Universal stem cell exosome tracer cell model and construction method and application thereof

Abstract

The present application relates to a kind of general stem cell exosome tracer cell model and its construction method and application, belong to biotechnology field.The present application is fused by genetic engineering means, and exosome membrane marker protein is fused with fluorescence reporter gene, bioluminescence reporter gene, and is stably integrated into the safe insertion site of stem cell genome, establishes the tracer cell model of double-mode labeled exosome that can be stably secreted.The tracer cell model of the present application can be applied in myocardial infarction repair, tumor targeted therapy and the diagnosis of various disease models, which helps to improve the conversion application value of exosome research.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a universal stem cell exosome tracer cell model, its construction method, and its application. Background Technology

[0002] Stem cell-derived exosomes (SC-Exos) are natural nanoparticles released from intracellular multivesicular bodies (MVBs) via exocytosis, and have become a core focus of research in intercellular communication and regenerative medicine in recent years. As a key mediator of the paracrine effect of stem cells, SC-Exos are crucial for driving tissue repair in transplant therapy. Exosomes can carry bioactive substances specific to stem cells, such as proteins, lipids, DNA, mRNA, miRNA, and lncRNA, acting as cell-free "information carriers" and playing a vital role in regulating target cell function, maintaining microenvironmental homeostasis, promoting tissue repair, and modulating the immune system. Natural stem cell exosomes, such as those secreted by mesenchymal stem cells (MSCs), can promote angiogenesis, reduce inflammation, and accelerate wound healing; exosomes derived from induced pluripotent stem cells (iPSCs) have shown promising therapeutic potential in neurodegenerative diseases and spinal cord injury repair.

[0003] However, current exosome research still faces many challenges. First, the distribution patterns and dynamic migration pathways of exosomes in vivo lack systematic analysis. Due to the lack of effective long-term tracking tools, there is currently a lack of intuitive evidence on how exosomes enter target tissues, cross biological barriers, and are utilized in specific microenvironments. Second, existing labeling and tracking methods have significant limitations. For example, membrane dye labeling methods (PKH26, DiR labeling, etc.), while simple to operate, often suffer from problems such as dye residue, strong background signals, and rapid fluorescence decay; transient transfection of fluorescent or bioluminescent fusion proteins is easily affected by transfection efficiency and stability, and results are difficult to reproduce between laboratories. Third, the exosome isolation, purification, and detection methods used by different laboratories vary considerably, and a unified technical standard has not yet been established, making research results incomparable. Finally, the lack of a standardized tracking resource that can be universally applied to different stem cell sources limits comparative studies of exosomes from different sources and also restricts the translational application of exosome-related research. Therefore, effectively solving the exosome tracking problem is one of the key issues in basic and translational stem cell research.

[0004] Furthermore, constructing a stable exosome tracking system relies not only on simple exosome labeling but also on the synergistic optimization of several key technical aspects, including the selection of integration sites for exogenous tracking elements in host cells, the adaptability of exosome membrane markers, and the design of the reporter system. Existing technologies indicate that different safe sites in iPSCs and their post-differentiated cells do not consistently support transgene expression intensity and stability, suggesting that the selection of integration sites affects the persistence and reliability of the tracking system. Meanwhile, the vesicle subpopulations corresponding to commonly used EV membrane markers such as CD63, CD9, and CD81 are not entirely identical, and their fusion constructs may exhibit differences in expression and loading performance across different cell types. In addition, the design of different fluorescent or luminescent reporter genes significantly affects signal intensity, expression stability, and applicable observation modes, thus impacting the overall performance of the tracking system. Therefore, establishing a tracking strategy for stem cells and their derived exosomes that combines stability, specificity, and reproducibility remains a technical challenge to be addressed in the current technology. Summary of the Invention

[0005] Therefore, the technical problem to be solved by the present invention is to overcome the problems of signal instability, large background interference, rapid fluorescence decay, poor versatility, low reproducibility of experimental results, and how exosomes enter target tissues, cross biological barriers, and are utilized in specific microenvironments in the existing stem cell exosome tracking technology.

[0006] To address the aforementioned technical problems, this invention provides a universal stem cell exosome tracking cell model, its construction method, and its applications. This invention utilizes genetic engineering techniques to fuse fluorescent reporter genes and bioluminescent reporter genes with exosome membrane marker proteins, stably integrating them into safe insertion sites within the stem cell genome to establish a tracking cell model capable of stably secreting bimodal labeled exosomes. This tracking cell model can be applied to the diagnosis of various disease models, such as myocardial infarction repair and targeted tumor therapy, contributing to enhancing the translational application value of exosome research.

[0007] The first objective of this invention is to provide a universal stem cell exosome tracking cell model that integrates an expression cassette at the AAVS1 site of stem cells, wherein the expression cassette includes CD63, enhanced green fluorescent protein, and NanoLuc luciferase linked together.

[0008] Furthermore, the gene sequence encoding CD63 is shown in SEQ ID NO.1, and the gene sequence encoding NanoLuc luciferase is shown in SEQ ID NO.2.

[0009] Furthermore, SEQ ID NO.1:

[0010] ATGGCCGTGGAGGGCGGCATGAAGTGCGTGAAGTTTCTGCTGTACGTGCTGCTGCTGGCCTTTTGTGCCTGCGCCGTCGGACTGATCGCCGTGGGCGTGGGCGCCCAGCTGGTGCTGAGCCAGACCATTATCCAGGGCGCCACCCCTGGCAGCCTGCTGCCAGTGGTGATCATTGCCGTGGGCGTGTTCCTGTTCCTGGTGGCTTTCGTGGGATGCTGTGGCGCCTGTAAAGAAAACTATTGTCTGATGATCACCTTCGCCATTTTTCTGAGCCTCATCATGCTGGTGGAAGTGGCTGCCGCCATTGCCGGGTACGTGTTTCGGGATAAGGTGATGAGCGAGTTCAACAACAATTTTAGACAGCAGATGGAAAATTACCCCAAGAATAACCACACAGCATCCATCCTGGACAGGATGCAGGCCGATTTCAAGTGCTGCGGCGCCGCCAATTACACCGATTGGGAGAAGATCCCCTCCATGTCCAAGAACCGGGTGCCTGACTCCTGCTGTATTAACGTGACCGTGGGATGCGGCATTAACTTTAATGAGAAGGCCATCCACAAAGAGGGATGCGTCGAGAAAATCGGCGGGTGGCTGCGGAAAAACGTGCTGGTGGTGGCCGCCGCCGCTCTGGGCATCGCCTTCGTGGAAGTGCTGGGAATCGTGTTCGCATGTTGTCTGGTCAAGAGCATTCGCTCCGGGTATGAGGTGATG。

[0011] Further, SEQ ID NO.2:

[0012] .

[0013] Furthermore, the stem cells include induced pluripotent stem cells.

[0014] The second objective of this invention is to provide a method for preparing a universal stem cell exosome tracer cell model, the method comprising the following steps:

[0015] S1. Construct a gRNA pair targeting the AAVS1 site and a donor DNA containing an expression cassette encoding a gene, wherein the expression cassette includes a linked CD63, enhanced green fluorescent protein, and NanoLuc luciferase.

[0016] S2. Transfect the recombinant vector containing the Cas9 protein encoding gene, gRNA pair and donor DNA into stem cells and screen them to obtain the universal stem cell exosome tracer cell model.

[0017] Furthermore, the sequences of the gRNA pair are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0018] SEQ ID NO. 3: CACCATGGTGAGCAAGGGCG.

[0019] SEQ ID NO.4: GGGGCCACTAGGGACAGGAT.

[0020] Furthermore, the connection setup includes using a GGGGSGGGGSGGGGS connector sub-connection.

[0021] Further, in step S2, the Cas9 protein-coding gene and gRNA pair are constructed into a lentiviral expression vector as a first lentivirus, and the donor DNA is constructed into another lentiviral expression vector as a second lentivirus. The first and second lentiviruses are transfected into stem cells and screened to obtain the universal stem cell exosome tracer cell model.

[0022] Furthermore, the stem cells include induced pluripotent stem cells.

[0023] A third objective of this invention is to provide an application of the above-described universal stem cell exosome tracking cell model or the cell model prepared by the described method in the preparation of exosome tracking products.

[0024] The fourth objective of this invention is to provide a method for tracing exosomes during stem cell differentiation. The method involves inducing and culturing the universal stem cell exosome tracing cell model or the cell model prepared by the method, and then observing the exosomes by fluorescence detection of the supernatant after induction culture.

[0025] Compared with the prior art, the above-described technical solution of the present invention has the following advantages:

[0026] (1) Achieve stable and long-term expression of the tracer signal: The fusion reporter gene is stably integrated into the safe site of the stem cell genome, avoiding the expression instability of transient transfection and the signal attenuation problem of dye labeling. It can realize long-term in vivo dynamic tracer of exosomes, and the reporter gene can be stably inherited with the division and differentiation of stem cells.

[0027] (2) Enhance the specificity of the tracer signal and reduce background interference: The reporter gene is fused with the exosome membrane marker protein and generates a specific tracer signal only on the secreted exosomes. This avoids the background noise caused by the non-specific uptake of dye particles and can accurately distinguish the real signal of the exosomes, realizing the full-process specific visualization of the exosomes from secretion to target tissue uptake.

[0028] (3) Ensure the natural biological function of exosomes: Stable gene modification is used instead of chemical dye labeling or transient transfection, avoiding the damage of exogenous substances to the structure and function of exosomes.

[0029] (4) Provide technical support for precision medicine: The tracer cell line of the present invention can be applied in various disease models such as myocardial infarction repair and tumor targeted therapy, thereby enhancing the translational potential of exosome research. Attached Figure Description

[0030] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

[0031] Figure 1 This is a schematic diagram of the construction of an exosome-tracing cell line based on CRISPR / Cas9 gene editing;

[0032] Figure 2 This is a schematic diagram of the structure of the VB250424-1139efv lentivirus packaging vector;

[0033] Figure 3 This shows the correspondence between Luc signal, GFP signal and protein content. Detailed Implementation

[0034] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0035] Example 1: Universal stem cell exosome tracking cell model

[0036] This embodiment discloses a method for constructing a stable bimodal marker exosome tracking cell line by site-specific integration of the CD63-EGFP-NanoLuc fusion gene into the AAVS1 site of human iPSC cells. The core method relies on CRISPR / Cas9-mediated homologous recombination technology, and the specific implementation steps are as follows:

[0037] (1) Molecular design and vector preparation

[0038] Target and gRNA Design: To obtain engineered stem cell lines that stably express exosome-tracing fusion proteins, this embodiment selects AAVS1 as the site-specific integration site. AAVS1 is one of the commonly used safe sites in human cells, suitable for the stable integration of exogenous expression cassettes. The open site of AAVS1 on human chromosome 19 was selected as the gene integration target, and 2-3 specific gRNAs with high cleavage efficiency and low off-target risk were designed using Benchling tools.

[0039] A Cas9 / gRNA lentiviral expression vector was constructed to ensure efficient expression of Cas9 protein and gRNA in iPSCs, achieving precise double-strand breaks at the AAVS1 site. Donor vector preparation: A commercially available custom-designed pAAVS1-EF1A>hCD63(co_H):3GGGGS:EGFP:3GGGGS:Nluc (co_H) vector (9165 bp) (catalog number: VB250424-1139efv) was directly selected as the Donor DNA. Its core components and characteristics are as follows:

[0040] 1. Homologous arm: Contains two homologous sequences upstream and downstream of the AAVS1 site, ensuring HDR homologous recombination efficiency;

[0041] 2. Expression cassette: EF1A promoter → Kozak sequence → human codon-optimized hCD63 (co_H) → 3×GGGGS flexible linker peptide → EGFP → 3×GGGGS flexible linker peptide → codon-optimized Nluc (co_H), with β-globin poly(A) signaling for transcription termination. The human codon optimization of hCD63 and Nluc is a key design to ensure effective tracking. Adapting to the codon usage preferences of human hiPSCs and their directed differentiation cells, it significantly improves the translation efficiency and expression level of the fusion protein, avoiding protein folding abnormalities and membrane localization deviations caused by rare codons. Simultaneously, it significantly improves Nluc enzyme activity and luminescence efficiency, as well as EGFP fluorescence brightness, ensuring the expression stability of the fusion protein throughout cell passage and differentiation. It achieves a linear quantitative relationship between the tracking signal and exosome volume, laying the foundation for high sensitivity, high specificity, and batch-to-batch reproducibility in dual-modal tracking.

[0042] 3. Screening element: Contains T2A-PuroR tandem element, combined with bGH poly (A) signal, to achieve co-expression and auto-cleavage of puromycin resistance.

[0043] 4. Vector characteristics: High copy plasmid, containing AmpR ampicillin resistance, ori replication origin, cloning host adapted to VBUltraStable strain, can be directly used for lentiviral packaging.

[0044] Lentiviral expression vector construction: The commercial Donor vector (VB250424-1139efv) was constructed into a lentiviral expression vector, which was used together with the Cas9 / gRNA lentiviral vector for subsequent viral packaging.

[0045] (2) Lentiviral packaging and concentration

[0046] HEK293T cells were used as the packaging host. Cas9 / gRNA lentiviral vector and Donor lentiviral vector (VB250424-1139efv) were co-transfected with lentiviral packaging plasmids into HEK293T cells. The packaging system was constructed using conventional liposome transfection. Cell supernatant was collected at 48h and 72h after transfection, and the virus was concentrated by ultracentrifugation.

[0047] (3) iPSC culture and pretreatment

[0048] Using mTeSR TM 1. Culture hiPSCs in culture medium, maintaining the cells in the logarithmic growth phase and achieving a confluence of 70-80%.

[0049] (4) Viral co-transfection and gene editing

[0050] Discard the original culture medium in the hiPSC culture dish, add a mixed infection solution containing Cas9 / gRNA lentivirus and Donor lentivirus (VB250424-1139efv), and incubate in a 37℃, 5% CO2 constant temperature incubator for 12-24h.

[0051] Discard the viral infection fluid and replace it with fresh mTeSR. TM 1. Complete culture medium, continue culturing for 48 h, and achieve site-specific integration of the CD63-EGFP-NanoLuc fusion gene on the Donor vector at the AAVS1 site through CRISPR / Cas9-mediated HDR homologous recombination.

[0052] (5) Drug screening and monoclonalization

[0053] Puromycin screening: 48-72 hours after viral infection, add 0.5-1 μg / mL puromycin to iPSC medium, replace with fresh drug-containing medium daily, and continue screening for 7-10 days until all uninfected blank control cells die.

[0054] (6) Identification of positive clones

[0055] Genomic PCR identification: AAVS1 site-specific primers (AAVS1-F / AAVS1-R) were designed to amplify the genomic DNA of monoclonal cells by PCR. The reaction program was: 95℃ pre-denaturation for 5 min → (95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 2 min) × 35 cycles → 72℃ final extension for 7 min. Agarose gel electrophoresis was used to detect the amplified bands. The wild-type cell band was approximately 500 bp, and the positive cell band for site-specific integration of the fusion gene was approximately 2 kb (adjusted according to the actual size of the inserted fragment).

[0056] Southern blot validation: Genomic DNA was extracted from monoclonal cells that were positive by PCR and digested with restriction endonucleases such as ApaLI (7891 bp and 8465 bp restriction sites). The digested products were transferred to a membrane and hybridized with CD63 or PuroR probes to verify single-copy site-directed integration of the fusion gene and exclude random integration.

[0057] Functional validation: Fluorescence observation: Cells were observed under a fluorescence microscope to verify the cell membrane localization of EGFP green fluorescence (CD63 is a membrane protein characteristic); Luciferase activity detection: Cells were lysed or cell culture supernatant was collected, NanoLuc-specific substrate was added, and the luminescence value was detected by a chemiluminescence detector to evaluate the expression activity of Nluc (co-H); Exosome characterization: Culture supernatant of positive clone cells was collected, and exosome particle size and concentration were detected by nanoparticle tracking analysis (NTA). CD63 exosome marker protein was detected by Western blot, and exosome morphology was observed by transmission electron microscopy (TEM) to verify the secretion efficiency of dual-modal labeled exosomes.

[0058] (7) iPSC Functionality and Multipotency Verification

[0059] Pluripotency marker detection: The expression of pluripotency core markers such as OCT4, SOX2, and NANOG in cells was detected by immunofluorescence staining to confirm that gene editing at the AAVS1 site did not affect the stemness of iPSCs;

[0060] Differentiation potential verification: Conduct cardiomyocyte directed differentiation experiments to verify the multi-directional differentiation ability of iPSCs after gene editing.

[0061] (8) Cardiac differentiation of stem cell exosome-traced cell lines

[0062] ① Maintenance and passage of stem cells: Cells are seeded in Matrigel-coated cell culture dishes and cultured in PSCeasy® culture medium with clearly defined chemical composition to maintain stem cell stemness and proliferation.

[0063] When the cell density reached approximately 85%, the cells were dissociated using 0.5 mM EDTA at 37°C for 3 min. After digestion was terminated, the cells were seeded at a 1:5 ratio. To inhibit programmed cell death triggered by cell dissociation during passage, 2 μM Thiazovivin was added to the culture medium. The cells were then cultured in a cell culture incubator at 37°C with 5% CO2.

[0064] ② Cardiomyocyte induction protocol: Cardiomyocyte differentiation begins when cell density reaches approximately 90%. From day 0 to day 2, induce differentiation by adding 2 μM of the Wnt signaling activator CHIR99021 and induction medium. From day 2 to day 3, add 1 μM of the Wnt signaling inhibitor IWR-1. After day 3, change the medium every two days. Collect the supernatant from cardiomyocytes after day 14.

[0065] (9) Preparation and enrichment of tracer exosomes (ultrafiltration concentration + PEG precipitation)

[0066] The collected cell supernatant was centrifuged at 300g for 5 min at 4℃ to remove cells, and the supernatant was collected again. Then, it was centrifuged at 2000g for 15 min to remove cell debris and the supernatant was collected again. 15 mL of the centrifuged supernatant was added to the inner tube, balanced, and centrifuged at 4℃, 4000×g for 45 min to concentrate the volume to 0.2-1 mL. Approximately 14 mL of supernatant was added in batches, and the ultrafiltration concentration steps at 4℃, 4000×g, and 45 min were repeated (for a total of two more additions) until the sample was concentrated to 0.2-1 mL. The inner tube was removed, and the concentrate was transferred to a clean centrifuge tube. Both sides of the ultrafiltration membrane were rinsed three times with 200 μL PBS, and the rinsing solution was combined with the concentrate. 500 μL of the concentrate was added to a 1.5 mL EP tube, and 500 μL of 16% PEG solution was added. The mixture was thoroughly mixed by pipetting or inverting, and incubated at 4℃ for 6 h to overnight. After incubation, the mixture was balanced and centrifuged at 4℃, 12000×g for 1 minute. h. Carefully discard the supernatant to avoid disturbing the precipitate, and finally resuspend the precipitate with 200 μL PBS to obtain the exosome-enriched sample.

[0067] (10) Physicochemical characterization of tracer exosomes and verification of tracer signals

[0068] NTA was used to detect exosome samples to obtain particle size distribution and particle concentration, and parameters such as X50, peak particle size, and particle concentration were recorded. Simultaneously, exosome samples were subjected to TEM observation to confirm their typical vesicle morphology. Western blot was then used to detect exosome markers, including CD63, CD9, CD81, and TSG101 (optional negative markers such as Calnexin were detected to exclude organelle contamination). For tracer signal verification, the GFP signal of exosomes themselves or exosome-treated cells was observed using fluorescence, and the luminescence intensity was measured by adding Luciferase substrate. A standardized correspondence was established between the luminescence signal and exosome protein content (BCA) or particle number (NTA) for subsequent exosome quantification and batch-to-batch comparisons.

[0069] Imaging and quantitative analysis were performed after adding the same batch of tracer exosomes to well plates at different doses. The results showed that the luminescence signal of each ROI increased progressively from ROI1 to ROI5, indicating that the tracer signal showed a monotonically increasing trend with the increase of exosome dosage. Figure 3 (A) Further, a calibration curve was established with the exosome protein level measured by BCA as the x-axis and the luminescence signal as the y-axis. The two showed a good linear correlation, and the fitted curve yielded Luc = 6 × 10⁻⁶. 6 ·P-3×10 7 (R) 2 =0.9849)( Figure 3 (B) indicates that the amount of exosomal protein can be inferred from the measured Luc signal for dose uniformity and batch-to-batch comparison; similarly, GFP fluorescence intensity is also linearly correlated with protein amount, and the fitted result is GFP = 17.399·P + 522.4 (R). 2 =0.9857)( Figure 3 (C in the example). Therefore, this embodiment demonstrates that the tracer exosome can not only generate a stable and detectable tracer signal, but also establish a quantitative conversion relationship between protein quantity and signal, thereby achieving standardized quantification and quality control.

[0070] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A universal stem cell exosome tracking cell model, characterized in that, The universal stem cell exosome tracking cell model integrates an expression cassette at the AAVS1 site of stem cells, wherein the expression cassette includes CD63, enhanced green fluorescent protein, and NanoLuc luciferase linked together.

2. The universal stem cell exosome tracking cell model according to claim 1, characterized in that, The gene sequence encoding CD63 is shown in SEQ ID NO.1, and the gene sequence encoding NanoLuc luciferase is shown in SEQ ID NO.

2.

3. The universal stem cell exosome tracking cell model according to claim 1, characterized in that, The stem cells include induced pluripotent stem cells.

4. A method for preparing a universal stem cell exosome tracer cell model, characterized in that, The preparation method includes the following steps: S1. Construct a gRNA pair targeting the AAVS1 site and a donor DNA containing an expression cassette encoding a gene, wherein the expression cassette includes a linked CD63, enhanced green fluorescent protein, and NanoLuc luciferase. S2. Transfect the recombinant vector containing the Cas9 protein encoding gene, gRNA pair and donor DNA into stem cells and screen them to obtain the universal stem cell exosome tracer cell model.

5. The preparation method according to claim 4, characterized in that, The sequences of the gRNA pairs are shown in SEQ ID NO.3 and SEQ ID NO.

4.

6. The preparation method according to claim 4, characterized in that, The connection setup includes using a GGGGSGGGGSGGGGS connection sub-connection.

7. The preparation method according to claim 4, characterized in that, In step S2, the Cas9 protein-coding gene and gRNA pair are constructed into a lentiviral expression vector as the first lentivirus, and the donor DNA is constructed into another lentiviral expression vector as the second lentivirus. The first and second lentiviruses are transfected into stem cells and screened to obtain the universal stem cell exosome tracer cell model.

8. The preparation method according to claim 4, characterized in that, The stem cells include induced pluripotent stem cells.

9. The use of the universal stem cell exosome tracking cell model according to any one of claims 1-3 or the cell model prepared by the preparation method according to any one of claims 4-8 in the preparation of exosome tracking products.

10. A method for tracing exosomes during stem cell differentiation, characterized in that, The method is as follows: the universal stem cell exosome tracer cell model according to any one of claims 1-3 or the cell model prepared by the preparation method according to any one of claims 4-8 is induced and cultured, and the exosomes can be observed by fluorescence detection of the supernatant after induction culture.

Images