Method for constructing prolactinoma drug-sensitive cell strain based on crisper / cas9 technology and application thereof

Abstract

The application discloses a method for constructing a prolactinoma drug sensitive cell strain based on a CRISPR / Cas9 technology, which knocks out a KBTBD7 gene of MMQ cells by using a CRISPR / Cas9 system to obtain a PRL-PitNET cell strain. The application also discloses an application of the PRL-PitNET cell strain in preparation of a PRL-PitNET treatment drug. Compared with a prior art which obtains a drug sensitive cell by plasmid or lentivirus overexpression of DRD2, the application knocks out an E3 ubiquitination ligase KBTBD7 which regulates ubiquitination degradation of DRD2 by using a CRISPR / Cas9 gene editing technology (non-treatment purpose), and obtains the PRL-PitNET cell strain which has high expression of DRD2 and is sensitive to dopamine agonists. The DRD2 has high expression efficiency and better stability, and is not affected by long-term subculturing.

Description

Technical Field

[0001] This invention relates to the field of cell biology technology, specifically to a method and application for constructing drug-sensitive prolactinoma cell lines based on CRISPR / Cas9 technology. Background Technology

[0002] Pituitary neuroendocrine tumors (PitNETs) are common benign tumors. The incidence of clinically manifested PitNETs is approximately 1 in 1100, while autopsy and imaging reports indicate a prevalence of 10%. PitNETs originate from the anterior pituitary gland within the pituitary fossa and can cause mass effect, leading to headaches, vomiting, altered consciousness, decreased vision, and even blindness. They can also secrete excessive hormones, causing metabolic disorders that affect organs throughout the body, resulting in disfigurement and internal imbalances such as acromegaly, central obesity, infertility, hypertension, diabetes, heart failure, and osteoporosis. In 2022, the WHO classified PitNETs into several types based on factors such as whether they secrete excessive hormones, anterior pituitary cell lineage, hormone composition, specific histological and immunohistochemical characteristics: Nonfunctioning PitNET (NF-PitNET), Growth hormone-secreting PitNET (GH-PitNET), Prolactin-secreting PitNET (PRL-PitNET), Adrenocorticotrophic hormone corticotropin-secreting PitNET (ACTH-PitNET), Thyroid-stimulating hormone-secreting PitNET (TSH-PitNET), Gonadotropin-secreting PitNET, zero-cell type, and multi-hormone type.

[0003] PRL-PitNET is the most common type of PitNET, primarily presenting as microadenomas and rarely growing into large adenomas, while giant adenomas (tumor diameter greater than 40 mm) are rare. Currently, the main treatments for PRL-PitNET patients are drug therapy (first-line treatment), surgery, and radiotherapy. Dopamine agonists, such as bromocriptine, cabergoline, and quinolones, are effective in lowering serum prolactin levels, improving hyperprolactinemia, and shrinking adenomas. Dopamine agonist therapy is the first-line treatment for PRL-PitNET patients, as well as patients with symptomatic idiopathic hyperprolactinemia (hyperprolactinemia without a clear cause), large adenomas, or those considering pregnancy. Dopamine agonists exert their therapeutic effect by specifically targeting and activating the dopamine D2 receptor (DRD2), resulting in improved visual field in 97% of patients, normalization of serum prolactin levels in 60% of patients, and a reduction in adenoma volume in 74% of patients. Although most PRL-PitNET patients achieve good treatment results after treatment with dopamine agonists, about 20-30% of patients are resistant to bromocriptine and about 5-15% are resistant to cabergoline.

[0004] Therefore, a thorough understanding of the underlying mechanisms of PRL-PitNET resistance is crucial to socioeconomic benefits and people's livelihoods. Numerous previous studies have observed and confirmed that low expression or reduced activity of DRD2 in PRL-PitNET patients is a major cause of dopamine agonist resistance. Because PRL-PitNET patients are primarily treated with drugs, the number of clinical patients is relatively small, making the isolation of primary PRL-PitNET cells difficult. Therefore, constructing stable cell lines with high DRD2 expression and sensitivity to dopamine agonist drugs is essential for in-depth research on PRL-PitNET resistance. Summary of the Invention

[0005] The purpose of this invention is to provide a method for constructing drug-sensitive prolactinoma cell lines based on CRISPR / Cas9 technology, which solves the problem of the lack of PRL-PitNET cell lines that highly express DRD2 and are sensitive to dopamine agonists in the existing technology, and provides a valuable means for subsequent research on PRL-PitNET.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: A method for constructing drug-sensitive prolactinoma cell lines based on CRISPR / Cas9 technology involves knocking out the KBTBD7 gene in MMQ cells using the CRISPR / Cas9 system to obtain the PRL-PitNET cell line.

[0007] Furthermore, the CRISPR / Cas9 system includes sgRNA, the primer sequences of which are SEQ ID No. 1 and SEQ ID No. 2; or at least one of the sequences shown in SEQ ID No. 3 and SEQ ID No. 4.

[0008] Furthermore, the method for constructing a drug-sensitive prolactinoma cell line based on CRISPR / Cas9 technology includes the following steps: S10: Design sgRNA primer sequences targeting the KBTBD7 gene, such as SEQ ID No. 1 and SEQ ID No. 2; or SEQ ID No. 3 and SEQ ID No. 4; S20. Constructing the targeting plasmid LentiCRISPRv2: Linearize the LentiCRISPRv2 vector with the restriction endonuclease BsmBI, and ligate the sgRNA into the linearized LentiCRISPRv2 vector using the T4 ligase. S30, Transfection of HEK293T cells: Targeting plasmid LentiCRISPRv2 and packaging plasmids psPAX2 and pMD2.G were transfected into HEK293T cells using liposome 3000; S40. Infecting MMQ cells: MMQ cells were infected with transfected HEK293T cells to obtain the PRL-PitNET cell line.

[0009] Furthermore, in step S20, the linearized LentiCRISPRv2 vector system after enzyme digestion is first loaded onto an agarose gel for electrophoresis, then the linearized LentiCRISPRv2 vector is recovered and purified, and then ligated with sgRNA.

[0010] Further, in step S30, the targeting plasmid LentiCRISPRv2 is added to competent cells, incubated on ice, heat-shocked, and then spread onto LB medium to cultivate single-clonal colonies. After the single-clonal colonies are generated, a single colony is picked and inoculated into LB liquid medium containing ampicillin for shaking culture. The plasmid is extracted from the culture broth using the alkaline lysis method. After lysis, neutralization, centrifugation, adsorption washing, and elution purification, high-purity recombinant targeting plasmid LentiCRISPRv2 is obtained, which is then transfected.

[0011] Furthermore, in step S30, the constructed targeting plasmid LentiCRISPRv2 and packaging plasmids psPAX2 and pMD2.G are transfected with liposome 3000 at a ratio of 5 µg: 5 µg: 5 µg.

[0012] Furthermore, in step S40, the endogenous protein levels of the infected MMQ cells were verified by Western blot, and puromycin was added for pressure screening. The MMQ cell line that stably survived in puromycin and highly expressed DRD2 was selected as the PRL-PitNET cell line.

[0013] Another aspect of the present invention is to provide the application of the PRL-PitNET cell line prepared by the method for constructing a drug-sensitive prolactinoma cell line based on CRISPR / Cas9 technology in the preparation of PRL-PitNET therapeutic drugs.

[0014] Furthermore, the PRL-PitNET therapeutic agent is a dopamine agonist.

[0015] Compared with the prior art, the present invention has the following beneficial effects: This invention obtains a monoclonal PRL-PitNET cell line with high DRD2 expression by targeting and knocking out the key E3 ubiquitination ligase that regulates DRD2 ubiquitination degradation. The cell line exhibits high DRD2 expression efficiency, better stability, and is not affected by long-term passage, providing a valuable tool for subsequent research on PRL-PitNET. Attached Figure Description

[0016] Figure 1 Electrophoresis diagram of the linearized restriction enzyme digestion of the LentiCRISPRv2 vector; Figure 2 The plate clone of the constructed Lenticrispr-KBTBD7-sgRNA1 plasmid (left) and the sequencing results of its single clone plasmid (right). Figure 3 The plate clone of the constructed Lenticrispr-KBTBD7-sgRNA2 plasmid (left) and the sequencing results of its single clone plasmid (right). Figure 4 This image shows the KTBBD7 knockout assay using Western blotting. Figure 5 To detect the protein level of DRD2 after KTBBD7 knockout using Western blotting; Figure 6 To test the efficacy of the constructed DRD2-overexpressing cell line against the dopamine agonist (camergolin) using CCK8 assay. Detailed Implementation

[0017] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. Examples of the embodiments are shown in the accompanying drawings, wherein the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain the present invention, and should not be construed as limiting the present invention.

[0018] Currently, dopamine agonists remain the first-line treatment for PRL-PitNET patients, and these agonists primarily exert their therapeutic effect by specifically activating the DRD2 receptor. Previous clinical and basic research has found that decreased DRD2 expression levels or activity are common in PRL-PitNET resistant patients. Clinically, surgical PRL-PitNET is less common, primary cell isolation is difficult, and the focus is primarily on drug-resistant PRL-PitNET patients.

[0019] Previous studies have shown that drug-sensitive cells can be obtained by overexpressing DRD2 using plasmids or lentiviruses. However, these methods have the following drawbacks: ① Transient plasmid transfection has a short maintenance period and unstable transfection efficiency, requiring repeated operations; ② Although lentiviral overexpression can obtain stable cell lines, its overexpression efficiency is poor because DRD2 is a seven-transmembrane protein, and long-term passage can also lead to fluctuations in DRD2 levels.

[0020] Currently, there is a lack of PRL-PitNET cell lines that highly express DRD2 and are sensitive to dopamine agonists. Therefore, this application utilizes CRISPR / Cas9 gene editing technology (non-therapeutic purpose) to knock out the E3 ubiquitination ligase KBTBD7, which regulates DRD2 ubiquitination degradation, thus obtaining a PRL-PitNET cell line that highly expresses DRD2 and is sensitive to dopamine agonists. This provides a valuable tool for subsequent research on PRL-PitNET.

[0021] This embodiment provides a method for constructing a drug-sensitive prolactinoma cell line based on CRISPR / Cas9 technology, wherein the KKBTBD7 gene of MMQ cells is knocked out using the CRISPR / Cas9 system to obtain the PRL-PitNET cell line.

[0022] Furthermore, the CRISPR / Cas9 system includes sgRNA, the primer sequences of which are SEQ ID No. 1 and SEQ ID No. 2; or at least one of the sequences shown in SEQ ID No. 3 and SEQ ID No. 4.

[0023] SEQ ID No. 1 sequence (KBTBD7-sgRN1): Forward primer: CACCGAGTATATGAATACGACACTA SEQ ID No. 2 sequence (KBTBD7-sgRN1): Reverse primer: AAACTAGTGTCGTATTCATATACTC; Or, SEQ ID No. 3 sequence (KBTBD7-sgRN2): Forward primer: CACCGCTTCAAGAGCATGTTCACAG SEQ ID No. 4 sequence (KBTBD7-sgRN2): Reverse primer: AAACCTGTGAACATGCTCTTGAAGC.

[0024] Furthermore, the method for constructing a drug-sensitive prolactinoma cell line based on CRISPR / Cas9 technology includes the following steps: S10: Design sgRNA primer sequences targeting the KBTBD7 gene, such as SEQ ID No. 1 and SEQ ID No. 2; or SEQ ID No. 3 and SEQ ID No. 4; S20. Constructing the targeting plasmid LentiCRISPRv2: Linearize the LentiCRISPRv2 vector with the restriction endonuclease BsmBI, and ligate the sgRNA into the linearized LentiCRISPRv2 vector using the T4 ligase. S30, Transfection of HEK293T cells: Targeting plasmid LentiCRISPRv2 and packaging plasmids psPAX2 and pMD2.G were transfected into HEK293T cells using liposome 3000; S40. Infecting MMQ cells: MMQ cells were infected with transfected HEK293T cells to obtain the PRL-PitNET cell line.

[0025] Furthermore, in step S20, the linearized LentiCRISPRv2 vector system after enzyme digestion is first loaded onto an agarose gel for electrophoresis, then the linearized LentiCRISPRv2 vector is recovered and purified, and then ligated with sgRNA.

[0026] Further, in step S30, the targeting plasmid LentiCRISPRv2 is added to competent cells, incubated on ice, heat-shocked, and then spread onto LB medium to cultivate single-clonal colonies. After the single-clonal colonies are generated, a single colony is picked and inoculated into LB liquid medium containing ampicillin for shaking culture. The plasmid is extracted from the culture broth using the alkaline lysis method. After lysis, neutralization, centrifugation, adsorption washing, and elution purification, high-purity recombinant targeting plasmid LentiCRISPRv2 is obtained, which is then transfected.

[0027] Furthermore, in step S30, the constructed targeting plasmid LentiCRISPRv2 and packaging plasmids psPAX2 and pMD2.G are transfected with liposome 3000 at a ratio of 5 µg: 5 µg: 5 µg.

[0028] Furthermore, in step S40, the endogenous protein levels of the infected MMQ cells were verified by Western blot, and puromycin was added for pressure screening. The MMQ cell line that stably survived in puromycin and highly expressed DRD2 was selected as the PRL-PitNET cell line.

[0029] Another aspect of this embodiment is to provide the application of the PRL-PitNET cell line prepared by the method for constructing a drug-sensitive prolactinoma cell line based on CRISPR / Cas9 technology in the preparation of the PRL-PitNET therapeutic drug.

[0030] Furthermore, the PRL-PitNET therapeutic agent is a dopamine agonist.

[0031] The following describes a method for constructing drug-sensitive prolactinoma cell lines based on CRISPR / Cas9 technology, using more specific experiments.

[0032] A method for constructing drug-sensitive prolactinoma cell lines based on CRISPR / Cas9 technology includes the following steps: The sgRNA primer sequence for the target gene KBTBD7 was designed using CHOPCHOP.

[0033] SEQ ID No. 1 sequence (KBTBD7-sgRN1): Forward primer: CACCGAGTATATGAATACGACACTA SEQ ID No. 2 sequence (KBTBD7-sgRN1): Reverse primer: AAACTAGTGTCGTATTCATATACTC; Or, SEQ ID No. 3 sequence (KBTBD7-sgRN2): Forward primer: CACCGCTTCAAGAGCATGTTCACAG SEQ ID No. 4 sequence (KBTBD7-sgRN2): Reverse primer: AAACCTGTGAACATGCTCTTGAAGC.

[0034] Enzyme digestion of the vector The lentiviral LentiCRISPRv2 vector (Addgene, #52961) was linearized using the restriction endonuclease BsmBI (NEB, R0739S). The digestion system is shown in Table 1. Table 1 Enzyme digestion reaction system

[0035] After mixing the above system, it was subjected to PCR in a PCR instrument at 37°C for 15 min, 65°C for 20 min.

[0036] Agarose gel electrophoresis Weigh 0.3 g of agar powder (ABclonal, RM02852) using an electronic balance, add it to a glass beaker, add 30 ml of 1×TAE electrophoresis buffer and shake well. Heat in a microwave oven for about 2 minutes to dissolve. Remove the beaker, add 3 μl of nucleic acid dye (ABclonal, RM19009) and shake well. Pour the mixture into a gel plate with a comb inserted. Cool at room temperature for 15–20 minutes, then remove the comb. Place the gel in an electrophoresis tank containing 1×TAE electrophoresis buffer. Add 5 μl of PCR product to each gel well, and add 5 μl of DL2000 Marker (YEASEN, 10501ES) or DL5000 Marker (ABclonal, PK30191) to the adjacent wells. Electrophoresis at 120 V for about 15–30 minutes. After removing the gel, observe it under a gel imaging system to confirm the target band or perform subsequent experiments.

[0037] Agarose gel DNA recovery Weigh the agarose gel containing the target fragment.

[0038] Add 100 μl of 1% agarose sol solution BD to every 100 mg of 1% agarose.

[0039] Incubate in a 56°C water bath for 10 minutes, gently inverting and mixing every 2-3 minutes until the gel is completely melted.

[0040] Add 100 μl of buffer AC to DNA adsorption column G1, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid.

[0041] Add the sample mixture to the DNA adsorption column G1, incubate at room temperature for 1 min, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid (the maximum volume of the mixture added each time is 750 μl, and it can be centrifuged multiple times).

[0042] After the filtered mixture is mixed with the residual strongly alkaline buffer AC in the collection tube, the mixture may change from yellow to orange-red or even purple. This is a normal color change of the phenol red pH indicator under alkaline conditions and does not affect the recovery efficiency.

[0043] Place the DNA adsorption column G1 back into the collection tube, add 600 μl of wash buffer W (add anhydrous ethanol as required), centrifuge at 12,000 rpm at room temperature for 30 s, and discard the waste liquid.

[0044] Add 600 μl of washing buffer W, centrifuge at 12,000 rpm at room temperature for 30 s, and discard the waste liquid.

[0045] Return the DNA adsorption column G1 to the collection tube and centrifuge the empty column at 12,000 rpm at room temperature for 2 min to remove residual wash buffer W.

[0046] Place the DNA adsorption column G1 into a new centrifuge tube (self-provided), add 50 μl of elution buffer to the center of the DNA adsorption column G1, and incubate at room temperature for 2 min. Then centrifuge at 12,000 rpm for 1 min. Collect the filtrate, which is the DNA solution.

[0047] T4 DNA linker (1) The linearized LentiCRISPRv2 product was recovered and ligated with phosphorylated and annealed oligonucleotide complexes using T4 DNA ligase (ABclonal, RK2150). The oligo complex system is shown in Table 2, and the ligation reaction system is shown in Table 3.

[0048] Table 2 Oligo Complex Reaction System

[0049] After mixing the above system, the reaction was carried out in a PCR instrument at 37°C for 30 min, 95°C for 5 min. After the reaction was completed, the temperature was allowed to drop to 25°C, and the oligo complex was taken out and diluted 200 times.

[0050] Table 3 Connection Reaction System

[0051] After mixing the above system, it was incubated overnight at 16°C in a PCR instrument.

[0052] Transformation experiment Add the above ligation product to 100 μl of competent cells (Qingke Biotechnology, TSC-C02, the ligation product should not exceed 1 / 10 of the competent cells), gently mix, and incubate on ice for 30 min.

[0053] Heat the centrifuge tubes at 42°C for 90 seconds (do not shake), then immediately place them in an ice-water bath for 2–3 minutes.

[0054] Add 900 µL of LB medium to a centrifuge tube and incubate at 37°C and 150 rpm with shaking for 45 min. This process allows the bacteria to recover and the resistance gene to be expressed.

[0055] Centrifuge at 2,500 g for 5 min, remove 900 µL of supernatant, resuspend the bacterial cells in the remaining culture medium, spread the remaining bacterial cells evenly on the correctly resistant plate using a sterile spreader, and incubate overnight in an inverted incubator at 37°C after the bacterial suspension has been absorbed by the plate.

[0056] Shaking After single-clone colonies have formed, pick a single-clone colony and, based on plasmid resistance, add 5 μl of ampicillin at a concentration of 100 mg / ml to 10 ml of LB liquid medium. Incubate the culture on a shaker at 37°C and 200 rpm for 16 hours.

[0057] plasmid extraction Preparing the adsorption column with column equilibration buffer: Place a new Spin Column 2 into a 2mL Collection Tube, and add 100 μL of column equilibration buffer BL to the column. Centrifuge at 12,000 rpm for 1 min, discard the waste liquid in the collection tube, and return the adsorption column to the collection tube.

[0058] Take 1.5 mL of overnight cultured bacterial solution, centrifuge at 12,000 rpm for 30 s, discard the supernatant as much as possible, and collect the bacterial cells (add more bacterial solution to the same 1.5 mL tube, continue centrifuging at 12,000 rpm for 30 s, until enough bacterial cells are collected).

[0059] Resuspend the bacterial pellet in 250 μl Buffer P1 (RNase A has been added before use), and pipette or vortex until completely suspended.

[0060] Add 250 μl of Buffer P2, gently invert 6-8 times to fully lyse the cells, and incubate at room temperature for 4-5 minutes.

[0061] Add 250 μl of Buffer N3 and immediately gently invert the tube 6–8 times. A white flocculent precipitate will appear when the mixture is thoroughly mixed. Centrifuge at 12,000 rpm for 10 min and carefully transfer the supernatant to a new tube, avoiding aspirating any floating white precipitate (the mixture should be stirred immediately after adding N3 to prevent localized precipitation of SDS).

[0062] Add 0.1 times the volume of Buffer ER (10% of the volume of the supernatant, approximately 75 μl) to the supernatant obtained in the previous step, and mix by inverting and rotating.

[0063] Add 0.1 times the volume of Buffer ER (10% of the supernatant volume, approximately 75 μl) to the supernatant, mix well, and place in an ice bath (or freezer) for 5 minutes until the turbidity becomes clear and transparent (or it remains slightly turbid). You can invert the container once during this process to mix thoroughly.

[0064] After standing at room temperature for 3-5 minutes, the solution quickly becomes cloudy as it returns to room temperature. Invert the container to mix thoroughly.

[0065] Centrifuge at 12,000 rpm for 10 min at room temperature to separate the phases. The upper aqueous phase contains plasmid DNA, and the lower blue oily phase contains endotoxins and other impurities. Transfer the DNA-containing upper aqueous phase to a new tube.

[0066] Add 0.5 times the volume of isopropanol (about 370 μl) to the supernatant, mix thoroughly by inverting, and transfer to the Spin Column 2 adsorption column in multiple portions (no more than 700 μl each time). Centrifuge at 12,000 rpm for 1 min and discard the filtrate.

[0067] Add 500 μl of Buffer PR (with anhydrous ethanol added before use), centrifuge at 12,000 rpm for 30 s, and discard the filtrate.

[0068] Add 600 μl of Buffer WB (with anhydrous ethanol added before use), centrifuge at 12,000 rpm for 30 s, and discard the filtrate. Add another 600 μl of Buffer WB and repeat the washing process once more.

[0069] Return the Spin Column 2 to the empty collection tube and centrifuge at 12,000 rpm for 2 min to remove as much of the wash solution as possible, so as to avoid residual ethanol in the wash solution inhibiting the downstream reaction.

[0070] Remove the Spin Column 2 from the adsorption column and place it in a clean 1.5 ml centrifuge tube. Add 50–100 μl of Buffer EB to the center of the adsorption membrane (to improve elution efficiency, incubate at room temperature for 2 min, then centrifuge at 12,000 rpm for 1 min). If a larger amount of plasmid is needed, the resulting solution can be added back to the adsorption column and centrifuged at 12,000 rpm for 1 min. Verify the obtained plasmid using sequencing.

[0071] Lentiviral packaging and screening of stable variants Prepare HEK293T cell suspension at 1 × 10⁻⁶ 6 Lentiviral cells were seeded at a density of 10 cm⁻¹ in 10 cm culture dishes. When the cell density reached 30%–50%, the constructed targeting plasmid LentiCRISPRv2 was co-transfected with packaging plasmids psPAX2 (Addgene, #12260) and pMD2.G (Addgene, #12259) at a ratio of 5 µg: 5 µg: 5 µg using Liposome 3000 (ThermoFisher, Lipofectamine™ 3000). Forty-eight hours after transfection, the lentiviral supernatant from HEK293T cells was collected and filtered through a 0.45 µm filter for subsequent cell infection. MMQ cells were infected with the lentiviral supernatant for 6 hours, then replaced with fresh culture medium. After 48 hours, endogenous protein levels were verified by Western blot, and puromycin (0.5 μg / ml) was added for pressure selection for one week. Finally, stable target gene knockout / knockdown cell lines were obtained through single-cell selection.

[0072] Screening of knockout monoclonal cell lines (1) After puromycin pressure screening, the cell suspension was serially diluted, the cell concentration was calculated, and the cells were seeded into 96-well plates so that each well contained an average of 0.5-1 cells. Wells containing only a single cell were marked under a microscope. After the single cells were cultured normally for 1 week, they were transferred to 6-well plates for further expansion culture. When the density reached 80-90%, the cells were collected.

[0073] (2) Centrifuge cells at 1000 rpm for 3 min, discard the supernatant, wash cells twice with pre-cooled PBS, and centrifuge to remove excess liquid. Add the prepared protein lysis buffer (lysis buffer: protease inhibitor PMSF = 100:1), mix well on ice, then lyse using an ultrasonic homogenizer, and incubate on ice for 20 min. Centrifuge at 1,2000 g for 20 min and collect the cell protein supernatant. Determine protein concentration using the BCA Protein Quantification Kit (YEASEN, 20202ES). Prepare BSA standard protein solutions of different concentrations according to Table 4 for determining the standard curve. Prepare BCA working solution by mixing Reagent A and Reagent B at a ratio of 50:1. Add 20 μl of standard protein solutions of each concentration and 200 μl of BCA working solution to a 96-well plate; add 1 μl of protein supernatant, 19 μl of deionized water, and 200 μl of BCA working solution to the wells of the protein to be tested. The plate was incubated at 37°C for 30 min, and the absorbance at 562 nm was measured using a microplate reader. A standard curve was plotted based on the standard protein concentration and the corresponding absorbance, and the concentration of the test protein was calculated (the standard protein solution was diluted to 0.5 μg / μl).

[0074] Table 4 Preparation of BSA Standards

[0075] (3) Add 1 / 4 volume of 5 × Loading buffer according to the protein liquid volume, vortex gently to mix, centrifuge briefly, and then denature in a 100℃ water bath for 5 min. The denatured protein sample can be used for subsequent experiments or aliquoted and stored at -80℃.

[0076] (4) Immunoblot experiments were performed using the gel preparation kit from YEASEN. After cleaning the glass plates, gel pads, and gel casting rack, assemble them according to the instructions. Prepare the separating gel and stacking gel according to Tables 5 and 6 in the reagent preparation table. Add 7.5 ml of separating gel to a 1.5 mm glass plate, gently add deionized water to flatten the separating gel, and let it stand at room temperature for 30 minutes to allow it to solidify. After the separating gel solidifies, add 2 ml of stacking gel, immediately insert the comb to avoid air bubbles, and let it stand at room temperature for 30 minutes to allow the stacking gel to solidify. Once the gel has completely solidified, remove the comb to proceed with subsequent operations.

[0077] Table 5. Preparation of 10% separating gel (15 ml)

[0078] Table 6. Preparation of 5% Stacking Gel (6 ml)

[0079] (5) Assemble the electrophoresis apparatus according to the instructions, add electrophoresis buffer, add the prepared protein sample to the gel wells, and add pre-stained protein marker (ABclonal, RM19001) as required for the experiment. Set the constant voltage to 80 V for electrophoresis for 30 min, then switch to a constant voltage of 120 V until the electrophoresis is complete. After electrophoresis, assemble the transfer apparatus in the order of sponge, filter paper, gel, PVDF membrane, filter paper and sponge, add electrotransfer buffer, and transfer under the following conditions: constant current 200 mA, 90 min, ice bath.

[0080] (6) After transfer, place the PVDF membrane (Millipore, IPVH00010) in a 1×TBST solution containing 5% skim milk powder and gently shake on a shaker at room temperature for 1 hour. After blocking, discard the blocking solution, wash three times with 1×TBST solution, add the primary antibody (KBTBD7, Abmart, MG881391; DRD2, Abmart, TD10211S; GAPDH, Proteintech Group, 10494) prepared with antibody dilution buffer, and incubate overnight at 4°C. The next day, remove the primary antibody, wash four times with an appropriate amount of 1×TBST solution for 5 minutes each time. Prepare the secondary antibody (Abmart, M21003) with 1×TBST solution and incubate on a shaker at room temperature for 1 hour. After antibody incubation, remove the secondary antibody, wash four times with an appropriate amount of 1×TBST solution for 5 minutes each time.

[0081] (7) Prepare the luminescent working solution (ABclonal, RM00021P) by mixing solution A and solution B from the ECL luminescence reagent kit at a 1:1 ratio. Turn on the chemical imaging analysis system (GelView 6000Plus). After pre-cooling, place the PVDF membrane in the center of the tray, add an appropriate amount of luminescent working solution, adjust the focus, select the exposure mode according to the experimental requirements, and click the start button to image. Perform protein quantification and calculate the grayscale value of the image using ImageJ software.

[0082] (8) Select drug-sensitive PRL-PitNET cell lines with KBTBD7 knockout and high expression of DRD2, and freeze them.

[0083] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0084] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A method for constructing drug-sensitive prolactinoma cell lines based on CRISPR / Cas9 technology, characterized in that: PRL-PitNET cell line was obtained by knocking out the KKBBD7 gene in MMQ cells using the CRISPR / Cas9 system.

2. The method for constructing drug-sensitive prolactinoma cell lines using CRISPR / Cas9 technology according to claim 1, characterized in that: The CRISPR / Cas9 system includes sgRNA, and the primer sequences of the sgRNA are SEQ ID No. 1 and SEQ ID No. 1; Alternatively, SEQ ID No. 3 and SEQ ID No.

4.

3. The method for constructing drug-sensitive prolactinoma cell lines using CRISPR / Cas9 technology according to claim 2, characterized in that, Includes the following steps: S10: Design sgRNA primer sequences targeting the KBTBD7 gene, such as SEQ ID No. 1 and SEQ ID No. 2; or SEQ ID No. 3 and SEQ ID No. 4; S20. Constructing the targeting plasmid LentiCRISPRv2: Linearize the LentiCRISPRv2 vector with the restriction endonuclease BsmBI, and ligate the sgRNA into the linearized LentiCRISPRv2 vector using the T4 ligase. S30, Transfection of HEK293T cells: Targeting plasmid LentiCRISPRv2 and packaging plasmids psPAX2 and pMD2.G were transfected into HEK293T cells using liposome 3000; S40. Infecting MMQ cells: MMQ cells were infected with transfected HEK293T cells to obtain the PRL-PitNET cell line.

4. The method for constructing a prolactinoma drug-sensitive cell line based on CRISPR / Cas9 technology according to claim 3, characterized in that: In step S20, the linearized LentiCRISPRv2 vector system after enzyme digestion is first loaded onto an agarose gel for electrophoresis, then the linearized LentiCRISPRv2 vector is recovered and purified, and then ligated with sgRNA.

5. The method for constructing a prolactinoma drug-sensitive cell line based on CRISPR / Cas9 technology according to claim 3, characterized in that: In step S30, the targeting plasmid LentiCRISPRv2 is added to competent cells, incubated on ice, and then heat-shocked. The cells are then spread onto LB medium to cultivate single colonies. After single colonies are formed, a single colony is picked and inoculated into LB liquid medium containing ampicillin for shaking culture. The plasmid is extracted from the culture solution using the alkaline lysis method. After lysis, neutralization, centrifugation, adsorption washing, and elution purification, high-purity recombinant targeting plasmid LentiCRISPRv2 is obtained, which is then transfected.

6. The method for constructing a prolactinoma drug-sensitive cell line based on CRISPR / Cas9 technology according to claim 3, characterized in that: In step S30, the constructed targeting plasmid LentiCRISPRv2 and packaging plasmids psPAX2 and pMD2.G were transfected with liposome 3000 at a ratio of 5 µg: 5 µg: 5 µg.

7. The method for constructing a drug-sensitive prolactinoma cell line based on CRISPR / Cas9 technology according to claim 3, characterized in that: In step S40, the endogenous protein levels of infected MMQ cells were verified by Western blot, and puromycin was added for pressure screening. The MMQ cell line that stably survived in puromycin and highly expressed DRD2 was selected as the PRL-PitNET cell line.

8. The use of the PRL-PitNET cell line prepared by the method for constructing a prolactinoma drug-sensitive cell line based on CRISPR / Cas9 technology according to any one of claims 1 to 7 in the preparation of PRL-PitNET therapeutic drugs.

9. The application according to claim 8, characterized in that: The PRL-PitNET treatment drug is a dopamine agonist.

Images