the subject via intravenous injection, local injection, or in situ injection into a tissue.

[0026] A fourth aspect of the invention provides a method for treating Sjögren's syndrome, comprising administering a therapeutically effective amount of the engineered mesenchymal stem cell aggregates as described above to a subject in need.

[0027] A fifth aspect of the present invention provides a kit for preparing mesenchymal stem cell aggregates, comprising: (1) Culture medium containing interferon-γ (IFN-γ); (2) Consumables for three-dimensional cell culture, wherein the consumables are selected from low-adhesion culture plates, microwell array culture plates or hanging drop culture plates; (3) Optionally, it also includes a mesenchymal stem cell basal culture medium and / or instructions.

[0028] By employing the above technical solution, the present invention has at least the following advantages: 1. This invention constructs a three-dimensional aggregate structure of mesenchymal stem cells, which better simulates the microenvironment in vivo, enhances the survival ability and retention time of cells in the inflammatory microenvironment, and thus helps them to exert a sustained therapeutic effect.

[0029] 2. This invention enhances the immunomodulatory capacity of mesenchymal stem cells through IFN-γ pretreatment, enabling them to more effectively suppress abnormal immune responses in vivo and improve the regulatory effect on Sjögren's syndrome-related inflammatory states.

[0030] 3. This invention combines functional pretreatment with structural engineering to systematically improve the therapeutic efficacy of mesenchymal stem cells, which helps to simultaneously protect and repair the function of immune regulation and exocrine glands, resulting in a more stable and controllable overall therapeutic effect.

[0031] 4. Relevant experimental results show that the IFN-γ pretreated mesenchymal stem cell aggregates of the present invention can increase the salivary flow rate of NOD mice, reduce inflammatory infiltration foci in the submandibular glands of NOD mice, enhance the inhibitory effect on apoptosis of salivary gland epithelial cells, and maximally inhibit the proportion of Th1 and Th17 cells, thereby achieving effective treatment for Sjögren's syndrome.

[0032] The above description is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention and to implement it in accordance with the contents of the specification, the preferred embodiments of the present invention are described in detail below. Attached Figure Description

[0033] Figure 1 The expression of immunosuppressive factors in mesenchymal stem cells under stimulation with different concentrations of IFN-γ.

[0034] Figure 2 The effect of different concentrations of IFN-γ on the inhibition of PBMC proliferation by mesenchymal stem cells.

[0035] Figure 3 The effect of different concentrations of IFN-γ on the inhibition of human CD4-positive T lymphocyte subsets by mesenchymal stem cells.

[0036] Figure 4 These are bright-field and dead-live staining images of the aggregates in this invention.

[0037] Figure 5 To detect the differences in the regulation of salivary gland function in vivo by mesenchymal stem cells cultured using the conventional adherent method and IFN-γ pretreated mesenchymal stem cell aggregates in a Sjögren's syndrome model—a statistical graph of salivary flow rate.

[0038] Figure 6 To investigate the differences in the regulation of salivary gland inflammation in a Sjögren's syndrome model between mesenchymal stem cells cultured using the conventional adherent method and aggregates of IFN-γ-pretreated mesenchymal stem cells—Salivary gland H&E plot.

[0039] Figure 7 To detect the difference in the inhibition of salivary gland cell apoptosis in vivo between mesenchymal stem cells cultured by the conventional adherent method and aggregates of IFN-γ-pretreated mesenchymal stem cells in a Sjögren's syndrome model—TUNNEL fluorescence image of salivary glands.

[0040] Figure 8 To detect the differences in the regulation of peripheral circulating immune cells in vivo by mesenchymal stem cells cultured by conventional adherence method and IFN-γ pretreated mesenchymal stem cell aggregates in a Sjögren's syndrome model—splenic Th1 and Th17 flow cytometry. Detailed Implementation

[0041] To make the technical means, creative features, achieved objectives, and effects of this invention readily understandable, the technical solutions in the embodiments of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are merely some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0042] The mesenchymal stem cells (MSCs) obtained in this invention using traditional adherent culture methods have a short residence time in the in vivo inflammatory microenvironment. After transplantation, they are easily affected by pro-inflammatory factors and pro-apoptotic signals, resulting in limited cell survival and in vivo retention capacity, thus affecting their sustained therapeutic effect. Furthermore, traditional two-dimensional cultured MSCs cannot simulate the three-dimensional microenvironment they inhabit in vivo. The lack of sufficiently tight and complex intercellular connections limits the synergistic function of intercellular signal transduction and paracrine functions, making it difficult for them to adapt to the complex microenvironment of Sjögren's syndrome-related lesions after transplantation, leading to unstable therapeutic effects. In addition, in existing technologies, most MSCs are directly applied in vivo without specific stimulation or pretreatment. Because their related functions have not been fully activated, their ability to inhibit abnormal immune responses is limited, making it difficult to effectively regulate the inflammatory response related to Sjögren's syndrome.

[0043] In view of the shortcomings of the prior art, the present invention provides a mesenchymal stem cell aggregate pretreated with IFN-γ, wherein the aggregate is a cell aggregate with a three-dimensional aggregate structure constructed by culturing mesenchymal stem cells pretreated with interferon-γ.

[0044] Suitable mesenchymal stem cells can be selected from one or more of the following: human umbilical cord-derived mesenchymal stem cells, bone marrow-derived mesenchymal stem cells, adipose-derived mesenchymal stem cells, and dental pulp-derived mesenchymal stem cells. In this invention, human umbilical cord mesenchymal stem cells are preferred.

[0045] In the above pretreatment process, the concentration of IFN-γ pretreatment was 10-80 ng / mL, and the pretreatment time was 12-48 hours.

[0046] Preferably, the concentration of IFN-γ pretreatment is 40 ng / mL, and the pretreatment time is 24 hours.

[0047] In this invention, a suitable culture method may be selected from any one of the following: 3D cell culture plate method, low adhesion culture plate method, hanging drop method, microcarrier rotation culture method or bioreactor culture method; preferably, the 3D cell culture plate method.

[0048] Upon testing, the aggregates exhibit at least one of the following biological characteristics: (1) The expression levels of immune regulation-related factors are significantly increased, including at least one of TSG6, PGE2, TGF-β, HGF, EGF or IL-6; (2) It significantly enhances the inhibitory effect on the proliferation of human peripheral blood mononuclear cells; (3) It significantly enhances the inhibitory effect on the pro-inflammatory subsets Th1 and / or Th17 in human CD4 positive T lymphocytes.

[0049] In this embodiment, the immunomodulatory factors may include, but are not limited to, TSG6, TGF-β, HGF, EGF, etc. In IFN-γ treatment at 40 mg / mL, the expression of TSG6 in IFN-γ-pretreated mesenchymal stem cells (MSCs) was 5.5 times that of untreated MSCs; the expression of PGE2 in IFN-γ-pretreated umbilical cord mesenchymal stem cells (UCMSCs) was 5.8 times that of untreated MSCs; the expression of IL-6 in IFN-γ-pretreated UCMSCs was 2.9 times that of untreated MSCs; the expression of TGF-β in IFN-γ-pretreated UCMSCs was 1.8 times that of untreated MSCs; the expression of HGF in IFN-γ-pretreated UCMSCs was 2.7 times that of untreated MSCs; and the expression of EGF in IFN-γ-pretreated UCMSCs was 1.8 times that of untreated MSCs. This indicates that the expression of immunosuppressive factors in MSCs was most significantly increased under IFN-γ stimulation at 40 ng / mL.

[0050] In the above functional characteristic tests, the inhibitory effect on PBMC proliferation can be detected by co-culturing with CFSE-stained PBMCs. In 40 ng / ml IFN-γ treatment, the IFN-γ-pretreated umbilical cord mesenchymal stem cells showed approximately 14% greater inhibitory effect on PBMC proliferation compared to the mesenchymal stem cells themselves.

[0051] In the above functional characteristic tests, the inhibitory effect on the pro-inflammatory subset of CD4-positive T cells can be detected by co-culturing with CFSE-stained PBMCs and using flow cytometry to detect specific cell surface markers. In 40 ng / ml IFN-γ treatment, the IFN-γ-pretreated umbilical cord mesenchymal stem cells showed approximately 10% greater inhibitory effect on the Th1 subset and approximately 13% greater inhibitory effect on the Th17 subset compared to the mesenchymal stem cells.

[0052] In another embodiment, the present invention provides a method for preparing mesenchymal stem cell aggregates as described above, the method comprising the following steps: (1) Mesenchymal stem cells were incubated in a medium containing interferon-γ to obtain pretreated mesenchymal stem cells; (2) The pretreated mesenchymal stem cells are seeded into a culture system and cultured to obtain cell aggregates with a three-dimensional aggregate structure.

[0053] In step (1), the final concentration of IFN-γ in the culture medium is 10-80 ng / mL, preferably 40 ng / mL; The incubation time is 12-48 hours, preferably 24 hours.

[0054] In step (2), the culture system is selected from any one of low adhesion culture plates, microporous array culture plates, hanging drop culture plates or rotating bioreactors.

[0055] In yet another embodiment, the present invention provides the following application of the aforementioned mesenchymal stem cell aggregates: (i) Application in the preparation of immunosuppressive products; (ii) Application in the preparation of products that reduce inflammatory damage; (iii) Application in the preparation of products for the repair of exocrine function; (iv) Application in the preparation of products for treating Sjögren's syndrome; The products include drugs or vaccines.

[0056] The drug is an injectable preparation, administered to the subject via intravenous injection, local injection, or in situ injection into the tissue.

[0057] This invention enhances the immunomodulatory and tissue repair functions of umbilical cord mesenchymal stem cells (MSCs) through IFN-γ pretreatment, and improves the survival rate and in vivo retention time of MSCs after transplantation by constructing aggregates, thereby enhancing the therapeutic effect on Sjögren's syndrome. This invention establishes a stable and highly efficient method for preparing MSC aggregates that suppress the immune response, laying the foundation for the research and application of MSCs in autoimmune diseases.

[0058] The present invention will now be described in further detail with reference to specific embodiments. The embodiments given are only for illustrating the present invention and are not intended to limit the scope of the present invention. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present invention in any way.

[0059] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0060] The human umbilical cord mesenchymal stem cells in the following examples are primary umbilical vein mesenchymal stem cells. The PBMCs in the following examples are primary cells.

[0061] In the following examples, the DMEM / F12 culture medium, penicillin-streptomycin mixed antibiotics, and fetal bovine serum were all from Nanjing Shenghang Biotechnology Co., Ltd.; recombinant human interleukin-6 protein was a product of Perotech; propylene glycol methyl ether acetate (PMA), ionmycin, and Brefeldin A were all products of eBioscience; CFSE, anti-human CD3 monoclonal antibody, and anti-human CD28 monoclonal antibody were all products of Invitrogen; 3D cell culture plates were products of Stemcell; and TRIZOL, reverse transcription kit, and SYBR Green reagent were all products of Nanjing Novizan Biotechnology Co., Ltd.

[0062] The quantitative data in the following examples were analyzed using GraphPad 9.0 software. One-way ANOVA was used to compare sample means, and P < 0.05 was considered statistically significant.

[0063] Example 1: Screening for the optimal concentration of IFN-γ to stimulate human umbilical cord mesenchymal stem cells In this embodiment, human primary umbilical vein endothelial cells were used as recipient mesenchymal stem cells. These recipient mesenchymal stem cells were stimulated with different concentrations of recombinant human IFN-γ protein (purchased from MCE). Pretreated mesenchymal stem cells with increased expression of immunosuppressive factors compared to untreated recipient mesenchymal stem cells were obtained, and the optimal concentration of recombinant human IFN-γ protein for stimulation was determined. The specific method is as follows: 1. Preparation of culture medium Culture medium N1: DMEM / F12 culture medium containing 10% (volume percentage) fetal bovine serum, 1% (volume percentage) penicillin-streptomycin mixed antibiotics, and 0 ng / mL IFN-γ.

[0064] Culture medium N2: DMEM / F12 culture medium containing 10% (volume percentage) fetal bovine serum, 1% (volume percentage) penicillin-streptomycin mixed antibiotics, and 10 ng / mL IFN-γ.

[0065] Culture medium N3: DMEM / F12 culture medium containing 10% (volume percentage) fetal bovine serum, 1% (volume percentage) penicillin-streptomycin mixed antibiotics, and 20 ng / mL IFN-γ.

[0066] Culture medium N4: DMEM / F12 culture medium containing 10% (volume percentage) fetal bovine serum, 1% (volume percentage) penicillin-streptomycin mixed antibiotics, and 40 ng / mL IFN-γ.

[0067] Culture medium N5: DMEM / F12 culture medium containing 10% (volume percentage) fetal bovine serum, 1% (volume percentage) penicillin-streptomycin mixed antibiotics, and 80 ng / mL IFN-γ.

[0068] 2. Cell treatment Human umbilical vein endothelial cells were cultured individually in culture medium N (culture medium N1, N2, N3, N4, or N5) at a concentration of 1.5 × 10⁻⁶. 5 pcs / cm 2 Cells were seeded at a density of 1000 μL in 6-well plates and then incubated at 37°C with 5% CO2 for 24 hours.

[0069] 3. Indicator Testing Subsequently, real-time quantitative PCR was used to detect the gene expression levels of PGE-2, IL-6, TGF-β, HGF, EGF, and TSG6 in umbilical cord mesenchymal stem cells before and after pretreatment with human IFN-γ recombinant protein. The specific steps included: first, total RNA was extracted from the cells using TRIZOL and then reverse transcribed into cDNA using a reverse transcription kit. The cDNA was used as a template, and SYBR Green reagent was added. Real-time quantitative PCR was then used to determine the expression of specific genes, expressed relative to the expression level of the GAPDH gene. The experiment was repeated three times. Results are shown below. Figure 1 .

[0070] The human GAPDH gene primer sequences include: Human EGF Forward: TGGATGTGCTTGATAAGCGG (SEQ ID NO. 1) Reverse: ACCATGTCCTTTCCAGTCTCT (SEQ ID NO. 2) Human GAPDH Forward: GTCTCCTCTGACTTCAACAGGG (SEQ ID NO. 3) Reverse:ACCACCCTGTTGCTGTAGCCAA (SEQ ID NO. 4) Human HGF Forward: GCTATCGGGGTAAAGACCTACA (SEQ ID NO. 5) Reverse: CGTAGCGTACCTCTGGATTGC (SEQ ID NO. 6) Human IL-6 Forward: CCCCTCAGCAATGTTGTTTGT (SEQ ID NO. 7) Reverse: CTCCGGGACTGCTAACTGG (SEQ ID NO. 8) Human PGE2 Forward: ATGCTGACTATGGCTACAAAAGC (SEQ ID NO. 9) Reverse:TCGGGCAATCATCAGGCAC (SEQ ID NO. 10) Human TGFβ Forward: CAATTCCTGGCGATACCTCAG (SEQ ID NO. 11) Reverse: GCACAACTCCGGTGCGACATCAA (SEQ ID NO. 12) Human TSG6 Forward: TCTGGCAAATACAAGCTCACC (SEQ ID NO. 13) Reverse: CTGCCCTTAGCCATCCATCC (SEQ ID NO. 14) like Figure 1 As shown, in the same number of cells, among MSCs treated with 40 mg / mL IFN-γ, the expression capacity of TSG6 in IFN-γ-pretreated umbilical cord mesenchymal stem cells was 5.5 times that of unpretreated mesenchymal stem cells, the expression capacity of PGE2 in IFN-γ-pretreated umbilical cord mesenchymal stem cells was 5.8 times that of unpretreated mesenchymal stem cells, the expression capacity of IL-6 in IFN-γ-pretreated umbilical cord mesenchymal stem cells was 2.9 times that of unpretreated mesenchymal stem cells, the expression capacity of TGF-β in IFN-γ-pretreated umbilical cord mesenchymal stem cells was 1.8 times that of unpretreated mesenchymal stem cells, the expression capacity of HGF in IFN-γ-pretreated umbilical cord mesenchymal stem cells was 2.7 times that of unpretreated mesenchymal stem cells, and the expression capacity of EGF in IFN-γ-pretreated umbilical cord mesenchymal stem cells was 1.8 times that of unpretreated mesenchymal stem cells. This indicates that the expression of immunosuppressive factors in mesenchymal stem cells increased most significantly under IFN-γ stimulation at 40 ng / mL.

[0071] Therefore, the optimal IFN-γ stimulation concentration was determined to be 40 ng / mL.

[0072] Example 2: In vitro verification of whether IFN-γ pretreatment at 40 ng / mL enhances the inhibition of PBMC and CD4-positive T cell proliferation by mesenchymal stem cells. In this embodiment, umbilical cord mesenchymal stem cells pretreated with 40 ng / mL IFN-γ for 24 hours were co-cultured with human PBMCs for three days. Flow cytometry was then used to detect the proliferation of PBMCs and CD4-positive T lymphocytes. PBMCs were pre-labeled using the CFSE method. The specific method is as follows: (1) PBMC separation: Peripheral blood samples from SS patients were collected using anticoagulant blood collection tubes. After centrifugation (600×g, 25 ℃, 10 min), the supernatant plasma was removed. The sample in the tube was replenished to the whole blood volume using pre-cooled PBS and mixed well. The diluted blood sample was slowly added along the tube wall to a centrifuge tube containing Ficoll lymphocyte separation solution, ensuring clear separation of the upper and lower liquid layers with a volume ratio of 1:1. Horizontal deceleration centrifugation (5 ascending, 2 descending, 600×g, 4 ℃, 20 min). After centrifugation, the liquid in the centrifuge tube mainly separated into 3 layers, from top to bottom: diluted plasma, Ficoll, red blood cells, and granulocytes. The white cloud layer at the junction of plasma and Ficoll was PBMC. This layer was aspirated and transferred to a new centrifuge tube, washed with PBS, and centrifuged (500×g, 4 ℃, 5 min) to obtain PBMC.

[0073] (2) CSFE staining: After washing the extracted PBMCs 2-3 times with PBS, resuspend the cells in PBS to a concentration of 5-10×10⁻⁶. 6 / mL. Add CFSE dye to the obtained cell suspension to a final concentration of 1 μM, mix well, and stain at room temperature in the dark for 10 min. Add 4-5 volumes of pre-cooled 1640 complete medium to stop staining, and let stand for 5 min. Centrifuge (500×g, 4 ℃, 5 min), and wash 3 times with 1640 complete medium to elute unbound dye.

[0074] (3) Co-culture of MSCs and PBMCs: Collect the upper layer of suspended PBMCs from the co-culture system, transfer them to a 96-well U-bottom cell culture plate and centrifuge (500×g, 4 ℃, 5 min). Wash the PBMCs with PBS and centrifuge again under the same conditions for staining. Add PMA, BFA, and Ion to 1640 complete medium at a ratio of 1000:1 to prepare the stimulant. Add 200 μL of resuspended PBMCs to each well and incubate at 37 ℃ for 4-5 h. Surface staining: Use 50 μL of staining liquid per well. After calculating the total volume, prepare antibodies using FACS (PBS + 1% FBS) according to the following proportions: anti-CD4 (1:350); anti-CD19 (1:350). Termination of stimulation: Centrifuge (500×g, 4 ℃, 5 min), discard supernatant; add 200 μL FACS to each well for washing, centrifuge again, discard supernatant; add 50 μL surface antibody mixture to each well, mix well, and incubate at 4 ℃ in the dark for 40 min. Cell fixation and permeabilization: After surface staining, add 150 μL FACS to each well to terminate staining, centrifuge (500×g, 4 ℃, 5 min), and discard supernatant. Nuclear membrane permeation: Prepare nuclear membrane permeation reagent and 1× termination solution (Permeabilization Buffer 10×:ddH2O = 1:9). After surface staining, add 100 μL nuclear membrane permeation solution to each well of samples requiring nuclear staining, and incubate at 4 ℃ in the dark for 45 min. Nuclear staining: 50 μL of staining solution was used per well. After calculating the total volume, antibodies were prepared using FACS (PBS + 1% FBS) at the following ratios: anti-IFN-γ (1:250); anti-IL17 (1:250). After nucleolysis, 200 μL of 1× stop solution was added to each well. After centrifugation (700×g, 4 ℃, 5 min), the supernatant was discarded. 50 μL of nuclear staining solution was added to each well, mixed well, and incubated at 4 ℃ in the dark for 1 h. Preparation for flow cytometry: 400 μL of 1× Binding Buffer was added, mixed gently, centrifuged, and the sample was filtered. Detection was performed using flow cytometry within 1 h. Results are shown below. Figure 2 and 3 .

[0075] like Figure 2 and Figure 3 As shown, pretreatment with 40 ng / mL IFN-γ significantly increased the proportion of MSCs suppressing PBMCs and CD4-positive T lymphocytes.

[0076] Example 3: MSC culture and MSC aggregate construction Human umbilical cord-derived MSCs were cultured in DMEM / F12 complete medium containing 10% FBS and 1% penicillin-streptomycin. The medium was changed every two days, and the cells were cultured in a cell culture incubator containing 5% CO2 at 37 °C. When the cell proliferation density reached 80%, the cells were digested with 0.25% trypsin and passaged. Subsequent experiments used cells no more than 6 passages to ensure cell functional stability. Finally, the cells were digested to obtain human umbilical cord-derived MSCs cultured to passage P6 (MSCs for short), which were used for subsequent intravenous injection in mice.

[0077] MSCs were added to culture flasks, and once the cell density reached 80%, recombinant human IFN-γ was added to DF12 complete culture medium to a final concentration of 40 ng / mL for 24 h of cell pretreatment. Subsequently, MSCs were digested with trypsin and prepared into 1×10⁻⁶ cells. 6 / mL of cell suspension was added to AggreWell plates treated with low-viscosity wetting wash and allowed to stand for 8 h to form 3D-MSC aggregates. Finally, the aggregates were collected, centrifuged and washed to obtain IFN-γ pretreated human umbilical cord-derived mesenchymal stem cell aggregates (referred to as 3D-MSCs), which were then used for subsequent intravenous injection in mice.

[0078] Example 4: In vivo validation of the therapeutic effect of 40 ng / mL IFN-γ pretreatment on mesenchymal stem cell aggregates. 1. Mice and their sources The mouse model of Sjögren's syndrome was established using female NOD / ShiLtjGpt mice (purchased from Jicui Yaokang), and age-matched healthy controls were female ICR mice (purchased from Jicui Yaokang).

[0079] 2. Grouping and Processing NOD mice were randomly divided into three groups: a disease control group (PBS group), an MSCs group, and a 3D-MSCs group, with five mice in each group. There were also five healthy control mice.

[0080] At 8-9 weeks of age, the mice in each group were treated as follows: MSCs group: Mice were injected via tail vein with the same total cell count (1×10⁻⁶). 6 MSCs (prepared in Example 3) were injected twice, once every two weeks. 3D-MSCs group: Mice were injected via tail vein with the same total cell count (1×10⁻⁶). 6 3D-MSCs (prepared in Example 3) were injected twice, once every two weeks. PBS group (NOD): Administer an equal volume of PBS, once every two weeks, for a total of two injections; Healthy control group (ICR): No special treatment was given except for routine dynamic weight monitoring.

[0081] 3. Detection and results of relevant indicators Salivary flow rate and animal tissue samples were collected from mice at 12-14 weeks of age, including: (1) Saliva flow rate detection Mice were weighed at 12-14 weeks of age, and the dosage of anesthetic drugs and pilocarpine was calculated. A 1.4% sodium pentobarbital solution was injected intraperitoneally. After the mice became inactive, a 3 μg / g dose of pilocarpine solution (dissolved in sterile physiological saline) was injected intraperitoneally according to the mice's weight. Syringes, clean EP tubes, and medical cotton balls were prepared in advance. The medical cotton balls were weighed and recorded before use. Five minutes after the pilocarpine injection, a clean cotton ball was placed around the mouse's mouth to collect saliva, with the mouse in a lateral or prone position. After collecting for 15 minutes, the cotton ball was removed, weighed, and placed in the corresponding EP tube, minimizing saliva loss during this process. The salivary flow rate (SFR) was calculated as follows: SFR (mg / g / h) = difference in salivary flow rate before and after cotton ball administration (mg) / mouse weight (g) / collection time (15 min). Results are shown below. Figure 5 .

[0082] like Figure 5 As shown, the salivary flow rate (SFR) of NOD model mice was significantly decreased. In the MSC and IFN-γ pretreated mesenchymal stem cell aggregate treatment groups, the SFR of mice was significantly restored, and the IFN-γ pretreated mesenchymal stem cell aggregates were more effective in restoring SFR than the ordinary MSC group.

[0083] (2) H&E staining of mouse submandibular glands After obtaining mouse submandibular glands, fixation was performed with 4% paraformaldehyde for 24 h, followed by paraffin embedding and sectioning. The sections were then stored at room temperature for later use. The paraffin sections were dewaxed sequentially in dewaxing agents I, II, and III for 10 min each, then immersed sequentially in anhydrous ethanol, 95% ethanol, 85% ethanol, and 75% ethanol for 5 min each, followed by rinsing with water. The sections were then immersed in hematoxylin staining solution for 5 min, followed by thorough rinsing with tap water to remove excess dye. Differentiation was performed with 0.8% hydrochloric acid alcohol for 2 s, followed by rinsing with water. Eosin staining was performed for 30 s, followed by 95% ethanol staining for 5 s, and then dehydration was performed in anhydrous ethanol I and II for 2 min. After clearing with xylene, the sections were mounted with neutral resin for further observation. Results are shown below. Figure 6 .

[0084] like Figure 6 The results demonstrated that treatment with MSC and IFN-γ pretreated mesenchymal stem cell aggregates reduced inflammatory lesions in the submandibular glands of NOD mice, and the IFN-γ pretreated mesenchymal stem cell aggregate treatment group showed a significant reduction in inflammatory lesions.

[0085] (3) TUNEL staining of mouse submandibular gland After obtaining mouse submandibular glands, OCT-embedded submandibular gland tissue blocks were cut into 10 μm thick sections, mounted, and air-dried. They could be stored at -20 °C for staining. Frozen sections were then removed and cells were fixed with 4% paraformaldehyde for 30 min. The sections were washed once with PBS, then incubated with PBS containing 0.3% Triton X-100 at room temperature for 5 min, followed by another wash with PBS. The sections were then incubated in 0.3% hydrogen peroxide solution prepared in PBS at room temperature for 20 min to inactivate endogenous peroxidase. Subsequently, the sections were washed three times with PBS or HBSS. Using a TUNEL staining kit, an appropriate amount of TUNEL detection solution was prepared and thoroughly mixed. 50 μL of TUNEL detection solution was added to the sample, and the sections were incubated at 37 °C in the dark for 60 min, maintaining a humid environment to reduce evaporation of the TUNEL detection solution. For mounting and observation: the sections were washed three times with PBS, mounted with anti-fluorescence quenching mounting solution, and observed under a fluorescence microscope. The usable excitation wavelength range is 450-500 nm, and the emission wavelength range is 515-565 nm. See the results below. Figure 7 .

[0086] from Figure 7 It is evident that the number of apoptotic epithelial cells in the submandibular gland tissue of NOD model mice increased. After treatment with MSC and IFN-γ pretreated mesenchymal stem cell aggregates, the number of apoptotic cells in the tissue decreased, and the inhibitory effect of IFN-γ pretreated mesenchymal stem cell aggregates on salivary gland epithelial cell apoptosis was more significant than that of the ordinary MSC group.

[0087] (4) Extraction of spleen lymphocytes After weighing and photographing the spleens, the cells were homogenized in PBS. The cell suspension was then transferred to 15 mL centrifuge tubes and centrifuged (450×g, 5 min, 4 ℃). The supernatant was discarded. Schizosin was added to the resulting precipitate and allowed to stand. FACS was then added to terminate lysis. After centrifugation (450×g, 5 min, 4 ℃), the cells were resuspended in each tube with an appropriate amount of FACS, and cell counting was performed. After adjusting the cell concentration, flow cytometry staining was performed. A specific volume of cells was placed in a 96-well U-shaped plate and centrifuged (500×g, 5 min, 4 ℃). A stimulant was prepared: 1640 complete medium + PMA (1000:1) + BFA (1000:1) + Lon (1000:1). Cells were then resuspended in 200 μL of the stimulant in each well and incubated at 37 ℃ for 5 h. Surface antibody dyes were prepared using FACS, with 50 μL of the following dye per well: L / D (1:1000); anti-CD45 (1:350); anti-CD4 (1:350); anti-CD8 (1:350). Termination of stimulation: Centrifuge (500×g, 5 min, 4 ℃), discard supernatant; add 200 μL FACS to each well, resuspend, centrifuge (500×g, 5 min, 4 ℃), discard supernatant; Surface staining: add 50 μL dye to each well, incubate at 4 ℃ in the dark for 45 min; Preparation of nuclear membrane rupture reagent: Fixation / Permeabilization Concentrate: Fixation Perm Diluent = 1:3; 1× termination solution: Permeabilization Buffer 10×: ddH2O = 1:9; Nuclear membrane rupture: add 150 μL FACS directly to each well, resuspend, centrifuge (500×g, 5 min, 4 ℃), discard supernatant; add 100 μL membrane rupture agent to each well, resuspend. Incubate at 4 ℃ in the dark for 60 min. Prepare nuclear staining antibodies: Add 50 μL of antibody to each well using 1×Permeabilization Buffer: anti-IFN-γ (1:250); anti-IL17 (1:250). Terminate cell permeabilization: Add 200 μL of 1×stop solution to each well, centrifuge (700×g, 5 min, 4 ℃). Nuclear staining: Add 50 μL of dye to each well, resuspend, and incubate at 4 ℃ in the dark for 60 min. After incubation, add 150 μL of FACS to each well to terminate staining, centrifuge at 700×g for 5 min. Discard the supernatant, resuspend cells in 150 μL of FACS in each well, filter, and analyze. Results are shown below. Figure 8 .

[0088] like Figure 8Flow cytometry results showed that there were a large number of Th1 and Th17 cells infiltrating the spleen in the PBS group, and IFN-γ pretreated mesenchymal stem cell aggregates could maximally suppress the proportion of Th1 and Th17 cells.

[0089] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the methods and techniques disclosed above without departing from the scope of the present invention to create equivalent embodiments. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. An aggregate of mesenchymal stem cells pretreated with IFN-γ, characterized in that, The aggregate is a three-dimensional aggregate of cells constructed by culturing mesenchymal stem cells pretreated with interferon-γ.

2. The mesenchymal stem cell aggregate according to claim 1, characterized in that, The mesenchymal stem cells are selected from one or more of the following: human umbilical cord-derived mesenchymal stem cells, bone marrow-derived mesenchymal stem cells, adipose-derived mesenchymal stem cells, and dental pulp-derived mesenchymal stem cells.

3. The mesenchymal stem cell aggregate according to claim 2, characterized in that, The mesenchymal stem cells mentioned are human umbilical cord mesenchymal stem cells.

4. The mesenchymal stem cell aggregate according to claim 1, characterized in that, The concentration of IFN-γ pretreatment was 10-80 ng / mL, and the pretreatment time was 12-48 hours.

5. The mesenchymal stem cell aggregate according to claim 4, characterized in that, The concentration of IFN-γ pretreatment was 40 ng / mL, and the pretreatment time was 24 hours.

6. The mesenchymal stem cell aggregate according to claim 1, characterized in that, The culture method is selected from any one of the following: 3D cell culture plate method, low adhesion culture plate method, hanging drop method, microcarrier rotation culture method, or bioreactor culture method.

7. The mesenchymal stem cell aggregate according to claim 1, characterized in that, The aggregates possess at least one of the following biological characteristics: (1) The expression levels of immune regulation-related factors are significantly increased, including at least one of TSG6, PGE2, TGF-β, HGF, EGF or IL-6; (2) It significantly enhances the inhibitory effect on the proliferation of human peripheral blood mononuclear cells; (3) It significantly enhances the inhibitory effect on the pro-inflammatory subsets Th1 and / or Th17 in human CD4 positive T lymphocytes.

8. A method for preparing mesenchymal stem cell aggregates according to any one of claims 1-7, characterized in that, The method includes the following steps: (1) Mesenchymal stem cells were incubated in a medium containing interferon-γ to obtain pretreated mesenchymal stem cells; (2) The pretreated mesenchymal stem cells are seeded into a culture system and cultured to obtain cell aggregates with a three-dimensional aggregate structure.

9. The preparation method according to claim 8, characterized in that, In step (1), the final concentration of IFN-γ in the culture medium is 10-80 ng / mL, preferably 40 ng / mL; The incubation time is 12-48 hours, preferably 24 hours.

10. The preparation method according to claim 8, characterized in that, In step (2), the culture system is selected from any one of low adhesion culture plates, microporous array culture plates, hanging drop culture plates or rotating bioreactors.

11. The following application of the mesenchymal stem cell aggregates according to any one of claims 1-7: (i) Application in the preparation of immunosuppressive products; (ii) Application in the preparation of products that reduce inflammatory damage; (iii) Application in the preparation of products for the repair of exocrine function; (iv) Application in the preparation of products for treating Sjögren's syndrome; The products include drugs or vaccines.

12. The application according to claim 11, characterized in that, The drug is an injectable preparation, administered to the subject via intravenous injection, local injection, or in situ injection into the tissue.