M13 bacteriophage based on spytag / spycatcher system and construction method and application thereof

Abstract

The application discloses M13 bacteriophages based on a SpyTag / SpyCatcher system and a construction method and application thereof, and belongs to the technical field of biotechnology, in particular relates to M13 bacteriophages, which are M13-ST helper phages and / or M13-SC helper phages, the genomic nucleotide sequence of the M13-ST helper phage is shown in SEQ ID NO. 8, and the genomic nucleotide sequence of the M13-SC helper phage is shown in SEQ ID NO. 14. The SpyTag or SpyCatcher displayed by the helper phage constructed by the application has high biological activity, can be covalently coupled to target proteins in a high-efficiency and specific manner, and realizes rapid display of functional proteins on the surface of the bacteriophage. The system supports flexible in-vitro co-display strategies, and can be widely applied to the fields of multivalent display, multi-protein co-display, antibody screening, protein interaction research and biosensing, etc.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to M13 bacteriophage based on the SpyTag / SpyCatcher system, its construction method and application. Background Technology

[0002] By fusing the target amino acid sequence with the coat protein, phage display technology can display the target protein or peptide on its outer surface, thereby supporting affinity screening of protein or peptide mutant libraries. Currently, the display system based on filamentous phage M13 is the most commonly used, with the target sequence typically fused to the N-terminus of the coat protein pIII. This system usually consists of two parts: a phagemid and a helper phage. The phagemid is a special plasmid containing the phage replication origin and packaging signal, used to encode the fusion of the target sequence and the coat protein. The helper phage is a modified phage carrying all the genetic information, providing all the genes required for phage replication. Its packaging signal is modified to reduce packaging efficiency; when coexisting with the phagemid, progeny phages will preferentially package the phagemid DNA, thus achieving a physical link between the genotype and the selection phenotype (the displayed target sequence). Phage display technology is a powerful molecular biology tool widely used in antibody screening, peptide library construction, protein-protein interaction research, and other fields. M13 phage is one of the most widely used phages. Its pIII protein is located at the end of the phage, making it an ideal site for displaying foreign proteins. Traditional display methods typically involve gene fusion to express foreign proteins by fusing them with the pIII protein. However, this method has certain limitations, such as the fusion protein potentially affecting the phage's infectivity, misfolding of the foreign protein, or suppression of its activity.

[0003] The SpyTag / SpyCatcher system originates from the fibronectin-binding protein of Streptococcus. SpyTag (a short peptide) spontaneously forms stable heteropeptide bonds with its chaperone protein SpyCatcher under mild conditions, and is widely used in bioconjugation. Using this technology, SpyTag or SpyCatcher can be pre-displayed on the surface of bacteriophages, and then reacted in vitro with target proteins fused with the corresponding chaperone proteins, achieving rapid, efficient, and covalent display of functional proteins.

[0004] A helper phage system based on SpyTag / SpyCatcher has not yet been established. Therefore, developing a helper phage that can stably express functional SpyTag or SpyCatcher and achieve efficient periplasmic spatial coupling or in vitro coupling co-display is of great significance for enhancing the application value of phage display technology. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention proposes an M13 phage based on the SpyTag / SpyCatcher system, its construction method, and its applications. The constructed auxiliary phage-displayed SpyTag or SpyCatcher exhibits high biological activity and can efficiently and specifically couple target proteins via covalent bonds, enabling rapid display of functional proteins on the phage surface.

[0006] To achieve the above objectives, the present invention provides an M13 phage, wherein the M13 phage is an M13-ST helper phage and / or an M13-SC helper phage, the genomic nucleotide sequence of the M13-ST helper phage is shown in SEQ ID NO.8, and the genomic nucleotide sequence of the M13-SC helper phage is shown in SEQ ID NO.14.

[0007] Preferably, the N-terminus of the M13-ST helper phage pIII protein is fused with the SpyTag polypeptide, the amino acid sequence of which is shown in SEQ ID NO.1.

[0008] Preferably, the N-terminus of the M13-SC helper phage pIII protein is fused with SpyCatcher protein, the amino acid sequence of which is shown in SEQ ID NO.9.

[0009] The present invention also provides a method for constructing the M13 phage, comprising the following steps: 1) Provide a gene fragment encoding the SpyTag polypeptide and / or a gene fragment encoding the SpyCatcher protein; 2) Provide M13-NarI plasmid, and use NarI restriction endonuclease and / or BamHI restriction endonuclease to digest the M13-NarI plasmid and the gene fragment encoding SpyTag polypeptide and / or the gene fragment encoding SpyCatcher protein described in step 1), ligate them, and obtain recombinant plasmids M13-ST and / or M13-SC; 3) Transform the recombinant plasmids M13-ST and / or M13-SC obtained in step 2) into competent cells, select positive clones by kanamycin, culture and induce expression, collect and purify to obtain M13-ST helper phage / M13-SC helper phage.

[0010] Preferably, the nucleotide sequence of the gene fragment encoding the SpyTag polypeptide in step 1) is shown in SEQ ID NO.4, and the nucleotide sequence of the gene fragment encoding the SpyCatcher protein is shown in SEQ ID NO.13.

[0011] Preferably, the M13-NarI plasmid in step 2) is obtained by modifying the wild-type M13KO7 genome through the NarI site.

[0012] Preferably, the M13-NarI plasmid in step 2) is obtained by PCR amplification of the wild-type M13KO7 genome using primers with nucleotide sequences as shown in SEQ ID NO.5 and SEQ ID NO.6.

[0013] The present invention also provides the application of the M13 phage in phage display and / or phage co-display, wherein the M13 phage is the M13-ST helper phage and / or the M13-SC helper phage.

[0014] Preferably, the target protein is coupled in vitro with the M13-ST helper phage or the M13-SC helper phage to achieve covalent display of the target protein on the phage surface.

[0015] Preferably, the M13-ST helper phage and / or the M13-SC helper phage are used for multivalent display and / or multiprotein co-display.

[0016] Compared with the prior art, the present invention has the following advantages and technical effects: This invention provides an M13 phage based on the SpyTag / SpyCatcher system, its construction method, and applications. The M13 phage is either the M13-ST helper phage or the M13-SC helper phage, with its pIII protein having a SpyTag polypeptide or a SpyCatcher protein fused to its N-terminus, respectively. This invention also provides a method for constructing the helper phage, including steps such as constructing recombinant plasmids, transformation, induction of expression, and purification. The SpyTag or SpyCatcher displayed by the helper phage constructed in this invention exhibits high biological activity, enabling efficient and specific covalent coupling of target proteins to achieve rapid display of functional proteins on the phage surface. This system supports flexible in vitro co-display strategies and can be widely applied in fields such as multivalent display, multi-protein co-display, antibody screening, protein-protein interaction studies, and biosensing. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1This is a schematic diagram illustrating the phage display based on M13-SC / M13-ST and the corresponding phage co-display principle of the present invention. Figure 2 This is an experimental characterization diagram of helper phages M13-ST and M13-SC obtained from the two helper phages M13-SC / M13-ST of this invention. In the diagram, A represents the identification of SpyTag display and biological function in M13-ST by Western blotting. The bands in the diagram, from left to right, represent: Marker, M13-ST expressed at 30℃ co-incubated with SC-GFP, M13-ST expressed at 30℃ co-incubated with WT-GFP, M13-ST expressed at 37℃ co-incubated with SC-GFP, M13-ST expressed at 37℃ co-incubated with WT-GFP, and helper phage M13-SC. 13-ST, B shows the identification of SpyCatcher display and biological function in M13-SC by immunoblotting. The bands in the figure from left to right are: Marker, M13-SC co-incubated with ST-GFP, M13-SC co-incubated with WT-GFP, wild-type helper phage M13KO7. C shows the fluorescence detection of the specific binding of SC and ST-GFP after co-incubating M13-SC with ST-GFP or GFP. The bands in the figure from left to right are: M13-SC co-incubated with ST-GFP solution, M13-SC co-incubated with GFP solution. Figure 3 To verify the phage display and co-display experiments of the auxiliary phages M13-ST and M13-SC of this invention, A shows the phage display and co-display of M13-ST identified by Western blotting. The bands in the figure, from left to right, represent: Marker, M13-ST displaying SC-GFP, M13-ST-SC-GFP co-displaying exogenous SC-GFP, auxiliary phage M13-ST, and wild-type auxiliary phage M13KO7. B shows the fluorescence detection of SC-GFP display by M13-ST. The bands in the figure, from left to right, represent: M13-ST auxiliary phage lysate... The first image shows the M13-ST solution displaying SC-GFP, and the second image shows the phage display and co-display of M13-SC identified by Western blotting. The bands from left to right in the image represent: Marker, helper phage M13-SC, M13-SC displaying ST-GFP, M13-SC-ST-GFP co-displaying exogenous ST-GFP, and wild-type helper phage M13KO7. The third image shows the fluorescence detection of ST-GFP display in M13-SC, and the fourth image shows the M13-SC solution displaying ST-GFP and the M13-SC helper phage solution. Detailed Implementation

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] Unless otherwise stated, all materials used in this invention are commercially available, and the specification and embodiments of this invention are merely exemplary.

[0021] The present invention relates to phage display based on M13-SC / M13-ST and a schematic diagram of the corresponding phage co-display principle, as shown in the figure below. Figure 1 As shown.

[0022] Example 1 M13-SC / M13-ST helper phages and their construction methods.

[0023] I. Experimental Materials and Methods: 1. Experimental Materials and Sources: Wild-type M13 phage (M13KO7) was purchased from New England Biolabs, catalog number: N0315S; PrimeSTAR Max DNA Polymerase was purchased from Takara, catalog number: R045A; Endotoxin-free plasmid miniprep kit was purchased from Beijing Kangwei Century Biotechnology Co., Ltd., catalog number: CW2106S; Restriction endonucleases NarI (catalog number: R0191V) and BamHI-HF (catalog number: R3136V) were purchased from New England Biolabs; T4 DNA ligase was purchased from New England Biolabs, catalog number: M0202V; Agarose gel DNA recovery kit (enhanced version) (catalog number: DP219-03) and ordinary DNA product purification kit (catalog number: DP204-03) were purchased from Tiangen Biotech (Beijing) Co., Ltd.; Anti-M13 Antibody, Rabbit Polyclonal (catalog number: 68007-T48) was purchased from Sino Biological; HRP-labeled goat anti-rabbit IgG... (H+L) antibody, catalog number HS101-01, was purchased from Beijing TransGen Biotech Co., Ltd.

[0024] 2. Preparation of M13-ST auxiliary phage: (1) Preparation of M13-ST plasmid: The amino acid sequence of SpyTag-TEV site-linker is shown in SEQ ID NO.1, SEQ ID NO.1: MVPTIVMVDAYKRYKENLYFQGGSG. Amplification primers ST-F (nucleotide sequence shown in SEQ ID NO.2) and ST-R (nucleotide sequence shown in SEQ ID NO.3) were designed, SEQ ID NO.2: 5'-CGCTGAAACTGGCGCCATGGTACCGACGATCGTTATGGTG-3'; SEQ ID NO.3: 5'-AACTTTCAACGGCGCCGCCAGAACCTCCCTGGAAATATAGATTTTCTTTGTAACGTTTGTACGCATCCACC-3'.

[0025] Then, using the existing plasmid pet22b-Spytag002 from the laboratory of Xuan Weimin at Tianjin University as a template, PCR was performed using ST-F, ST-R, and PrimeSTAR Max DNA Polymerase according to the procedure in Table 1 to obtain the target sequence, denoted as DNA. ST DNA ST The nucleotide sequence is shown in SEQ ID NO.4, SEQ ID NO.4: CGCTGAAACTGGCGCCATGGTACCGACGATCGTTATGGTGGATGCGTACAAACGTTACAAAGAAAATCTATATTTCCAGGGAGGTTCTGGCGGCGCCGTTGAAAGTT.

[0026] Table 1 PCR Procedure

[0027] (2) In order to insert DNA ST First, the M13-NarI plasmid was constructed using the wild-type M13KO7 genome as a template. Using NarI-F (nucleotide sequence as shown in SEQ ID NO.5) and NarI-R (nucleotide sequence as shown in SEQ ID NO.6) primers, the reaction was carried out according to the PCR procedure in Table 1 to obtain the M13-NarI fragment (SEQ ID NO.7).

[0028] SEQ ID NO. 5: 5'-TGAAACTGGCGCCGTTGAAAGTTGTTTAGCAAAACCCATACAGA-3'.

[0029] SEQ ID NO. 6: 5'-AACTTTCAACGGCCGCCAGTTTCAGCGGAGTGAGAATAGAAAGGA-3'.

[0030] The PCR products were then subjected to gel electrophoresis and recovered using an enhanced agarose gel DNA recovery kit. The DNA products were electroporated into DH10B cells, and 1 mL of SOB medium was added (tryptone and yeast extract were purchased from Oxoid Ltd., sodium chloride from Sangon Biotech Shanghai Co., Ltd., magnesium chloride hexahydrate from Sangon Biotech Shanghai Co., Ltd., and potassium chloride from Tianjin Chemical Reagent Supply and Marketing Co., Ltd.; the formula is as follows: prepare a 250 mL blue cap bottle, weigh 1.25 g of yeast extract, 5 g of tryptone, 0.125 g of sodium chloride, 0.0475 g of potassium chloride, and 0.2375 g of magnesium chloride hexahydrate, dissolve in ultrapure water and bring the volume to 250 mL, place in a 250 mL blue cap bottle, sterilize, and set aside). Incubate at 37℃, 220 rpm. After 1 hour of recovery, 200 µL of the culture medium was spread onto the surface of 50 μg / mL kanamycin-resistant LB solid medium (agar powder was purchased from Sangon Biotech Shanghai Co., Ltd., and the rest were the same as above, with the following formula: prepare a 500 mL blue cap bottle, weigh 2.5 g of yeast extract, 5 g of tryptone, 5 g of sodium chloride, and 7.5 g of agar powder, dissolve them in ultrapure water and make up to 500 mL, place them in a 500 mL blue cap bottle, sterilize, and set aside). The medium was incubated overnight at 37°C to obtain anti-positive clones, and the kanamycin-resistant clones were selected for DNA sequencing.

[0031] (3) DNA was digested using a single enzyme at the NarI site. ST Insert the M13-NarI plasmid to obtain the M13-ST plasmid. The NarI sequence is GG / CGCC. The specific construction process is as follows: Construction of M13-ST plasmid: The successfully sequenced M13-NarI plasmid was cloned, yielding a large number of M13-NarI plasmids. NarI restriction endonucleases were used to bind the M13-NarI plasmid and DNA. ST The gene fragments were digested with enzymes at 37℃ for 8 hours; the fragments were recovered using a standard DNA product purification kit. The two recovered DNA fragments were ligated using T4 DNA ligase at room temperature for 16 hours to obtain the M13-ST plasmid, which was then recovered using a standard DNA product purification kit. 100 ng of the purified M13-ST plasmid was added to 50 μL of DH10B competent cells, mixed, electroporated, and then 1 mL of SOB medium was added. The cells were incubated at 37℃ and 220 rpm for 1 hour. The resulting indwelling plasmid was then spread in 200 µL onto the surface of 50 μg / mL kanamycin-resistant LB agar and cultured overnight at 37℃ to obtain anti-positive clones. Anti-kanamycin clones were selected for DNA sequencing.

[0032] The nucleotide sequence of the M13-ST plasmid is shown in SEQ ID NO.8. It carries kanamycin resistance and is 8756 bp in length.

[0033] (4) M13-ST helper phage expression and purification: 100 ng of purified and recovered M13-ST plasmid was added to 50 μL of TOP10F' competent cells and mixed well. Electroporation was performed, followed by the addition of 1 mL of SOB medium. The cells were incubated at 37°C and 220 rpm for 1 h. Then, 200 µL of the plasmid was spread onto the surface of 50 μg / mL kanamycin-resistant LB solid medium and cultured overnight at 37°C to obtain anti-positive clones. Anti-kanamycin clones were selected and cultured in 2×YT liquid medium containing 50 μg / mL kanamycin (materials as above, formulation: prepare a 500 mL blue-capped bottle, weigh 5 g of yeast extract, 8 g of tryptone, and 4 g of sodium chloride, dissolve in ultrapure water and bring to a final volume of 500 mL, place in a 500 mL blue-capped bottle, sterilize, and set aside). The culture was incubated at 37°C for 12 h, then diluted 50-fold to 2×YT medium containing 50 μg / mL kanamycin and expressed at 30°C for 15 h. Centrifuge at 4000 rpm for 20 min, and collect the supernatant for phage purification. Add 1 / 4 volume of phage precipitant (containing 20% ​​PEG6000 and 2.5M NaCl) to the collected supernatant, incubate in an ice-water bath for 1 h, then centrifuge at 7000 rpm for 45 min, and remove the supernatant. Resuspend in 200 µL PBS (prepared by weighing 8.0 g sodium chloride, 0.2 g potassium chloride, 0.24 g potassium dihydrogen phosphate, and 1.44 g disodium hydrogen phosphate, dissolving in 950 mL ultrapure water, adjusting the pH to 7.4, adding ultrapure water to 1 L, and storing in a 1 L blue-capped bottle), centrifuge at 12000 rpm for 5 min, collect the supernatant, and filter through a 0.45 µm sterile filter membrane; the filtrate is the obtained phage. Add glycerol to the obtained phage to a final concentration of 20%, mix well, and store at -80°C.

[0034] 3. Preparation of M13-SC auxiliary phage: (1) Preparation of M13-SC plasmid: The amino acid sequence of SpyCatcher-TEV site-linker is shown in SEQ ID NO.9, SEQ ID NO.9: MVTTLSGLSGEQGPSGDMTTEEDSATHIKFSKRDEDGRELAGATMELRDSSGKTISTWISDGHVKDFYLYPGKYTFVETAAPDGYEVATAITFTVNEQGQVTVNGEATKGDAHTGSENLYFQGGSGAET. Amplification primers SC-F (nucleotide sequence shown in SEQ ID NO.10), SC-R1 (nucleotide sequence shown in SEQ ID NO.11), and SC-R2 (nucleotide sequence shown in SEQ ID NO.12) were designed.

[0035] SEQ ID NO. 10: 5'-CGCTGAAACTGGCGCCATGGTTACTACTCTGTCCGGTCTGTC-3'.

[0036] SEQ ID NO. 11: 5'-ATAGATTTTCGGAGCCAGTATGAGCATCGCCTTTGGTGG-3'.

[0037] SEQ ID NO. 12: 5'-TTTCAACagtttcagcGCCAGAACCTCCCTGGAAATATAGATTTTC-3'.

[0038] Then, using the existing laboratory plasmid pet22b-Spycatcher002 as a template, PCR was performed using SC-F, SC-R1, SC-R2, and PrimeSTAR Max DNA Polymerase according to the procedure in Table 1 to obtain the target sequence, denoted as DNA. SC (SEQ ID NO.13).

[0039] SEQ ID NO.13: CGCTGAAACTGGCGCCATGGTTACTACTCTGTCCGGTCTGTCTGGTGAACAGGGTCCGTCTGGCGACATGACCACCGAAGAGGATTCTGCAACCCACATTAAATTCAGCAAACGTGATGAAGACGGTCGTGAACTGGCAGGTGCGACTATGGAACTGCGTGACAGCAGCGGCAAAACCATCTCCACTTGGATCTCTGACGGT CACGTGAAGGACTTTTACCTGTACCCGGGCAAGTACACTTTCGTTGAAACCGCAGCACCGGACGGCTACGAAGTTGCAACTGCCATTACCTTCACTGTGAACGAACAGGGTCAGGTTACTGTGAACGGTGAAGCCACCAAAGGCGATGCTCATACTGGCTCCGAAAATCTATATTTCCAGGGAGGTTCTGGCgctgaaactGTTGAAA.

[0040] (2) DNA was digested using NarI and BamHI double enzyme digestion. SC Insert the M13-NarI plasmid to obtain the M13-SC plasmid. The NarI sequence is GG / CGCC, and the BamHI sequence is G / GATCC. The specific construction process is as follows: Construction of M13-SC plasmid: The successfully sequenced M13-NarI plasmid was cloned, yielding a large number of M13-NarI plasmids. NarI and BamHI restriction endonucleases were used to bind the M13-NarI plasmid and DNA. SC The gene fragments were digested with enzymes at 37℃ for 8 h; the fragments were recovered using a standard DNA product purification kit. The two recovered DNA fragments were ligated using T4 DNA ligase at room temperature for 16 h to obtain the M13-SC plasmid, which was then recovered using a standard DNA product purification kit. 100 ng of the purified M13-SC plasmid was added to 50 μL of DH10B competent cells, mixed, electroporated, and then 1 mL of SOB medium was added. The cells were incubated at 37℃, 220 rpm for 1 h, and then plated in 200 µL of 50 μg / mL kanamycin-resistant LB agar and cultured overnight at 37℃ to obtain anti-positive clones. Anti-kanamycin clones were selected for DNA sequencing.

[0041] The nucleotide sequence of plasmid M13-SC is shown in SEQ ID NO.14. It carries kanamycin resistance and is 9062 bp in length.

[0042] (3) M13-SC helper phage expression and purification: 100 ng of purified M13-SC plasmid was added to 50 μL of TOP10F' competent cells and mixed well. Electroporation was performed, followed by the addition of 1 mL of SOB medium. The cells were incubated at 37°C and 220 rpm for 1 h. Then, 200 µL of the mixture was spread onto the surface of 50 μg / mL kanamycin-resistant LB agar and cultured overnight at 37°C to obtain anti-positive clones. Anti-kanamycin clones were selected and cultured in 2×YT liquid medium containing 50 μg / mL kanamycin at 37°C for 12 h. The culture was then diluted 50-fold to 2×YT medium containing 50 μg / mL kanamycin and expressed at 30°C for 15 h. Afterward, the cells were centrifuged at 4000 rpm for 20 min, and the supernatant was collected for phage purification. 1 / 4 volume of phage precipitant was added to the collected supernatant, and the cells were incubated in an ice-water bath for 1 h. The supernatant was then removed by centrifugation at 7000 rpm for 45 min. Resuspend in 200 µL PBS, incubate at 12000 rpm for 5 min, collect the supernatant, and filter through a 0.45 µm sterile filter membrane. The filtrate is the obtained phage. Add the obtained phage to 10 mL of TEV digestion system (150 mM NaCl, 0.1 mM DTT, 25 mM Tris-HCl, pH 8.0), add 6 µL of TEV enzyme, incubate at 30 °C for 6 h, add glycerol to a final concentration of 20%, mix well, and store at -80 °C.

[0043] 4. Experimental verification of the helper phage function, phage display, and co-display of M13-ST and M13-SC: (1) Validation of bacteriophage function: Validation of helper phage function for M13-ST: The total reaction volume was 50 µL. In 10 mM PBS at pH 7.4, 10 μL of [amount missing] was added. 10 CFU-purified M13-ST helper phage and 7 µM SpyCatcher002-GFP or wild-type GFP were incubated at 25 °C for 2 h. An equal volume of phage solution was then added to 5× Loading buffer (purchased from Jiangsu Kangwei Century Biotechnology Co., Ltd.), boiled at 98 °C for 5 min, and simultaneously subjected to SDS-PAGE electrophoresis and Western blotting identification with M13-ST. Figure 2 As shown in Figure A, due to the small molecular weight of SpyTag, ST-pIII cannot be distinguished from wild-type pIII on the gel. Therefore, GFP fused with SpyCatcher (SC-GFP) was used to characterize the display of ST. The GFP-SC-ST-pIII bands demonstrate that the expressed M13-ST exhibits a functional SpyTag.

[0044] Validation of helper phage function for M13-SC: The total reaction volume was 50 µL. In 10 mM PBS at pH 7.4, 10 μL of [amount missing] was added. 10 CFU-purified M13-SC helper phage and 7 µM SpyTag002-GFP or wild-type GFP were incubated at 25 °C for 2 h. An equal volume of phage solution was then added to 5× Loading buffer and boiled at 98 °C for 5 min. The mixture, along with M13-SC and wild-type helper phage M13KO7, was then subjected to SDS-PAGE electrophoresis and Western blotting for identification. Figure 2 As shown in Figure B, the SC-pIII band confirms that the system successfully displayed the SpyCatcher. Incubation with GFP fused with SpyTag (ST-GFP) revealed a clear GFP-SC / ST-pIII coupling band, demonstrating that the expressed M13-SC exhibits a biologically functional SpyCatcher. In the above experiments, wild-type GFP was used as a negative control.

[0045] After adding 1 / 4 volume of phage precipitant to the above reaction solution, incubate in an ice-water bath for 1 hour, remove the supernatant at 12000 rpm for 5 minutes, resuspend in 50 µL PBS, and photograph under blue light using a Tanon-5200 to show GFP luminescence. Figure 2 Fluorescence detection in the medium C medium showed that ST-GFP could be coupled to the surface of the phage, proving that M13-SC successfully displayed a functional SpyCatcher.

[0046] (2) Verification by phage display experiment: Phage display validation for M13-ST: 100 ng of pSEX90-SC-GFP plasmid (Xuan Weimin Laboratory, Tianjin University) was electroporated into TOP10F' competent cells. The cells were then recovered in SOB medium at 37°C and 220 rpm for 1 h. After recovery, the plating was spread onto LB agar plates containing 1% glucose, 100 µg / mL ampicillin, and 25 µg / mL tetracycline hydrochloride, and incubated overnight at 37°C. Single colonies were picked from the plates and cultured in 2×YT liquid medium containing 1% glucose, 100 µg / mL ampicillin, and 25 µg / mL tetracycline hydrochloride at 37°C for 12 h. The culture was then diluted 50-fold to 2×YT medium containing 1% glucose and 100 µg / mL ampicillin and cultured at 37°C and 220 rpm until OD=0.6. Take 2 mL of bacterial suspension and infect it with M13-ST at MOI=10. Incubate at 37℃ and 220 rpm for 1 h, then incubate at 4000 rpm for 10 min. Remove the supernatant, resuspend the bacteria in 1 mL of 2×YT and wash the precipitated bacteria. Repeat centrifugation to remove the supernatant, then resuspend in 1 mL of 2×YT and add to 100 mL of 2×YT medium containing 100 µg / mL ampicillin and 50 µg / mL kanamycin. Incubate at 30℃ for 15 h. Then centrifuge at 4000 rpm for 20 min and collect the supernatant for phage purification. Add 1 / 4 volume of phage precipitant to the collected supernatant, incubate in an ice-water bath for 1 h, then incubate at 7000 rpm for 45 min and remove the supernatant. Resuspend in 200µL PBS, incubate at 12000rpm for 5min, collect the supernatant, and filter through a 0.45µm sterile filter membrane. The filtrate is the obtained phage (M13-ST-SC-GFP).

[0047] Take a quantitative amount of phage solution, add 5× Loading buffer, and boil at 98℃ for 5 min. Perform SDS-PAGE electrophoresis at 180V for 45 min, followed by Western blotting. Identification is performed using Anti-M13 Antibody as the primary antibody and HRP-labeled goat anti-rabbit IgG (H+L) antibody as the secondary antibody. Figure 3 As shown in image A, SC-GFP is displayed on the phage surface via coupling (GFP-SC-ST-pIII). The remaining phage solution was photographed under blue light using a Tanon-5200, demonstrating the GFP luminescence. Figure 3 The fluorescence signal in B indicates that GFP is displayed on the surface of the phage via SpyLigation.

[0048] Phage display validation for M13-SC: 100 ng of pSEX90-ST-GFP plasmid (Xuan Weimin Laboratory, Tianjin University) was electroporated into TOP10F' competent cells. The cells were then recovered in SOB medium at 37°C and 220 rpm for 1 h. After recovery, the plating was spread onto LB agar plates containing 1% glucose, 100 µg / mL ampicillin, and 25 µg / mL tetracycline hydrochloride, and incubated overnight at 37°C. Single colonies were picked from the plates and cultured in 2×YT liquid medium containing 1% glucose, 100 µg / mL ampicillin, and 25 µg / mL tetracycline hydrochloride at 37°C for 12 h. The culture was then diluted 50-fold to 2×YT medium containing 1% glucose and 100 µg / mL ampicillin and cultured at 37°C and 220 rpm until OD=0.6. Take 2 mL of bacterial suspension and infect it with M13-SC at MOI=10. Incubate at 37℃ and 220 rpm for 1 h, then incubate at 4000 rpm for 10 min. Remove the supernatant, resuspend the bacteria in 1 mL of 2×YT and wash the precipitated bacteria. Repeat centrifugation to remove the supernatant, then resuspend in 1 mL of 2×YT and add to 100 mL of 2×YT medium containing 100 µg / mL ampicillin and 50 µg / mL kanamycin. Incubate at 30℃ for 15 h. Then centrifuge at 4000 rpm for 20 min and collect the supernatant for phage purification. Add 1 / 4 volume of phage precipitant to the collected supernatant, incubate in an ice-water bath for 1 h, then incubate at 7000 rpm for 45 min and remove the supernatant. Resuspend in 200µL PBS, incubate at 12000rpm for 5min, collect the supernatant, and filter through a 0.45µm sterile filter membrane. The filtrate is the obtained phage (M13-SC-ST-GFP).

[0049] Take a quantitative amount of phage solution, add 5× Loading buffer, and boil at 98℃ for 5 min. Perform SDS-PAGE electrophoresis at 180V for 45 min, followed by Western blotting. Identification is performed using Anti-M13 Antibody as the primary antibody and HRP-labeled goat anti-rabbit IgG (H+L) antibody as the secondary antibody. Figure 3 As shown in Figure C, ST-GFP is displayed on the phage surface via coupling (GFP-ST-SC-pIII). The remaining phage solution was photographed under blue light using a Tanon-5200, demonstrating the GFP luminescence. Figure 3 The fluorescence signal in D indicates that GFP is displayed on the surface of the phage via SpyLigation.

[0050] (3) Phage co-display (e.g.) Figure 3 (As shown) Experimental verification: Validation of phage co-display for M13-ST: The total reaction volume was 50 µL. In 10 mM PBS at pH 7.4, 10 μL of [amount missing] was added. 10CFU M13-ST-SC-GFP and 7µM MSpyCatcher002-GFP were incubated at 25℃ for 2 hours. An equal volume of phage solution was then added to 5× Loading buffer and boiled at 98℃ for 5 minutes. The mixture was then simultaneously subjected to SDS-PAGE electrophoresis and Western blotting for identification, along with M13-ST-SC-GFP. Figure 3 As shown in Figure A, uncoupled ST-pIII is present on the surface of the phage. Upon further incubation with SC-GFP, the coupled band increases significantly, while the ST-pIII band decreases accordingly. This indicates the presence of empty ST-pIII reacting with added SC-GFP, proving that this display system supports periplasmic spatially coupled / in vitro coupled phage co-display.

[0051] Validation of phage co-display for M13-SC: The total reaction volume was 50 µL. In 10 mM PBS at pH 7.4, 10 μL of [amount missing] was added. 10 CFU M13-SC-ST-GFP and 7µM MSpyTag002-GFP were incubated at 25℃ for 2 hours. An equal volume of phage solution was taken, 5× Loading buffer was added, and the mixture was boiled at 98℃ for 5 minutes. The mixture was then simultaneously subjected to SDS-PAGE electrophoresis and Western blotting for identification, along with M13-SC-ST-GFP. Figure 3 As can be seen in Figure C, there are uncoupled SC-pIII on the surface of the phage; further incubation with ST-GFP shows a significant increase in the coupled band and a decrease in the SC-pIII band, indicating the presence of empty SC-pIII reacting with added ST-GFP, proving that this display system supports periplasmic spatially coupled / in vitro coupled phage co-display.

[0052] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. An M13 bacteriophage, characterized in that, The M13 phage is the M13-ST helper phage and / or the M13-SC helper phage. The genomic nucleotide sequence of the M13-ST helper phage is shown in SEQ ID NO.8, and the genomic nucleotide sequence of the M13-SC helper phage is shown in SEQ ID NO.

14.

2. The M13 phage according to claim 1, characterized in that, The M13-ST helper phage pIII protein is fused to the N-terminus of the SpyTag polypeptide, the amino acid sequence of which is shown in SEQ ID NO.

1.

3. The M13 phage according to claim 1, characterized in that, The M13-SC helper phage pIII protein is fused to the N-terminus of SpyCatcher protein, the amino acid sequence of which is shown in SEQ ID NO.

9.

4. The method for constructing M13 phage according to any one of claims 1 to 3, characterized in that, Includes the following steps: 1) Provide a gene fragment encoding the SpyTag polypeptide and / or a gene fragment encoding the SpyCatcher protein; 2) Provide M13-NarI plasmid, and use NarI restriction endonuclease and / or BamHI restriction endonuclease to digest the M13-NarI plasmid and the gene fragment encoding SpyTag polypeptide and / or the gene fragment encoding SpyCatcher protein described in step 1), ligate them, and obtain recombinant plasmids M13-ST and / or M13-SC; 3) Transform the recombinant plasmids M13-ST and / or M13-SC obtained in step 2) into competent cells, select positive clones by kanamycin, culture and induce expression, collect and purify to obtain M13-ST helper phage / M13-SC helper phage.

5. The construction method according to claim 4, characterized in that, The nucleotide sequence of the gene fragment encoding the SpyTag polypeptide described in step 1) is shown in SEQ ID NO.4, and the nucleotide sequence of the gene fragment encoding the SpyCatcher protein is shown in SEQ ID NO.

13.

6. The construction method according to claim 4, characterized in that, The M13-NarI plasmid described in step 2) was obtained by modifying the wild-type M13KO7 genome through the NarI site.

7. The construction method according to claim 4, characterized in that, The M13-NarI plasmid mentioned in step 2) was obtained by PCR amplification of the wild-type M13KO7 genome using primers with nucleotide sequences as shown in SEQ ID NO.5 and SEQ ID NO.

6.

8. The application of the M13 phage as described in any one of claims 1 to 3 in phage display and / or phage co-display, characterized in that, The M13 phage is the M13-ST helper phage and / or the M13-SC helper phage.

9. The application according to claim 8, characterized in that, The target protein is coupled in vitro with the M13-ST helper phage or the M13-SC helper phage to achieve covalent display of the target protein on the phage surface.

10. The application according to claim 8, characterized in that, Multivalent display and / or multiprotein co-display are performed using the M13-ST helper phage and / or the M13-SC helper phage.

Images