High-sensitivity mycobacterium fluorescent reporter bacteriophage and application thereof

CN122811121APending Publication Date: 2026-09-25SHANGHAI PUBLIC HEALTH CLINICAL CENT
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610742829.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-26
Publication Date
2026-09-25

AI Technical Summary

Technical Problem

2020年,Jain等人将下游荧光报告基团替换为纳米荧光素酶nluc,获得新型应该报告噬菌体TM4-nluc,48小时检测下限达到100菌落形成单位(CFU),与Xpert达到了同等灵敏度[4],并且建立了96孔板快速检测耐药性Mtb流程,可用于批量化检测Mtb耐药性,但并未用于临床分离品系Mtb

Benefits of technology

(1)优化得到了适用于分枝杆菌的纳米荧光素酶报告基因盒Pls3-nluc。该报告基因盒可高效表达纳米荧光素酶,表达能力远高于目前已报道的其它报告基因盒,且可以通过PacI酶切连接至phAE159噬菌体基因组骨架中。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122811121A_ABST
    Figure CN122811121A_ABST
Patent Text Reader

Abstract

The present application relates to a kind of high sensitivity mycobacterium fluorescence reporter phage and its application, the phage ΦLSN contains phagemid phAE159-LSN, the phagemid phAE159-LSN include (1) phAE159 skeleton carrier;(2) nanofluorescent reporter gene cassette Pls3-nluc;The nanofluorescent reporter gene cassette Pls3-nluc include: promoter P left , P smyc Ribosome binding site region (RBS) downstream of promoter, luciferase gene nluc The present application also relates to the application of the phage ΦLSN in detecting mycobacterium and / or mycobacterium drug sensitivity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial detection technology, specifically relating to a highly sensitive fluorescent reporter phage for mycobacteria and its application. Background Technology

[0002] Mycobacterium is a genus of slender, slightly curved microorganisms belonging to the actinomycete family. They are non-flagellated, non-spore-forming, and generally do not produce endotoxins or exotoxins. The diseases they cause are usually chronic and accompanied by granulomas. There are many types of mycobacteria, which can be mainly divided into three categories: the tuberculous mycobacterial complex, non-tuberculous mycobacteria, and Mycobacterium leprae.

[0003] Mycobacterium tuberculosis ( Mycobacterium tuberculosis, Mtb Mycobacterium tuberculosis (TB) is the pathogen that causes tuberculosis. It can invade all organs of the body, but pulmonary tuberculosis is the most common (because it is an aerobic organism). To this day, tuberculosis remains the leading cause of death from a single bacterium. In recent years, the emergence of drug-resistant tuberculosis has made its treatment more challenging. Mycobacterium tuberculosis is an obligate aerobic bacterium, with an optimal growth temperature of 37°C; it does not grow below 30°C. The high lipid content of the cell wall of Mycobacterium tuberculosis affects nutrient absorption, thus slowing its growth. In general culture media, each generation takes 18-24 hours. Therefore Mtb Growth is extremely slow; it typically takes 3-5 weeks of culture for visible colonies to appear on plates. Therefore, conventional methods involve culturing... Mtb Diagnosing tuberculosis using live bacteria is a very slow process, taking approximately 4 to 8 weeks. Mtb Drug susceptibility testing is time-consuming, requiring 4 to 8 weeks to obtain results after the isolated strains are acquired. In recent years, commonly used fully automated mycobacterial culture monitoring systems in clinical laboratories, such as the BD BECTEC MGIT 960 system, have reduced diagnostic and drug susceptibility testing times to 8-12 days respectively. However, these systems are still relatively slow, and the instruments and accompanying test tubes are large, taking up considerable space and being expensive, thus limiting their ability to perform high-throughput studies.

[0004] In recent years, although molecular technology-based methods have performed well in the detection of Mycobacterium tuberculosis, the detection of drug resistance remains difficult due to slow progress in the study of drug resistance mechanisms, discrepancies between drug resistance gene mutations and drug resistance phenotypes, and cost issues.

[0005] Therefore, a rapid, simple, and economical testing method is needed. Mtb The existence and performance of drug sensitivity testing for multiple drugs, and the improvement of the specificity and accuracy of the test results, remain unresolved clinical problems.

[0006] Bacteriophages are viruses that use bacteria as hosts. Their genetic material is wrapped in a protein coat. Most bacteriophages have a "tail" that allows them to inject genetic material into bacteria. They are usually specific. Phagemids are composed of plasmid vectors. Constructed from a phage vector, it contains both the origin of replication of plasmids and the origin of replication of phages. Therefore, in E. coli cells, it can replicate as a normal double-stranded plasmid molecule, generating double-stranded DNA. When the phage particle enters the host bacterium (such as mycobacteria), it can synthesize the DNA and capsid protein of the progeny phage in the host bacterium, and release it by lysing the host cell. However, under certain conditions, the phage particle does not replicate, cannot lyse the host, and remains stably present in the host.

[0007] Fluorescent reporter phage assays detect the presence and drug resistance of live bacteria by constructing phages carrying reporter gene cassettes. In 1993, Jacobs et al. established a method for detecting MDR-TB using fluorescent reporter phages. They constructed a luciferase reporter system into the genome of the temperature-sensitive mycobacterium-specific phage TM4. Using the modified phage to infect antibiotic-treated mycobacteria, after 12 hours of incubation, they could determine whether the phage genome had integrated into the host by detecting the fluorescence signal, thereby determining the presence of drug-resistant mycobacteria. [1] However, due to insufficient fluorescence signal intensity, this method still could not be directly applied to the detection of clinical samples. Until 2012, Jacobs' team discovered that using the Pleft promoter could significantly increase the expression level of fluorescent proteins. Based on this, they constructed a fluorescent reporter phage Φ2GFP10, which, after being co-incubated with clinical samples and antibiotics for 12 hours, allowed them to determine drug resistance by observing the expression of fluorescence signals under a fluorescence microscope. [2] Clinical studies have shown that Φ2GFP10 can identify rifampicin- and streptomycin-resistant strains within 2 days and isoniazid-resistant strains within 3 days, offering advantages such as simplicity, economy, and speed. [3] In 2020, Jain et al. replaced the downstream fluorescent reporter group with nanoluciferase nluc, obtaining a novel reporter phage TM4-nluc, which achieved a detection limit of 100 colony-forming units (CFU) at 48 hours, reaching the same sensitivity as Xpert. [4] Furthermore, a rapid 96-well plate assay for Mtb resistance was established, which can be used for batch detection of Mtb resistance, but it has not been applied to clinical isolates. In 2024, Rajagopalan et al. constructed a new fluorescent reporter phage TM4::GeNL, which further improved the detection limit, but it only showed good results for a few drugs, and it only used clinical isolates, so it could not significantly shorten the detection time for drug resistance in clinical samples. [5]In 2025, the inventors used the PfurAma promoter to express nluc, constructing a fluorescent reporter phage ΦFN. By optimizing the detection process, they significantly improved sample detection efficiency and could accurately detect Mtb resistance to first-line anti-tuberculosis drugs. However, it is only for clinical isolation of strains. [6] .

[0008] In summary, the fluorescent reporter phage assay has great potential in detecting Mycobacterium tuberculosis and its drug resistance. However, the sensitivity of phage detection has been reported to be low so far, and it is only used for clinical isolates after solid culture. The detection time still cannot meet clinical needs.

[0009] Based on this, the present invention is proposed.

[0010] [References] [1]Jacobs WR Jr, Barletta RG, Udani R, et al. Rapid assessment ofdrug susceptibilities of Mycobacterium tuberculosis by means of luciferasereporter phages. Science. 1993 May;260(5109):819-22. [2]Jain P, Hartman TE, Eisenberg N, et al. Φ2GFP10, a high-intensityfluorophage, enables detection and rapid drug susceptibility testing ofMycobacterium tuberculosis directly from sputum samples. J Clin Microbiol. 2012 Apr;50(4):1362-9. [3]Yu X, Gu Y, Jiang G, et al. Evaluation of a high-intensity greenfluorescent protein fluorophage method for drug-resistance diagnosis inTuberculosis for isoniazid, rifampin, and streptomycin. Front Microbiol. 2016Jun;7:922. [4]Jain P, Garing S, Verma D, et al. Nanoluciferase reportermycobacteriophage for sensitive and rapid detection of Mycobacteriumtuberculosis drug susceptibility. J Bacteriol. 2020 Oct;202(22):e00411-20. [5]Rajagopalan S, Rourke AK, Asare E, et al. EngineeredMycobacteriophage TM4::GeNL Rapidly Determines Bedaquiline, Pretomanid,Linezolid, Rifampicin, and Clofazimine Sensitivity in Mycobacteriumtuberculosis Clinical Isolates. J Infect Dis. 2025 Apr 15;231(4):859-870.doi: 10.1093 / infdis / jiae438. [6]Guo M, Wang Y, Ma R, et al. Rapid detection of drug resistance inMycobacterium tuberculosis clinical isolates for first-line antituberculardrugs by using a novel reporter mycobacteriophage. Front Cell InfectMicrobiol. 2025 Apr 10;15:1589236. doi: 10.3389 / fcimb.2025.1589236. [7]Bardarov S, Bardarov S, Pavelka MS, et al. Specializedtransduction: an efficient method for generating marked and unmarked targetedgene disruptions in Mycobacterium tuberculosis, M. bovis BCG and M. smegmatis . Microbiology. 2002 Oct;148(Pt 10):3007-3017. doi: 10.1099 / 00221287-148-10-3007. [8]Guo M, Wang Y, Sun J. Rapid detection of drug resistance in Mycobacterium tuberculosis clinical isolates for first-line antituberculardrugs by using a novel reporter mycobacteriophage. Front Cell InfectMicrobiol. 2025 Apr 10;15:1589236. doi: 10.3389 / fcimb.2025.1589236. Summary of the Invention

[0011] This invention first relates to a fluorescent reporter phage ΦLSN for detecting mycobacteria, wherein the phage ΦLSN contains the phage particle phAE159-LSN, and the phage particle phAE159-LSN contains... (1) phAE159 skeleton carrier; (2) An insert containing the nanoluciferase reporter gene cassette Pls3-nluc; The aforementioned nanoluciferase reporter gene cassette Pls3-nluc contains: promoter P left P smyc Ribosome binding site (RBS) downstream of the promoter, luciferase gene nluc ; And optionally, hygromycin resistance genes. hyg + .

[0012] The bacteriophage ΦLSN exhibits lysogenic growth when infecting host bacteria at 37-42℃, without lysing the host; however, it can lyse the host at 30℃.

[0013] The nanoluciferase reporter system (Pls3-nluc gene cassette expression product) carried by the bacteriophage ΦLSN can be efficiently expressed in mycobacteria; the mycobacteria include, but are not limited to, Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium marineum, Mycobacterium tuberculosis, and BCG and other common clinical pathogens.

[0014] Furthermore, The promoter P left The base sequence is shown in SEQ ID NO: 14. The RBS mentioned is an optimized RBS, and its base sequence is shown in SEQ ID NO: 15. The luciferase gene nluc The base sequence is shown in SEQ ID NO: 2 The aforementioned hyg + The gene sequence is shown in SEQ ID NO: 16 SEQ ID NO:2, ATGGTCTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGACAGCCGGCTACAACCTGGACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTCCGATC CAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGTCATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGAAAAAATTTTTAAGGTGGTGTACCCTGTGGATG ATCATCACTTTAAGGTGATCCTGCACTATGGCACACTGGTAATCGACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGTTCGACGGCAAAAAGATCACTGTAAC AGGGACCCTGTGGAACGGCAACAAAATTATCGACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCCGAGTAACCATCAACGGAGTGACCGGCTGGCGGCTGTGCGAACGCATTCTGGCGAATTAA SEQ ID NO:14, CACCAATTTGCGATTAGGGCTTGACAGCCACCCGGCCAGTAGTGCATTCTTGTGTCACCGCAGCAGCAAGGCGGT SEQ ID NO:15, GAGAGATTCGCCGCCCGAAATGAGCACGATCCGCATGCTTATATAAGGAGGTATCTCC SEQ ID NO:16, Gtgacacaagaatccctgttacttctcgaccgtattgattcggatgattcctacgcgagcctgcggaacgaccaggaattctgggagccgctggcccgccgagccctggaggagctcgggctgccggtgccgccggtgctgcgggtgcccggcgagagcaccaaccccgtactggtcggcgagcccgacccggtcatcaagctgttcggcgagcactggtgcggtccggagagcctcgcgtcggagtcggaggcgtacgcggtcctggcggacgccccggtgccggtgccccgcctcctcggccgcggcgagctgcggcccggcaccggagcctggccgtggccctacctggtgatgagccggatgaccggcaccacctggcggtccgcgatggacggcacgaccgaccggaacgcgctgctcgccctggcccgcgaactcggccgggtgctcggccggctgcacagggtgccgctgaccgggaacaccgtgctcaccccccattccgaggtcttcccggaactgctgcgggaacgccgcgcggcgaccgtcgaggaccaccgcgggtggggctacctctcgccccggctgctggaccgcctggaggactggctgccggacgtggacacgctgctggccggccgcgaaccccggttcgtccacggcgacctgcacgggaccaacatcttcgtggacctggccgcgaccgaggtcaccgggatcgtcgacttcaccgacgtctatgcgggagactcccgctacagcctggtgcaactgcatctcaacgccttccggggcgaccgcgagatcctggccgcgctgctcgacggggcgcagtggaagcggaccgaggacttcgcccgcgaactgctcgccttcaccttcctgcacgacttcgaggtgttcgaggagaccccgctggatctctccggcttcaccgatccggaggaactggcgcagttcctctgggggccgccggacaccgcccccggcgcctga Furthermore, the complete gene sequence containing the insert fragment of the aforementioned nanoluciferase reporter gene cassette Pls3-nluc is shown in SEQ ID NO: 1.

[0015] SEQ ID NO:1, The gene sequence of the nanoluciferase reporter gene cassette Pls3-nluc is shown in SEQ ID NO: 17 (the underlined part is the linker fragment between the promoter and RBS).

[0016] SEQ ID NO: 17: CACCAATTTGCGATTAGGGCTTGACAGCCACCCGGCCAGTAGTGCATTCTTGTGTCACCGCAGCAGCAAGGCGGT AGGCGGATCCGAGAGGATCGTGCCGGTGCCGGTGAA GAGAGATTCGCCGCCCGAAATGAGCACGATCCGCATGCTTATATAAGGAGGTATCTCCATGGTCTTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGACAGCCGGCTACAACCTGGACCAAGTCCTTGAACAGGGAGGTGT GTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTCCGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGTCATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGAAAA AATTTTTAAGGTGGTGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCACTATGGCACACTGGTAATCGACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGTTCGACGGCAA AAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAAATTATCGACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCCGAGTAACCATCAACGGAGTGACCGGCTGGCGGCTGTGCGAACGCATTCTGGCGAATTAA The sequence of the linker fragment between the promoter and RBS is shown in SEQ ID NO: 18. SEQ ID NO: 18: AGGCGGATCCGAGAGGATCGTGCCGGTGCCGGTGAA Furthermore, the present invention also relates to a method for preparing bacteriophage ΦLSN, the method comprising the following steps: (1) Transform the phAE159-LSN phage particle into a mycobacterial host; preferably, the host is Mycobacterium smegmatis, and the transformation is carried out by electroconversion. (2) Cultivate the host and isolate and harvest the phage ΦLSN.

[0017] Furthermore, the electrical switching conditions are: 2.5 kV, 3 ms; The steps of culturing the host and isolating and harvesting the bacteriophage ΦLSN are as follows: (1) Add 7H9 medium to the electroporation solution and revive in an incubator at 37°C for 2 hours; (2) Centrifuge to remove supernatant, resuspend in 7H9 medium, then take bacterial culture and agar, add CaCl2 to a final concentration of 2 mM, mix well, and culture on 7H11 plate at 30℃ for more than 48 h. (3) Pick up the phage plaques into MP buffer, incubate overnight at 4°C, take the supernatant, filter and obtain the phage ΦLSN.

[0018] The MP buffer solution is prepared by adding 50 mL of 1 M Tris-HCl (pH = 7.5), 8.766 g NaCl (final concentration 150 mM), 2.46 g magnesium sulfate heptahydrate (final concentration 10 mM), and 0.222 g anhydrous calcium chloride (final concentration 2 mM) to distilled water and bringing the volume to 1 L.

[0019] Furthermore, the present invention also relates to a method for detecting mycobacteria using the phage ΦLSN, wherein the mycobacteria include, but are not limited to: Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium marineum, Mycobacterium tuberculosis, and BCG. The method includes the following steps: (1) Add the bacteriophage ΦLSN to the culture medium containing the mycobacteria to be tested; preferably, set up a negative control group without mycobacteria and a positive control group that confirms the presence of mycobacteria. (2) Incubate at 36~40℃ for more than 12 hours, preferably more than 18 hours; (3) Add the nano-luciferase substrate Furimazine, and use a chemiluminescence detector to detect the luminescence signal value to determine whether the sample contains mycobacteria.

[0020] Preferably, the detection steps are performed in a 96-well plate, with at least 10,000 pfu of phage added to each well.

[0021] Preferably, the detection is performed on clinical in vitro samples, which include, but are not limited to: clinical isolates after solid culture, and cultures from a fully automated mycobacterial culture monitoring system.

[0022] Furthermore, the present invention also relates to a method for detecting mycobacterial drug susceptibility using the phage ΦLSN, wherein the mycobacteria include, but are not limited to: Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium marineum, Mycobacterium tuberculosis, and BCG. The method includes the following steps: (1) Add the drug whose drug sensitivity activity is to be tested to the culture medium containing mycobacteria or the culture of the fully automated mycobacteria culture monitoring system; set up a positive control group without drug addition and a negative control group without mycobacteria; (2) After culturing at 36~40℃ for more than 48 h, add a certain amount of phage ΦLSN and continue incubation for more than 18 h; (3) Add the substrate Furimazine and detect the luminescence signal value using a chemiluminescence detector; (4) Calculate the remaining luminescence rate (RLR), compare the signal values ​​of the test sample with those of the positive control group and the negative control group, and determine the drug resistance of the test sample.

[0023] Preferably, the detection steps are performed in a 96-well plate, with at least 10,000 pfu of phage added to each well.

[0024] Preferably, the analysis is performed on clinical in vitro samples, which include, but are not limited to: clinical isolates after solid culture and cultures from a fully automated mycobacterial culture monitoring system.

[0025] Furthermore, the present invention also relates to the application of the bacteriophage ΦLSN in tuberculosis detection and tuberculosis drug susceptibility testing, wherein the detection is for clinical in vitro samples, including but not limited to: clinical isolates after solid culture and cultures of a fully automated mycobacterial culture monitoring system.

[0026] Furthermore, the present invention also relates to the application of the aforementioned bacteriophage ΦLSN in the preparation of detection products or kits for detecting Mycobacterium tuberculosis and / or analyzing the drug resistance spectrum of Mycobacterium tuberculosis.

[0027] The beneficial effects of this invention are as follows: (1) A nanoluciferase reporter gene cassette, Pls3-nluc, suitable for mycobacteria was optimized. This reporter gene cassette can express nanoluciferase efficiently, with an expression capacity far exceeding that of other reporter gene cassettes reported to date, and can be ligated into the phAE159 phage genome backbone via PacI restriction enzyme digestion.

[0028] (2) A novel artificially modified mycobacterial phage (ΦLSN) was constructed by integrating the optimized reporter gene cassette Pls3-nluc into a temperature-sensitive mycobacterial phage. ΦLSN exhibits lysogenic growth in infected host bacteria at 37-42℃ without lysing the host; at 30℃, it can lyse the host. ΦLSN can integrate its high-intensity nanoluciferase reporter gene cassette into the genome of its host mycobacteria, enabling efficient expression of the corresponding protein (enzyme). These enzymes can react with artificially added substrates to produce fluorescence. The nanoluciferase reporter system carried by the ΦLSN of this invention integrates into the attb site of mycobacteria through the attp site of the phage without affecting gene expression before and after integration.

[0029] (3) ΦLSN phage can infect a variety of mycobacteria and enable the infected mycobacteria to express nanoluciferase after being cultured at a specific temperature. The mycobacteria include, but are not limited to: Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium marineum, Mycobacterium tuberculosis, and BCG.

[0030] (4) ΦLSN phage is specific to mycobacteria and can be used for rapid detection of mycobacteria.

[0031] (5) ΦLSN phage has strong reporting ability and high sensitivity. For Mycobacterium tuberculosis, it can determine the presence of Mycobacterium tuberculosis within 24 hours. The detection limit is below 100 CFU, and the bacterial load can be assessed by fluorescence signal value.

[0032] (6) The detection process of this invention is simple, requires a small sample volume, and can detect the presence and drug resistance of Mycobacterium tuberculosis in batches. It is applicable to liquid cultures of mycobacteria and positive products of the BACTEC MGIT 960 culture system in clinical laboratories. The drug sensitivity of Mycobacterium tuberculosis in the sample can be determined within 72 hours. The reaction process can be carried out in a 96-well plate, and multiple bacterial diagnoses and drug sensitivity tests can be completed simultaneously.

[0033] (7) The artificial phage provided by this invention is inexpensive and can: I. be used for simple, economical, and rapid diagnosis of live Mtb in samples, and the specificity of the phage may assist in the identification of bacterial species. II. when combined with the BACTEC MGIT 960 culture system of the laboratory, it can perform drug susceptibility testing (DST) simply, economically, and rapidly, which can greatly shorten the operation process and reporting time. Attached Figure Description

[0034] Figure 1 Comparison of expression efficiency between optimized RBS with PacI restriction site removal and original RBS (P in the figure) ls1-3-nluc, corresponding to the smyc1-3 sequence, P ls -nluc corresponds to the smyc sequence.

[0035] Figure 2 Flowchart of plasmid pYUB854-LSN construction.

[0036] Figure 3 Flowchart of the construction process of phAE159-LSN phage particle.

[0037] Figure 4 The principle and flowchart of rapid detection of mycobacteria in samples by bacteriophage ΦLSN.

[0038] Figure 5 Bacteriophage ΦLSN infection with different bacterial loads Mtb The luminescence intensity of the clinical isolate Bj type 24 hours later.

[0039] Figure 6 The luminescence intensity of MGIT 960 culture positivity broth and Roche solid culture isolates was detected by phage ΦLSN.

[0040] Figure 7 Flowchart for phage ΦLSN detection of mycobacterial drug resistance.

[0041] Figure 8 Comparison of the RLR values ​​of 62 clinical isolates of Mtb detected by phage ΦLSN with the detection results of the MGIT 960 drug susceptibility culture system.

[0042] Figure 9 The RLR values ​​of 131 positive products detected by the phage ΦLSN in the MGIT 960 culture system were compared with those detected by the solid drug sensitivity culture system. Detailed Implementation

[0043] This invention constructs a bacteriophage ΦLSN capable of enabling host bacteria to express nanoluciferase. The phage carries a phAE159-LSN containing a gene that enables host bacteria to express nanoluciferase. The phage base sequence that enables host bacteria to express nanoluciferase contains the luminescence-requiring gene nluc, a gene expression regulatory element, and the resistance gene hyg+. The replication initiation sites are oriE and CosA sites, enabling the phage to replicate extensively in Escherichia coli.

[0044] The gene expression regulatory element in the phage is Pleft-smyc3(RBS) (Pls3), which integrates the Pleft promoter and the downstream ribosome binding site region (RBS) of the Psmyc promoter without the PacI restriction site.

[0045] The preparation process of the phage particles is as follows: using the restriction endonuclease PacI to bind the nanoluciferase fragment and phAE159 that enable the host bacteria to express luciferase. [7-8] The backbone is digested with enzymes to form a linear sequence. The digested DNA fragments are then ligated and packaged in vitro as phages to infect E. coli. After in vivo amplification in E. coli, plasmids can be extracted to obtain phage particles.

[0046] The method for preparing the complete gene fragment of the phage particle includes the following steps: 1) Constructing the pYUB854-LSN plasmid: The F1 fragment (synthesized gene expression regulatory element) shown in SEQ ID NO:3 and the F2 fragment (nluc) shown in SEQ ID NO:2 were amplified by PCR. The F1 and F2 fragments were then used to synthesize the F3 fragment via overlap PCR. The F3 fragment was ligated to the pYUB854 template used for PCR amplification using a one-step cloning method to obtain the pYUB854-LSN plasmid.

[0047] 2) Obtaining the base fragment shown in SEQ ID NO:1: The large fragment obtained by digesting pYUB854-LSN plasmid with PacI restriction endonuclease and recovering it is the sequence SEQ ID NO:1.

[0048] SEQ ID NO:3: CACCAATTTGCGATTAGGGCTTGACAGCCACCCGGCCAGTAGTGCATTCTTGTGTCACCGCAGCAGCAAGGCGGTAGGCGGATCCGAGAGGATCGTGCCGGTGCCGGTGAAGAGAGATTCGCCGCCCGAAATGAGCACGATCCGCATGCTTATATAAGGAGGTATCTCC The above-mentioned phage particles were electroporated into Mycobacterium smegmatis, and the phage ΦLSN could be obtained by culturing on a solid plate at 30°C.

[0049] The bacteriophage of the present invention is used for the detection of mycobacteria and their drug resistance.

[0050] The aforementioned mycobacteria include Mycobacterium smearii, Mycobacterium abscessii, Mycobacterium avium, Mycobacterium marineum, Mycobacterium tuberculosis, and BCG.

[0051] The above-mentioned method for detecting host bacteria using bacteriophages includes the following steps: 1) Add a liquid or solid containing a certain amount of bacteriophage to the sample to be tested, and set up a sample without mycobacteria as a negative control group; 2) Incubate at 36~40℃ for more than 18 hours, add nano-luciferase substrate, and detect the luminescence signal value using a chemiluminescence detector; 3) Compared with the negative control group, if the signal value of the test sample is significantly higher than that of the negative control group, it indicates that the sample contains live mycobacteria.

[0052] Preferably, the optimal culture temperature in step 2) above is 37°C and the culture time is 48 hours.

[0053] The above-mentioned method for detecting host bacterial drug resistance using bacteriophages includes the following steps: 1) Add the drug to be tested to the sample, and set up the group without drug as the positive control and the group without mycobacteria as the negative control; 2) After culturing at 36~40℃ for more than 48 hours, add a certain amount of bacteriophage and continue incubation for more than 18 hours; 3) Add the substrate and detect the luminescence signal value using a chemiluminescence detector; 4) Compare the signal values ​​of the test sample with those of the positive and negative control groups to assess the drug resistance of the test sample.

[0054] Preferably, the above-mentioned host bacterial drug resistance detection method is used for clinical strains of Mycobacterium tuberculosis isolated by solid culture and sputum culture products that are positive according to the MGIT 960 culture system.

[0055] The molecular biology experimental techniques used in the following implementation cases, including PCR amplification, plasmid extraction, plasmid transformation, DNA fragment ligation, enzyme digestion, and gel electrophoresis, all employ conventional methods.

[0056] The DNA polymerase-related reagents and one-step cloning kits used in the PCR reactions in the following examples were purchased from Shanghai Yisheng Biotechnology Co., Ltd. Escherichia coli DH5α was purchased from Beijing TransGen Biotech Co., Ltd., and DNA ligase was from Takara Bio Inc.'s T4 DNA ligation kit. Plasmid mini-extraction kit, plasmid intermediate extraction kit, and gel DNA recovery kit were purchased from Beijing Tiangen Biotech Co., Ltd. The restriction endonucleases involved in this invention were all purchased from Takara Bio Inc. The antibiotics isoniazid, rifampin, ethanolamine, and streptomycin were obtained from the BD MGIT 960 kit reagents; Hygromycin was purchased from Roche. The MaxPlaxad phage packaging kit was purchased from Epicentre.

[0057] Example 1: Construction of phAE159-LSN phage particle The phage particle phAE159-LSN was constructed; the construction flowchart is shown below. Figure 2 , 3 phAE159-LSN contains the phAE159 phage backbone; promoter P left ;P smyc Ribosome binding site (RBS) downstream of the promoter; luciferase gene nluc; hygromycin resistance gene hyg + The functions of each component are as follows: P left A strong promoter derived from bacteriophages in mycobacteria that can initiate strong expression of subsequent genes (SEQ ID NO: 14).

[0058] The optimized downstream RBS of the Psmyc promoter exhibits stronger ribosome binding ability, enhancing gene expression. The PacI restriction site preceding the RBS core region has been removed, allowing it to be ligated into the phAE159 vector via enzyme digestion. Figure 1 The optimized sequence is smyc-3 (SEQ ID NO: 15: GAGAGAGATCGCCGCCCGAAATGAGCACGATCCGCATGCTTATATAAGGAGGTATCTCC). nluc : Nanoluciferase, the expression of this gene enables the host bacteria to autonomously synthesize nanoluciferase, which then reacts with the substrate to emit fluorescence.

[0059] Hygromycin resistance gene ( hyg + ): hyg + It is a selection marker used to screen for target strains. Hygromycin resistance gene ( hyg + After expression in mycobacteria and Escherichia coli, hygromycin can confer resistance to hygromycin, enabling the bacteria to grow in media containing hygromycin antibiotics. Hygromycin (abbreviated as Hyg) is a commonly used resistance screening drug; the Hyg concentration for mycobacteria is 150 μg / mL, and the Hyg concentration for Escherichia coli is 200 μg / mL.

[0060] The specific construction method includes the following steps: 1. Construction of plasmid pYUB854-LSN The starting plasmid pYUB854 was derived from our laboratory, and the construction process is as follows: Figure 1 As shown.

[0061] (1) Using primer 1 (SEQ ID NO:4) and primer 2 (SEQ ID NO:5) to synthesize P from the gene ls3The F1 fragment was obtained by amplification using primers 3 (SEQ ID NO:6) and 4 (SEQ ID NO:7) with the gene synthesized... nluc The F2 fragment was amplified using a template, and the F1 and F2 fragments were ligated and amplified into the F3 fragment using overlap PCR with primers 1 and 4. (2) The pYUB854 plasmid was amplified with primer 5 (SEQ ID NO:8) and primer 6 (SEQ ID NO:9) to obtain the F4 fragment. The F4 fragment and the F3 fragment have the same 25 bp homologous sequences at both ends. The two fragments were ligated by one-step cloning to obtain the plasmid pYUB854-LSN. (3) Transform Escherichia coli competent cells DH5α, screen positive clones using hygromycin-resistant LB solid plates, pick single clones and culture them in LB liquid medium, and verify the colonies using 854-yz-F / R (SEQ ID NO:10 and SEQ ID NO:11) primers. After culturing positive clones, extract plasmids and perform sequencing verification.

[0062] SEQ ID NO:4: tggGCTTGCATGCCTGCAGCTAGGGCACCAATTTGCGATTAGGGCT SEQ ID NO:5: CGAAATCTTTCGAGTGTGAAGACCATGGAGATAACCTCCTTATAAG SEQ ID NO:6: ATGGTCTTCACACTCGAAGAT SEQ ID NO:7: tatcctgcaggaaTTCCTCGAGACGTTAATTCGCCAGAATGCGTTC SEQ ID NO:8: CCCTAGCTGCAGGCATGCAAG SEQ ID NO:9: CGTCTCGAGGAAttcctgcagg SEQ ID NO:10: Gtctgacgctcagtcgaacga SEQ ID NO:11: Atttcggacggttgctagcac 2. Construction of phAE159-LSN phage particle: (1) The genome of phAE159 phage particle was digested with PacI restriction endonuclease, and the digestion products were recovered by ethanol precipitation. (2) The pYUB854-LSN plasmid was digested with PacI and the large fragment was recovered; (3) After mixing the two products, add T4 ligase to ligate and package with MaxPlaxad phage packaging kit; (4) The packaged product was transformed into competent Escherichia coli cells, and positive colonies were screened using Hyg-resistant LB solid plates; (5) Select positive colonies for culture and verify them using primers 854-YZ-F / R and TM4-F / R (SEQ ID NO:12 and SEQ ID NO:13). Colonies with bands are cultured and phAE159-LSN is extracted.

[0063] SEQ ID NO:12: TGCGTCAGCTCGGCCAGCACCTT SEQ ID NO:13: TGCGCCTAGATGTATTCAGCGATAACGGT Example 2: Preparation of bacteriophage ΦLSN The 7H11 culture medium used in this embodiment was purchased from BD Company, and the electroporation instrument was purchased from BIO-RAD Company.

[0064] Materials needed: 1) Mycobacterium smegma Msm [7-8] 2) Upper layer agar: 0.7% agar; lower layer agar 7H11 medium.

[0065] 3) MP buffer: Add 50 mL of 1 M Tris-HCl (pH = 7.5), 8.766 g NaCl (final concentration 150 mM), 2.46 g magnesium sulfate heptahydrate (final concentration 10 mM), and 0.222 g anhydrous calcium chloride (final concentration 2 mM) to distilled water and bring the volume to 1 L. Filter to remove bacteria.

[0066] The specific operating method is as follows: Methods for preparing bacteriophages by electroconversion (1) Add 4 μg of phAE159-LSN and 200 μl of phage to the electroporation cuvette. Msm After gently mixing the competent cells by blowing them into the ice for 10 minutes, wipe off the water from the outside of the cup and then electroporate them.

[0067] (2) Electrical transfer (2.5 kV, 3 ms) to Msm middle.

[0068] (3) Add 1 mL of 7H9 medium (BD) to the electroporation solution, transfer it to a 1.5 mL Ep tube, and incubate at 37°C for 2 hours.

[0069] (4) Centrifuge to remove supernatant, resuspend in 150 μL 7H9 medium, then take 100 μL of the resuspended bacterial solution and 10 ml of 0.7% upper agar cooled to 42℃, add CaCl2 to a final concentration of 2 mM, mix well and pour onto 7H11 plate, incubate in a 30℃ incubator for more than 48 h.

[0070] (5) Pick up the phage plaques into 1 ml of MP buffer, incubate overnight at 4°C, take the supernatant, filter it through a 0.45 μm filter and store it at 4°C to obtain phage ΦLSN.

[0071] Example 3: Detection using phage ΦLSN Mtb bacteria The method for detecting mycobacteria in a sample, and the detection principle are as follows: Figure 3 As shown.

[0072] 1) In a 96-well plate, place a mixture containing 10... 6 PFU ΦLSN liquid was added to the sample to be tested, and the sample without mycobacteria was set as the negative control group; 2) Incubate at 37℃ for 24 hours, add nano-luciferase substrate, and detect the luminescence signal value using a chemiluminescence detector; 3) Compared with the negative control group, if the signal value of the test sample is significantly higher than that of the negative control group, it indicates that the sample contains live mycobacteria.

[0073] I. Following the method described above, the phage ΦLSN of the present invention is used to target bacteria containing 10... 2 -10 6 CFU samples of clinical isolates of Mycobacterium tuberculosis type Bj (preserved in our laboratory) were tested, with sterile 7H9 medium used as a control group. The test results are as follows: Figure 4 As shown in the figure, the results are as follows: Liquid containing bacteriophage ΦLSN was added to the test samples and control group, and after incubation at 37°C for 24 h, the substrate was added. The fluorescence value was read using a chemiluminescence detector. When the bacterial CFU was higher than 10, the fluorescence value was determined. 2 At that time, the fluorescence values ​​of the sample group to be tested and the control group showed significant differences, indicating that the detection method is fast and highly sensitive.

[0074] II. Following the method described above, the phage ΦLSN of this invention was used to detect 10 positive samples from the fully automated mycobacterial culture monitoring system (MGIT 960 culture system) and 14 samples of Roche solid culture colony homogenate. The detection results are as follows: Figure 6 As shown.

[0075] In summary, when the sample contains Mtb Content exceeding 10 2 When CFU is detected, it can be rapidly detected within 24 hours and is applicable to fully automated mycobacterial culture monitoring systems (MGIT 960 culture system) and clinical isolates in solid culture.

[0076] Experiment Example 4: Using phage ΦLSN to detect the susceptibility of first-line anti-tuberculosis drugs Mtb Methods: Detect host bacteria (e.g. Mtb Methods for drug sensitivity testing, and the detection principles are as follows: Figure 7 As shown.

[0077] 1) In a 96-well plate, 30 μL of the product reported as positive by the fully automated mycobacterial culture monitoring system (MGIT 960 culture system) was added to wells containing different first-line anti-tuberculosis drugs. The group without drugs was set as a positive control and the group without mycobacteria was set as a negative control. 2) After incubating at 37℃ for 48 h, add 10 6 PFU phage was incubated for another 24 hours; 3) Add the substrate and detect the luminescence signal value using a chemiluminescence detector; 4) Compare the signal values ​​of the test sample with those of the positive and negative control groups, and assess the drug resistance of the test sample by calculating the residual luminescence rate (RLR = (luminescence value of test sample - luminescence value of negative sample) / (luminescence value of positive sample - luminescence value of negative sample)).

[0078] Following the above-described detection method, this invention was used to detect 62 strains. Mtb The sensitivity of clinical isolates and 131 MGIT 960 rapid culture system positive culture media to rifampin (RIF, 1 μg / ml), isoniazid (INH, 0.1 μg / ml), ethambutol (EMB, 1 μg / ml), and streptomycin (SM, 1 μg / ml) was measured. The results are as follows: Figure 8 , 9 As shown in Tables 1 and 2, the colored dots in the figures represent strains that were determined to be resistant to drugs through solid-state drug susceptibility culture, the colored dashed lines represent the threshold lines for determining drug resistance, and the red dashed boxes represent samples that are inconsistent with the results of solid-state drug susceptibility culture.

[0079] Table 1. Antimicrobial susceptibility test results of 62 clinical isolates.

[0080]

[0081] Table 2. Drug susceptibility test results of 131 MGIT 960 system positive culture media.

[0082]

[0083] As can be seen, the detection method of the present invention can rapidly detect host bacteria within 72 hours. Mtb Sensitivity to multiple drugs.

[0084] Finally, it should be noted that the above embodiments are only used to help those skilled in the art understand the essence of the present invention, and are not intended to limit the scope of protection of the present invention.

Claims

1. A fluorescent reporter phage ΦLSN for detecting mycobacteria, characterized in that, The phage ΦLSN contains phage particle phAE159-LSN, and the phage particle phAE159-LSN contains (1) phAE159 skeleton carrier; (2) An insert containing the nanoluciferase reporter gene cassette Pls3-nluc; The aforementioned nanoluciferase reporter gene cassette Pls3-nluc contains: promoter P left P smyc Ribosome binding site (RBS) downstream of the promoter, luciferase gene nluc ; And optionally, hygromycin resistance genes. hyg + ; The fluorescent reporter phage ΦLSN carries a nano-luciferase reporter system that is efficiently expressed in mycobacteria; the mycobacteria include, but are not limited to, common clinical pathogens such as Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium marineum, Mycobacterium tuberculosis, and BCG.

2. The fluorescent reporter phage ΦLSN according to claim 1, characterized in that, The bacteriophage ΦLSN exhibits lysogenic growth in infected host bacteria at 37-42℃ without lysing the host, but lyses the host at 30℃.

3. The fluorescent reporter phage ΦLSN according to claim 1, characterized in that, The promoter P left The base sequence is shown in SEQ ID NO: 14; The RBS mentioned is an optimized RBS, and its base sequence is shown in SEQ ID NO: 15; The luciferase gene nluc The base sequence is shown in SEQ ID NO: 2; The aforementioned hyg + The gene sequence is shown in SEQ ID NO:

16.

4. The fluorescent reporter phage ΦLSN according to any one of claims 1-3, characterized in that, The complete gene sequence of the insert containing the nanoluciferase reporter gene cassette Pls3-nluc is shown in SEQ ID NO: 1; The gene sequence of the nanoluciferase reporter gene cassette Pls3-nluc is shown in SEQ ID NO:

17.

5. A method for preparing the fluorescent reporter phage ΦLSN according to any one of claims 1-4, the method comprising the following steps: (1) Transform the phAE159-LSN phage particle into a mycobacterial host; Preferably, the host is Mycobacterium smegmatis, and the conversion is carried out by electroconversion. (2) Cultivate the host and isolate and harvest the phage ΦLSN.

6. The method according to claim 5, characterized in that, The specified electrical switching conditions are: 2.5 kV, 3 ms; The steps of culturing the host and isolating and harvesting the bacteriophage ΦLSN are as follows: (1) Add 7H9 medium to the electroporation solution and revive in an incubator at 37°C for 2 hours; (2) Centrifuge to remove supernatant, resuspend in 7H9 medium, then take bacterial culture and agar, add CaCl2 to a final concentration of 2 mM, mix well, and culture on 7H11 plate at 30℃ for more than 48 h. (3) Pick up the phage plaques into MP buffer, incubate overnight at 4°C, take the supernatant, filter and obtain the phage ΦLSN.

7. A method for detecting mycobacteria in in vitro biological samples using the fluorescent reporter phage ΦLSN according to any one of claims 1-4; The mycobacteria mentioned include, but are not limited to: Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium marineum, Mycobacterium tuberculosis, and BCG vaccine; The method includes the following steps: (1) Add the bacteriophage ΦLSN to the culture medium containing the mycobacteria to be tested; Preferably, a negative control group with no mycobacteria and a positive control group with samples confirmed to contain mycobacteria are set up respectively; (2) Incubate at 36~40℃ for more than 12 hours, preferably more than 18 hours; (3) Add the nano-luciferase substrate Furimazine, and use a chemiluminescence detector to detect the luminescence signal value to determine whether the sample contains mycobacteria; Preferably, the detection steps are performed in a 96-well plate, with at least 10,000 pfu of phage added to each well.

8. A method for detecting the drug susceptibility activity of mycobacteria in in vitro biological samples using the fluorescent reporter phage ΦLSN according to any one of claims 1-4; The mycobacteria mentioned include, but are not limited to: Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium marineum, Mycobacterium tuberculosis, and BCG vaccine; The method includes the following steps: (1) Add the drug whose drug sensitivity activity is to be tested to the culture medium containing mycobacteria or the culture of the fully automated mycobacteria culture monitoring system; set up a positive control group without drug addition and a negative control group without mycobacteria; (2) After culturing at 36~40℃ for more than 48 h, add a certain amount of phage ΦLSN and continue incubation for more than 18 h; (3) Add the substrate Furimazine and detect the luminescence signal value using a chemiluminescence detector; (4) Calculate the remaining luminescence rate (RLR), compare the signal values ​​of the test sample with those of the positive control group and the negative control group, and determine the drug resistance of the test sample; Preferably, the detection steps are performed in a 96-well plate, with at least 10,000 pfu of phage added to each well.

9. The method according to claim 7 or 8, characterized in that, The in vitro biological samples mentioned include, but are not limited to: clinically isolated strains after solid culture, and cultures from a fully automated mycobacterial culture monitoring system.

10. The use of the fluorescent reporter phage ΦLSN according to any one of claims 1-4 in the preparation of detection products or kits for detecting Mycobacterium tuberculosis and / or analyzing the drug resistance spectrum of Mycobacterium tuberculosis.