Isolated atp5f1a mutant protein and use thereof

Abstract

The application discloses an isolated ATP5F1A mutant protein and application thereof. The isolated ATP5F1A mutant protein comprises a p.Gly203Ser mutation in a wild-type ATP5F1A protein, and the amino acid sequence of the wild-type ATP5F1A protein is shown in NP_004037.1. The ATP5F1A mutant protein and a coding gene thereof are found and identified for the first time, and functional changes and pathogenic mechanisms thereof are researched.

Description

Technical Field

[0001] This invention belongs to the field of basic medicine, specifically relating to an isolated ATP5F1A mutant protein and its applications. Background Technology

[0002] Mitochondrial adenosine triphosphate (ATP) synthase (complex V) is central to cellular energy metabolism, responsible for producing the vast majority of cellular ATP under aerobic conditions. The ATP synthase dimer also contributes to the assembly of the mitochondrial cristae membrane. This complex molecular machine comprises an embedded Fo domain, a central stalk, and a globular catalytic head (F1). Within this system, ATP5F1A The gene plays a crucial role by encoding the α subunit of the F1 domain. There are three α subunits and three β subunits (the latter consisting of...). ATP5F1B The enzyme (encoded by ions) assembles into a heterohexameric ring, forming the core catalytic domain. Functionally, this synthase relies on a precise mechanochemical coupling mechanism: a proton gradient generated by the electron transport chain drives the rotation of the central stalk, thereby initiating periodic conformational changes within the F1 complex. These conformational changes coordinate the binding of ADP and inorganic phosphate (Pi) to drive efficient ATP synthesis. Therefore, the enzyme... ATP5F1A The structural and functional integrity of the gene-encoded α subunit is crucial for maintaining cellular energy homeostasis, especially in nerve cells. Processes such as maintaining action potentials, regulating neurotransmitter release, supporting long-distance axonal transport, and forming complex synaptic networks all depend on a continuous and abundant supply of ATP from ATP synthase.

[0003] Impaired ATP synthase assembly, stability, or catalytic efficiency ATP5F1A Pathogenic mutations can lead to cellular energy crises, particularly in neurons. Pathogenicity ATP5F1A Variations are rarely reported, but exhibit a variety of clinical features. While initial findings described a fatal autosomal recessive mitochondrial disease, a growing number of autosomal dominant cases are being found associated with severe global developmental delay and intellectual disability. De novo heterozygous missense mutations have become a significant contributing factor. ATP5F1A The main causes of related neurodevelopmental disorders. Summary of the Invention

[0004] To address the limitations of existing technologies in understanding the structure of mitochondrial adenosine triphosphate (ATP) synthase and the insufficient depth and comprehensiveness of research on developmental delays caused by mitochondrial defects, this invention provides an isolated ATP5F1A mutant protein and its applications. This invention is the first to discover and identify this ATP5F1A mutant protein and its encoding gene, and to investigate its functional changes and pathogenic mechanisms. This mutant protein possesses unique characteristics. It provides a more comprehensive analysis of the structure and function of mitochondrial adenosine triphosphate (ATP) synthase and offers potential therapeutic options for developmental delays caused by specific mitochondrial defects.

[0005] To solve the above-mentioned technical problems, the present invention provides a technical solution as follows: an isolated ATP5F1A mutant protein, wherein the ATP5F1A mutant protein contains the p.Gly203Ser mutation in the wild-type ATP5F1A protein.

[0006] In this invention, the amino acid sequence of the wild-type ATP5F1A protein is shown in NP_004037.1.

[0007] The applications of the isolated ATP5F1A mutant protein include, but are not limited to, protein structure research, standards, and drug screening targets.

[0008] To solve the above-mentioned technical problems, another technical solution provided by the present invention is: an isolated nucleic acid, wherein the nucleic acid encodes the isolated ATP5F1A mutant protein as described in the present invention.

[0009] In a preferred embodiment of the present invention, the nucleic acid contains the c.607G>A mutation in the coding sequence of the wild-type ATP5F1A protein.

[0010] In this invention, the coding sequence of the wild-type ATP5F1A protein is shown as NM_004046.6.

[0011] To solve the above-mentioned technical problems, another technical solution provided by the present invention is: a recombinant vector, wherein the recombinant vector contains the isolated nucleic acid as described in the present invention.

[0012] In a preferred embodiment of the present invention, the recombinant vector is a pDONR201 vector or a pFA6a-kanMX6 vector.

[0013] In a preferred embodiment of the present invention, the host cell of the genetically modified cell is HEK293T cell or yeast cell.

[0014] To solve the above-mentioned technical problems, another technical solution provided by the present invention is: a detection reagent, which detects the ATP5F1A mutant protein isolated as described in the present invention and / or the nucleic acid isolated as described in the present invention.

[0015] In this invention, the detection reagents include, for example, gene sequencing reagents, protein sequencing reagents, probes and antibodies specifically targeting the isolated ATP5F1A mutant protein, and primers, probes, and antibodies specifically targeting the isolated nucleic acids. These detection reagents can be obtained using conventional methods in the art.

[0016] To solve the above-mentioned technical problems, another technical solution provided by the present invention is: a reagent kit, the reagent kit comprising the detection reagents as described in the present invention.

[0017] To solve the above-mentioned technical problems, another technical solution provided by the present invention is: the application of one or more of the following in the preparation of drugs for diagnosing ATP5F1A mutation-related diseases: the isolated ATP5F1A mutant protein as described in the present invention, the isolated nucleic acid as described in the present invention, the recombinant vector as described in the present invention, the gene-modified cells as described in the present invention, and the detection reagent as described in the present invention, wherein the ATP5F1A mutation is NP_004037.1 p.Gly203Ser or NM_004046.6c.607G>A.

[0018] In a preferred embodiment of the present invention, the disease is developmental delay.

[0019] The isolated ATP5F1A mutant protein, the isolated nucleic acid, the recombinant vector, and the genetically modified cells can be used as standards, controls, or biomarkers in the kit.

[0020] To solve the above-mentioned technical problems, another technical solution provided by the present invention is: a biomarker, wherein the biomarker is one or more of the following: the ATP5F1A mutant protein isolated as described in the present invention, the nucleic acid isolated as described in the present invention, the recombinant vector as described in the present invention, and the gene-modified cell as described in the present invention.

[0021] To solve the above-mentioned technical problems, another technical solution provided by the present invention is: a gene therapy drug, wherein the gene therapy drug specifically edits the gene with the NP_004037.1 p.Gly203Ser mutation; or, the gene therapy drug specifically silences the transcript of the gene carrying the NP_004037.1 p.Gly203Ser mutation.

[0022] In a preferred embodiment of the present invention, the gene therapy drug further includes a vector carrying a sequence as shown in NM_004046.6.

[0023] To solve the above-mentioned technical problems, another technical solution provided by the present invention is: the application of the gene therapy drug as described in the present invention in the preparation of a drug for treating diseases related to ATP5F1A mutation, wherein the ATP5F1A mutation is NP_004037.1p.Gly203Ser or NM_004046.6c.607G>A.

[0024] In a preferred embodiment of the present invention, the disease is developmental delay.

[0025] To solve the above-mentioned technical problems, another technical solution provided by the present invention is: the use of one or more of the following as targets in screening drugs for treating ATP5F1A mutation-related diseases: the isolated ATP5F1A mutant protein as described in the present invention, the isolated nucleic acid as described in the present invention, the recombinant vector as described in the present invention, and the gene-modified cells as described in the present invention.

[0026] In a preferred embodiment of the present invention, the screening criteria for the drug meet one or more of the following: (1) Whether the ATP5F1A mutant protein has undergone a reverse mutation of NP_004037.1 p.Gly203Ser. If the reverse mutation has occurred, the candidate substance is valid. (2) Whether the isolated nucleic acid has undergone a reverse mutation of NM_004046.6 c.607G>A; if the reverse mutation occurs, the candidate material is valid; and (3) Whether the genetically modified cells have restored ATP synthesis activity. If they have restored ATP synthesis activity, then the candidate substance is effective.

[0027] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0028] The reagents and raw materials used in this invention are all commercially available.

[0029] The positive and progressive effects of this invention are as follows: This invention is the first to discover and identify the ATP5F1A mutant protein (NP_004037.1, p.Gly203Ser) and its encoding gene (NM_004046.6, c.607G>A), and to investigate its functional changes and pathogenic mechanisms. It provides a more comprehensive analysis of the structure and function of mitochondrial adenosine triphosphate (ATP) synthase, revealing for the first time that this mutation exerts a dominant-negative effect by specifically disrupting the hydrophobic core interaction between the α / β subunits. This mutation does not lead to a decrease in the transcriptional level of ATP5F1A protein; rather, it interferes with the stability of wild-type ATP5F1A protein through a dominant-negative effect mechanism. This synergistic damage severely disrupts the stability of the mitochondrial ATP synthase mechanism, elucidating the severe and irreversible neurological damage caused by this mutation, and providing a potential treatment for developmental delays caused by specific mitochondrial defects. Attached Figure Description

[0030] Figure 1 Early analysis of the newly discovered dominant-negative ATP5F1A p.Gly203Ser variant; A: Pedigree of the proband (II1, arrow). Solid symbols indicate affected individuals; B: Sanger sequencing validation of NM_004046.6, c.607G>A; C: Schematic diagram of ATP5F1A exon-intron structure, showing the genomic location of the c.607G>A variant (pink) in exon 5, and currently reported autosomal dominant variants; D: Evolutionary conservation analysis, including the distribution of mutation sites in the ATP5F1A protein domain, and orthologous variant sites at the variant sites in vertebrates and Saccharomyces cerevisiae; E: Protein structure modeling of the F1 domain and magnified comparison of the local interactions between wild-type and variant proteins at amino acid residue 203 and surrounding structures in the F1 complex; purple represents wild-type amino acid residues, yellow represents the variant amino acid residues in the proband, cyan represents other α-subunit amino acid residues, and dashed lines represent hydrogen bonds.

[0031] Figure 2 The following are the results of histopathological examination of muscle biopsy specimens: A: Hematoxylin-eosin (HE) staining; B: Nicotinamide adenine dinucleotide-tetraazole reductase (NADH-TR) staining; C: Modified Gomori trichrome (MGT) staining; D: Cytochrome c oxidase (COX) staining; Scale bar, 50 μm.

[0032] Figure 3 Transmission electron microscopy analysis of the proband's muscle tissue.

[0033] Figure 4This study included quantitative analysis of oxygen consumption rate (OCR) of patient-derived fibroblasts and control fibroblasts, measured using Seahorse, as well as OCR of basal respiration, maximal respiration, and reserve respiration; NS, no statistically significant difference; compared with the control group, P < 0.05。

[0034] Figure 5 The ATP synthase activity of proband and control fibroblasts was measured; compared with the control group, P < 0.01 .

[0035] Figure 6 Immunofluorescence staining of control and patient-derived fibroblasts with ATP5F1A (green), mitochondrial marker HSP60 (red), and nuclear marker DAPI (blue) is shown; compared with the control group, P < 0.05 .

[0036] Figure 7 Western blot analysis of ATP5F1A and ATP5F1B in proband and control fibroblasts. β-actin was used as an internal control.

[0037] Figure 8 To and Figure 7 Corresponding relative protein expression quantification analysis; expression levels of ATP5F1A (A) and ATP5F1B (B) in primary fibroblasts derived from patients and three healthy controls; compared with the control group, P < 0.01.

[0038] Figure 9 The relative expression levels of ATP5F1A mRNA in fibroblasts of the proband and control were shown; NS, no statistical significance.

[0039] Figure 10 Western blot results are presented for HEK293 cells co-transfected with wild-type (WT) ATP5F1A labeled with HA and WT or variant plasmids labeled with FLAG.

[0040] Figure 11 To and Figure 10 Corresponding quantitative Western blot analysis; Expression levels of FLAG-labeled WT or mutant ATP5F1A plasmid (A) co-transfected with HEK293T cells with HA-labeled wild-type (WT) (B): NS, no statistical significance; compared with the WT group, P < 0.05， P < 0.01 .

[0041] Figure 12 For brewing yeast atp1 Human genes ATP5F1A BLAST alignment diagram of genes.

[0042] Figure 13 Functional complementation assays were demonstrated in *Saccharomyces cerevisiae* atp1Δ deletion mutants on non-fermenting YPGly medium; using empty vectors and WT... atp1 The atp1Δ strain was transformed with the mutated allele.

[0043] Figure 14 The results of co-transformation of atp1Δ strain with WT and indicated mutant alleles are presented. Detailed Implementation

[0044] Materials and methods Ethical statements and sample collection The Institutional Ethics Committee of the Second Affiliated Hospital of Zhejiang University School of Medicine reviewed and approved this study protocol (2015-048). Written informed consent was obtained directly from all adult participants and the guardians of all minors, including the proband's family and the control group. This consent specifically covered the release of genome sequencing, proteomics analysis, and clinical and molecular data. All experiments complied with the principles of the Declaration of Helsinki.

[0045] Peripheral blood was collected from the proband and his family members for genetic analysis. Primary fibroblasts were derived from 4 mm skin biopsy tissue obtained from the proband under local anesthesia. Muscle specimens (approximately 0.5 cm × 0.5 cm × 1.0 cm; 100 mg) were collected from the proband under local anesthesia for histopathological and transmission electron microscopy (TEM) analysis. Primary fibroblasts in the control group were derived from foreskin tissue from healthy young men.

[0046] Genome analysis and Sanger sequencing High-throughput whole-genome sequencing (WGS) was performed on the proband, his parents, and his brother. Family WGS was performed at an average depth of approximately 30×, and the resulting reads were aligned to the human reference genome (hg19). Single nucleotide variants (SNVs), insertions / deletions (<20 bp), and copy number variants (CNVs, >30 kb) were retrieved using standard bioinformatics workflows. Variance analysis prioritized genes listed in OMIM, and the clinical significance of identified variants was classified according to the guidelines of the American College of Medical Genetics and Genomics (ACMG). Candidate variants identified by WGS were validated using Sanger sequencing on an ABI 3730xl DNA analyzer. Primer sequences designed for the ATP5F1A variant (NM_004046.6: c.607G>A, p.Gly203Ser) are as follows (5'-3'): forward, CCCATTACCATTTACCATTCCAAGA (SEQ ID NO: 1); reverse, GGAACCTGACAATGTTGGTGTTG (SEQ ID NO: 2). Family cosegregation analysis was performed within the family core to confirm the inheritance pattern of the identified variant.

[0047] 3D molecular modeling To investigate the impact of the missense variants identified in this study, 3D molecular modeling was performed using ChimeraX (version 1.9). The structure of the human ATP synthase 10-subunit complex (PDB ID: 8h9e) was retrieved from a protein database (LaiY, Zhang Y, Zhou S, et al. Structure of the human ATP synthase. Mol Cell.2023;83(12):2137-2147.e4. doi:10.1016 / j.molcel.2023.04.029). Structural alignment, visualization, and mutagenesis were performed within ChimeraX. Single-letter amino acid codes were used to denote residues of interest.

[0048] Primary fibroblast culture Primary fibroblasts were obtained from 4 mm skin biopsy tissues of affected patients and normal controls and cultured at 37°C and 5% CO2 in Dulbecco modified Eagle medium / nutrient mixture F-12 (DMEM / F12, Gibco) supplemented with 10% fetal bovine serum (Gibco).

[0049] Transmission electron microscopy (TEM) Fresh muscle biopsy tissue (approximately 1 mm) 3The samples were fixed in 2.5% glutaraldehyde and 1% OsO4, dehydrated, and embedded. Ultrathin sections (60–80 nm) were double-stained with uranyl acetate and lead citrate and then examined under a transmission electron microscope.

[0050] Histopathological and histochemical examination Serial frozen sections (8–10 μm) were prepared from fresh frozen muscle biopsy specimens for morphological and histochemical analysis. General muscle morphology was assessed using standard hematoxylin-eosin (HE) staining. To assess mitochondrial pathology and respiratory chain function, enzymatic histochemical analysis was performed using nicotinamide adenine dinucleotide-tetraazole reductase (NADH-TR) and cytochrome c oxidase (COX) staining, which highlighted mitochondrial distribution and complex IV activity, respectively. Furthermore, modified Gomori trichrome (MGT) staining was used to identify aberrant mitochondrial accumulations, such as fragmented red fibers.

[0051] Seahorse Mitochondrial Respiration Analysis Mitochondrial respiration was assessed using the Seahorse XFp Cell Mitochondrial Stress Assay Kit (103010-100; Agilent Technologies) according to the manufacturer's instructions. Optimal cell seeding density and FCCP concentration were first determined using an optimization assay with control fibroblasts; subsequently, cells were seeded at a density of 10,000 cells per well 24 hours prior to assay. The final in-well concentrations of the injected compounds were set as follows: 1.5 μM oligomycin, 1.0 μM FCCP, and 0.5 μM each of rotenone and antimycin A. Briefly, oxygen consumption rate (OCR) was measured after sequential injection of oligomycin, FCCP, rotenone, and antimycin A. The obtained OCR values ​​were then normalized to the total protein content per well, which was quantified using a dioctanedinic acid (BCA) assay. All experiments were performed in triplicate.

[0052] Mitochondrial complex V enzyme activity assay Following the manufacturer's instructions, the activity of mitochondrial complex V (FOF1-ATPase / ATP synthase) was measured using the Mitochondrial Complex V (FOF1-ATPase / ATP synthase) Activity Assay Kit (E-BC-K838-M; Elabscience; USA). In short, ADP produced from ATP hydrolysis drives NADH oxidation. The accompanying decrease in absorbance at 340 nm (characteristic of NADH) was used to calculate ATP synthase activity. Enzyme activity was normalized to protein concentration using the BCA assay.

[0053] Immunofluorescence and colocalization analysis Fibroblasts were fixed with 4% paraformaldehyde, permeabilized with 0.2% Triton X-100, and blocked in 5% BSA. Cells were then incubated overnight at 4°C with primary antibodies: anti-ATP5F1A (1:100; ab245580, Abcam) and anti-HSP60 (1:100; ab46798, Abcam). After washing with PBST, cells were incubated for 1 h with secondary antibodies (1:200; Invitrogen) labeled with Alexa Fluor 488 (A21202) and 568 (A11036) respectively. Cell nuclei were counterstained with DAPI (236276; Roche). Images were acquired using an LSM800 confocal microscope (Carl Zeiss), and quantification was performed using ImageJ 1.51j8 (NIH).

[0054] Western blot analysis Total protein from fibroblasts or transfected HEK293 cells was separated by SDS-PAGE and transferred to a PVDF (Millipore) membrane. After blocking with 5% skim milk in TBST for 1 hour, the membrane was incubated overnight at 4°C with primary antibodies: anti-ATP5F1A (1:2000; ab245580, Abcam), anti-ATP5F1B (1:2000; 17247-1-AP, Proteintech), anti-β-actin (1:1000; 66009, Proteintech), anti-FLAG (1:1000; 14793S, CST), and anti-HA (1:1000; 3724S, CST). After washing with TBST, the membrane was incubated for 1 hour with HRP-labeled anti-rabbit (1:3000; 7074, CST) or anti-mouse (1:3000; 7076, CST) secondary antibodies. Protein bands were observed using ECL reagent (WBKLS0500, Millipore) and quantified using ImageJ 1.51j8 (NIH).

[0055] RNA extraction and real-time quantitative PCR (RT-qPCR) Total RNA was extracted from fibroblasts using TRIzol reagent (Invitrogen) and reverse transcribed into cDNA using HiScript II reverse transcriptase (R201-1, Vazyme). RT-qPCR was performed using a Bestar SYBR Green qPCR Mastermix (DBI Bioscience) on an ABI 7500 real-time PCR system (Applied Biosystems). The primers used were: ATP5F1A (Forward: 5'-GTATTGCCCGCGTACATGG-3' (SEQ ID NO: 3), Reverse: 5'-AACTGATTATTGGTGACCGACAG-3' (SEQ ID NO: 4)) and ACTB (Forward: 5'-CACCATTGGCAATGAGCGGTTC-3' (SEQ ID NO: 5), Reverse: 5'-AGGTCTTTGCGGATGTCCACGT-3' (SEQ ID NO: 6)). Using 2 ^-ΔΔCt The method calculates relative mRNA expression and uses ACTB Standardization was performed. All experiments were biologically replicated three times.

[0056] Plasmid construction and mutagenesis Synthetic HA / FLAG-labeled ATP5F1A The sequence was obtained and cloned into the expression vector using Gateway technology (12535-019, Invitrogen) via pDONR201 entry cloning. The generated expression vector was then processed using the QuikChange Multi site-directed mutagenesis kit (200513, Agilent). ATP5F1A Mutants (p.Gly203Ser, p.Arg207His, p.Arg182Gln, and p.Ser346Phe). All constructs were validated by Sanger sequencing.

[0057] Co-transfection assay in HEK293 cells HEK293T cells were cultured in DMEM containing 10% FBS at 37°C and 5% CO2. When the cells in the 6-well plates reached 70–80% confluence, wild-type or mutant cells were separated using Lipofectamine 3000 (L3000015, Invitrogen) according to the manufacturer's instructions. ATP5F1A The plasmid was transiently transfected into the cells. Cells were collected 48 hours after transfection for downstream analysis.

[0058] Construction of atp1Δ deletion mutant yeast strain To construct an atp1Δ deletion strain, a targeted method was used. atp1 A 60 bp homologous arm and a 20 bp plasmid-derived universal sequence were used as primers to amplify the kanMX6 cassette from pFA6a-kanMX6. The PCR product was transformed into yeast using the lithium acetate method. Transformants were screened on YPD medium containing G418, and the correct gene deletion was verified by genomic PCR.

[0059] Construction of recombinant expression vectors Wild-type and site-directed mutant *Saccharomyces cerevisiae* were obtained by high-fidelity PCR. atp1 Fragments. The target fragment and shuttle vectors (pRS315-TEF-CYC1, pRS313-TEF-CYC1) were digested and purified with the corresponding restriction endonucleases and ligated overnight at 4°C. The recombinant plasmid was transformed into E. coli DH5α, and positive clones were verified by colony PCR and Sanger sequencing.

[0060] Yeast functional complementation and dominant-negative effect experiment Transform the recombinant vector, alone or in combination, into yeast mutants. Transformants were screened on SD-LEU or SD-LEU-HIS deficient media. Overnight cultures were adjusted to a uniform cell density, serially diluted 10-fold, and then seeded onto YPD-Gly and selective agar plates. Plates were incubated at 30°C for 3–4 days, and growth phenotypes were recorded.

[0061] Statistical analysis Analysis was performed using GraphPad Prism version 7.0 (GraphPad Software, CA). All data are presented as mean ± standard error (SEM) of at least three independent biological replicates. Comparisons between two groups were performed using a two-tailed unpaired Student's t-test. Statistical significance was set at [value missing]. P < 0.05.

[0062] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0063] Example 1: Discovery and identification of the ATP5F1A mutant p.Gly203Ser The amino acid sequence of the wild-type ATP5F1A protein is shown in NP_004037.1 (SEQ ID NO: 7), and its encoding gene is shown in NM_004046.6 (SEQ ID NO: 8).

[0064] (SEQ ID NO: 7) A novel heterozygous adenogene was identified in a patient exhibiting total developmental delay. ATP5F1A The variant (NM_004046.6, c.607G>A, p.Gly203Ser) was used. Mitochondrial function validation and protein expression analysis were performed using fibroblasts derived from the patient. Furthermore, a yeast model was used to validate that the pathogenic mechanism of this variant is likely driven by a dominant-negative effector.

[0065] The patient was born full-term via cesarean section (birth weight: 4.4 kg) with no obvious structural abnormalities. Initially, feeding was normal, but subsequent developmental delays were observed across the board. At 5 months of age, the patient was still unable to control their head. Although serum lactate was slightly elevated (2.35 mmol / L), brain MRI was normal. Following an initial diagnosis of cerebral palsy and subsequent rehabilitation, this 9-year-old patient currently exhibits severe deficits: inability to control the head, inability to sit independently, finger flexion, slightly low ear position, and impaired chewing function. Neurological evaluation highlighted hypertonia, lack of language ability, dysphagia, and poorly controlled (treatment-resistant) epilepsy.

[0066] Whole-genome sequencing (WGS) was performed on the proband, his parents, and a brother, and it was found that... ATP5F1A A heterozygous missense variant exists: NM_004046.6: c.607G>A, p.Gly203Ser ( Figure 1 A and Figure 1 (B) in the example. Figure 1 A and Figure 1 As shown in B, pedigree analysis and Sanger sequencing confirmed that this was a de novo variant, and it was not found in the proband's brother. The mutation is located in exon 5 ( Figure 1 (C in the original text). Furthermore, the genomic locations of all currently reported autosomal dominant variants are marked in [the original text is missing here]. Figure 1 In the C group. Cross-species conservation analysis showed that the residues affected by these missense variations are highly conserved. Figure 1 (D in the text). Protein structure modeling shows that p.Gly203Ser is located near the interaction interface between the α / β (ATP5F1A / ATP5F1B) subunits. The p.Gly203Ser mutation alters the hydrogen bond network with neighboring residues (…). Figure 1 (E in the original text). Furthermore, considering that glycine is a hydrophobic residue primarily located in a hydrophobic microenvironment, replacing it with polar serine is expected to disrupt the local hydrophobic core. This disruption could affect the correct folding of the protein and the overall stability of the complex.

[0067] To investigate the impact of the p. Gly203Ser mutation on cellular mitochondrial function, skin and muscle biopsies were performed with informed consent from the patient's legal guardian. Histopathological examination of the muscle biopsy specimens showed no significant abnormalities in all routine staining assays, including hematoxylin-eosin (HE), nicotinamide adenine dinucleotide-tetraazole reductase (NADH), cytochrome c oxidase (COX), and modified Gomori trichrome (MGT) staining. Figure 2 Subsequent transmission electron microscopy (TEM) analysis of the muscle tissue revealed significant morphological abnormalities in the mitochondria. Figure 3 Specifically, mitochondria exhibited marked swelling and significant loss of cristae. Although the p.Gly203Ser mutation did not cause visible pathological changes under a light microscope, it disrupted the integrity of mitochondria at the ultrastructural level.

[0068] Example 2: Cell source study of the ATP5F1A mutant p.Gly203Ser To better understand the pathogenic mechanism of this variant, dermal fibroblasts derived from patients and normal controls were cultured. Oxygen consumption rate (OCR) measurements were performed, revealing that the basal and maximal respiratory capacities of proband cells were significantly increased, and their reserve respiratory capacity was also generally increased. Figure 4 The activity of complex V in proband fibroblasts was measured using an ATP synthase activity assay kit. The results showed that complex V activity was decreased in proband cells compared to the control group, confirming that the mutation resulted in severe impairment of ATP synthase catalytic function. Figure 5 These data indicate that ATP5F1A The p.Gly203Ser mutation impairs ATP synthesis efficiency through uncoupled oxidative phosphorylation. In this mode, normal functioning of the upstream respiratory complexes (I-IV) accelerates oxygen uptake; however, the defective complex V fails to maintain the electrochemical gradient, ultimately reducing ATP synthesis.

[0069] To examine the expression and localization of the variant protein in proband cells, immunofluorescence assays were performed, and the fluorescence intensity in the mitochondrial region was quantitatively analyzed. The study found that ATP5F1A protein co-localized with the mitochondrial marker HSP60. Under the same imaging conditions, compared with control cells, the fluorescence intensity of ATP5F1A in the mitochondrial region of proband fibroblasts was significantly reduced (…). Figure 6 This indicates that the level of ATP5F1A protein in the mitochondria of patient cells is low. This result was further confirmed by quantitative Western blot analysis. Figure 7 The statistical results are displayed in Figure 8Meanwhile, real-time quantitative PCR results showed that there was a difference between patients and the control group. ATP5F1A There was no statistically significant difference in mRNA expression. Figure 9 Interestingly, despite the presence of the Gly203Ser variant in ATP5F1A, the protein level of ATP5F1B remained unchanged. Figure 7 It can be assumed that the observed decrease in ATP5F1A protein levels is likely due to impaired protein stability rather than transcriptional changes; that is, the mutation does not lead to a decrease in the transcriptional level of ATP5F1A protein.

[0070] Example 3: In vitro study of the ATP5F1A mutant p.Gly203Ser To further investigate the pathogenic mechanisms of newly discovered missense variants beyond cellular function assays, a series of plasmids were constructed. These included previously reported novel missense variants (p.Arg207His, p.Arg182Gln, and p.Ser346Phe). After co-transfecting HEK293 cells with wild-type (WT) plasmids tagged with HA and WT or mutant plasmids tagged with FLAG, the p.Gly203Ser, p.Arg182Gln, and p.Ser346Phe variants significantly reduced the expression levels of HA-tagged WT proteins. Figure 10 Statistical data can be found Figure 11 Conversely, co-transfection with the p.Arg207His variant did not result in a significant decrease in HA-tagged WT protein levels. Figure 10 These results suggest that these three variants, besides p.Arg207His, may interfere with the stability of the wild-type ATP5F1A protein, possibly through a dominant-negative effect mechanism.

[0071] To further confirm this hypothesis, site-directed mutagenesis and functional complementation experiments were performed on the corresponding residues in *Saccharomyces cerevisiae*. BLAST alignment ( Figure 12 ) identified atp1 Human ATP5F1A Highly conserved orthologous genes in Saccharomyces cerevisiae, the disease-associated human variants p.Arg182Gln, p.Gly203Ser, p.Arg207Gly, and p.Ser346Phe, show strict residue conservation, corresponding to Atp1 p.Arg176Gln, p.Gly197Ser, p.Arg201His, and p.Ser340Phe in Saccharomyces cerevisiae, respectively.

[0072] To assess the functional impact of the mutation, functional complementation assays were performed on the atp1Δ deletion mutant (BY4741 background) on non-fermenting YPGly medium. As expected, atp1Δ strains transformed with the empty vector, serving as a negative control, exhibited severe growth arrest. Although the wild-type was reintroduced... atp1 The growth defect was completely salvaged, but the expression of the mutant alleles (p.Arg176Gln, p.Gly197Ser, or p.Ser340Phe) failed to restore survival ability. Figure 13 ).

[0073] To elucidate the potential dominant-negative effect mechanism, co-expression analysis was performed in the atp1Δ strain. Notably, while yeast strains co-expressing the WT and p.Arg201His variants maintained normal growth, co-expression of WT with the other three missense variants completely eliminated growth recovery. Figure 14 These in vivo findings strongly confirm that these specific variants drive pathogenesis through a dominant-negative-effect mechanism rather than simple loss of function.

[0074] In vitro functional validation was consistent with previous reports, confirming pathogenicity. ATP5F1A The mutation promotes oxidative phosphorylation uncoupling and blocks ATP synthesis. Furthermore, the analysis revealed a striking genotype-phenotype correlation with clinical severity. Patients carrying the novel p.Gly203Ser mutation, similar to those carrying the recently characterized dominant-negative-effect variant, exhibited severe neurodevelopmental phenotypes, including global developmental delay, intellectual disability, and dystonia. Conversely, patients carrying frameshift mutations (primarily dystonia with mild cognitive problems) presented significantly milder clinical manifestations, while those carrying the p.Arg207His allele were transient. It is hypothesized that these distinct clinical trajectories stem from different molecular etiologies. Unlike frameshift mutations causing simple haploinadequacy or transient metabolic blockade of p.Arg207His, the dominant-negative-effect variant actively disrupts the structural integrity and function of the wild-type ATP5F1A protein. This synergistic damage severely disrupts the stability of mitochondrial ATP synthase mechanisms, providing a mechanistic explanation for the severe, irreversible neurological damage observed in carriers of the dominant-negative-effect allele.

[0075] Summarize This study found that a patient with severe global developmental delay carried [a certain trait]. ATP5F1AA novel, newly discovered missense variant of the gene (p.Gly203Ser) was identified. Structural modeling revealed that this substitution disrupts the hydrophobic core near the α / β subunit interface. Functional analysis of fibroblasts derived from the patient revealed severe mitochondrial ultrastructural abnormalities, reduced complex V catalytic activity, and impaired ATP5F1A protein stability without altering mRNA transcription. To elucidate the molecular etiology, co-expression assays were performed in HEK293 cells, and functional complementation was conducted in a yeast atp1Δ model. Crucially, these analyses demonstrated that the p.Gly203Ser variant—similar to other severe alleles but distinct from the p.Arg207His variant—actively suppresses wild-type protein expression and completely blocks phenotypic rescue in yeast. In conclusion, clinical, cellular, and in vivo findings collectively confirm that the p.Gly203Ser variant drives mitochondrial pathogenesis through a dominant-negative effector mechanism, significantly impairing ATP synthase assembly and function.

Claims

1. An isolated ATP5F1A mutant protein, characterized in that, The ATP5F1A mutant protein is a wild-type ATP5F1A protein containing the p.Gly203Ser mutation, and the amino acid sequence of the wild-type ATP5F1A protein is shown in NP_004037.

1.

2. An isolated nucleic acid, characterized in that, The nucleic acid encodes the ATP5F1A mutant protein isolated as described in claim 1.

3. A recombinant vector, characterized in that, The recombinant vector contains the isolated nucleic acid as described in claim 2.

4. A genetically modified cell, characterized in that, The genetically modified cells contain the isolated nucleic acid as described in claim 2 and / or the recombinant vector as described in claim 3.

5. A detection reagent for detecting the ATP5F1A mutant protein isolated as claimed in claim 1 and / or the nucleic acid isolated as claimed in claim 2.

6. A reagent kit, characterized in that, The kit contains the detection reagent as described in claim 5.

7. The use of one or more of the following in the preparation of a drug for diagnosing ATP5F1A mutation-related diseases: the isolated ATP5F1A mutant protein as described in claim 1, the isolated nucleic acid as described in claim 2, the recombinant vector as described in claim 3, the gene-modified cell as described in claim 4, and the detection reagent as described in claim 5, wherein the ATP5F1A mutation is NP_004037.1 p.Gly203Ser or NM_004046.6 c.607G>A.

8. A biomarker, characterized in that, The biomarker is one or more of the following: the ATP5F1A mutant protein isolated as described in claim 1, the nucleic acid isolated as described in claim 2, the recombinant vector as described in claim 3, and the gene-modified cell as described in claim 4.

Images