Use of soybean GmUbox protein or its coding gene in plant resistance to anthracnose

Abstract

The application discloses application of a soybean GmUbox protein or a coding gene thereof in plant resistance to anthracnose, wherein the amino acid sequence of the GmUbox protein is shown as SEQ ID NO. 2, and the nucleotide sequence of the GmUbox gene is shown as SEQ ID NO. 1. The GmUbox gene is introduced into Nicotiana benthamiana leaves or soybean plants to be overexpressed by a method of agrobacterium-mediated transient transformation or stable overexpression, and the overexpression of the GmUbox gene significantly improves the resistance of the plants to anthracnose fungus of soybean.

Description

Technical Field

[0001] This invention belongs to the field of agricultural science and technology, specifically relating to the application of soybean GmUbox protein or its encoding gene in plant anthracnose resistance. Background Technology

[0002] Soybean anthracnose is distributed in major soybean-producing areas worldwide. Its incidence and prevalence are positively correlated with rainfall and temperature; severely affected fields can suffer yield losses of up to 50%, or even total crop failure (Wang et al., 2006). Between 1996 and 2016, this disease caused cumulative economic losses exceeding US$1.9 billion in soybean production in the United States (Wrather et al., 2009; Bandara et al., 2021). Anthracnose has occurred in soybean-producing areas across Northeast, Northwest, South, East, and North my country. In 2025, an outbreak of anthracnose occurred in Hunan and Hubei provinces, causing complete crop failure in some fields. In recent years, scholars both domestically and internationally have conducted extensive evaluations and screenings of anthracnose-resistant soybean germplasm resources, but no soybean varieties completely immune to anthracnose have yet been discovered, and no soybean resistance genes have been cloned.

[0003] E3 ubiquitin ligases have two conformations: a single-subunit conformation (with only one subunit) and a multi-subunit conformation (containing multiple subunits). Single-subunit E3 ligases include RING, U-box, HECT, and RBR types. Plant U-Box (PUB) E3 ligases are the smallest family in the E3 ligase superfamily and play a crucial role in plant growth, development, and responses to various environmental stresses. Silencing the rice U-box protein PUB44 gene weakened PAMP-induced immune responses (such as peptidoglycan and chitin) and increased susceptibility to bacterial blight, indicating that PUB44 positively regulates rice resistance to bacterial blight (Ishikawa et al., 2014). GhPUB17 is a negative regulator of cotton (Gossypium hirsutum L.) resistance to Verticillium dahliae; knocking out the GhPUB17 gene improved cotton resistance to Verticillium dahliae. Further research showed that GhPUB17 interacts with GhCyP3, and GhCyP3 mainly weakens cotton plant resistance to Verticillium wilt by inhibiting the ligase activity of GhPUB17. In Glycine max, 125 U-Box (PUB) genes were identified, among which nine PUB proteins, GmPUB1-GmPUB9, are involved in the response to water deficiency. The disease resistance function of GmUbox proteins in soybean remains unclear. Summary of the Invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide the application of GmUbox protein in plant anthrax resistance.

[0005] Another technical problem to be solved by the present invention is to provide the application of the GmUbox gene encoding the protein in plant anthracnose resistance.

[0006] Another technical problem to be solved by the present invention is to provide the application of expression cassettes, recombinant vectors, recombinant cells or recombinant bacteria in plant anthracnose resistance.

[0007] The final technical problem to be solved by this invention is to provide a method for obtaining anthrax-resistant plants.

[0008] Technical solution: In order to solve the above-mentioned technical problems, the present invention provides the application of soybean GmUbox protein with an amino acid sequence as shown in SEQ ID NO.2 in improving plant resistance to anthracnose.

[0009] The present invention also provides the application of the GmUbox gene encoding the soybean GmUbox protein in plant anthracnose resistance, the nucleotide sequence of the GmUbox gene being shown in SEQ ID NO.1.

[0010] The present invention also provides the application of expression cassettes, recombinant vectors, recombinant cells, recombinant bacteria or transgenic plants in plant anthrax resistance, wherein the expression cassettes, recombinant vectors, recombinant cells, recombinant bacteria or transgenic plants contain the GmUbox gene, and the nucleotide sequence of the GmUbox gene is shown in SEQ ID NO.1.

[0011] The recombinant vector is a plant expression vector.

[0012] The recombinant vector is obtained by introducing the GmUbox gene into the pEarleyGate104 vector or pBA-Flag-Myc4.

[0013] The recombinant bacteria are obtained by introducing the recombinant vector into a host bacterium, preferably Agrobacterium or Escherichia coli.

[0014] The plants mentioned include, but are not limited to, soybeans or tobacco.

[0015] The present invention also provides a method for obtaining anthrax-resistant plants, the method comprising: upregulating the expression or activity of GmUbox protein, wherein the amino acid sequence of GmUbox protein is shown in SEQ ID NO.2.

[0016] The method for upregulating the expression or activity of the GmUbox protein is to overexpress the GmUbox gene in the genome of a plant, and the nucleotide sequence of the GmUbox gene is shown in SEQ ID NO.1.

[0017] The plants mentioned include, but are not limited to, soybeans or tobacco.

[0018] The present invention also includes a method for identifying whether the plant obtained by the method has anthrax resistance, by identifying whether the plant contains GmUbox protein or GmUbox gene, wherein the amino acid sequence of the GmUbox protein is shown in SEQ ID NO.2 and the nucleotide sequence of the GmUbox gene is shown in SEQ ID NO.1. Preferably, the identification method is by qPCR detection.

[0019] Beneficial Effects: Compared with existing technologies, the outstanding effect of this invention is that it is the first to discover that soybean GmUbox and its encoding gene possess plant anthracnose resistance. This invention utilizes Agrobacterium-mediated transient transformation or stable overexpression to overexpress the GmUbox gene in Nicotiana benthamiana or soybean, significantly improving the resistance of Nicotiana benthamiana or soybean to soybean anthracnose. Attached Figure Description

[0020] Figure 1 Figure 1 shows the results of quantitative detection of anthracnose colonization biomass 72 h after Agrobacterium-mediated transient transformation GmUbox-YFP and anthracnose co-infection of Tobacco Bengal leaves.

[0021] Figure 2 This is a comparative image showing the lesion appearance of *Nicotiana benthamiana* leaves co-infected with Agrobacterium-mediated transient transformation GmUbox-YFP and *Anthracis*. The left side of the same leaf represents the YFP control, and the right side represents the transiently expressed GmUbox-YFP. Spore suspensions were inoculated after 2 days, and lesions were observed at 8 dpi. The left and right images are comparative photographs of the same leaf under natural light and ultraviolet light, respectively.

[0022] Figure 3 This is a comparison of trypan blue tissue staining results. The left side shows the YFP control, and the right side shows lesions transiently expressing GmUbox-YFP, inoculated with spore suspension 2 days later, and stained at 8 dpi.

[0023] Figure 4 The result of overexpressing GmUbox to induce resistance in soybeans to soybean anthracnose. Figure 4 In the figure, A represents the phenotype of WT and GmUbox overexpressing plants 8 days after anthracnose inoculation. B represents the expression level of GmUbox in WT and GmUbox overexpressing plants. Detailed Implementation

[0024] The embodiments of the present invention will be described in detail below with reference to the examples. The following examples are only for illustrating the present invention. Unless otherwise specified, specific conditions in the examples are performed under conventional conditions or conditions recommended by the manufacturer. Reagents or instruments used, unless otherwise specified, are all commercially available conventional products.

[0025] Example 1: Transient overexpression of GmUbox in Nicotiana benthamiana induces virus resistance in plants.

[0026] 1. Vector construction and strain acquisition

[0027] RNA was extracted from 'You 6019' (a soybean variety donated by the Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences), and cDNA was obtained by reverse transcription. Using the cDNA as a template, the GmUbox gene fragment was amplified by primer PCR. The PCR reaction volume was 50 μL, including 25 μL PCR Mix, 0.5 μL cDNA template, 2 μL each of forward and reverse primers, and water to make up to 50 μL. The reaction conditions were: 98℃ for 10 s; 58℃ for 5 s; 72℃ for 5 s / kb, for 35 cycles. The forward and reverse primer pairs were: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGGAACGGAAGGCTACACT-3 and 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCCGCCACCACTTCTGATGTAC-3. The amplified fragment was constructed using the Gateway vector construction method (using Invitrogen™ Gateway™ cloning technology). GmUbox was ligated to the YFP fluorescently tagged vector pEarleyGate104 (purchased from TAIR, website: https: / / www.arabidopsis.org / results?mainType=general&searchText=pEarleyGate104&category=vector, catalog number CD3-686) to obtain the GmUbox-YFP overexpression vector. The nucleotide sequence of the GmUbox gene in this embodiment is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.

[0028] 1 μg of the above GmUbox-YFP overexpression vector was mixed with 50 μL of Agrobacterium competent cells (GV3101 strain), and the mixture was incubated on ice, in liquid nitrogen, in a 37°C water bath, and on ice for 5 min in sequence. Immediately afterward, antibiotic-free LB liquid medium was added, and the mixture was allowed to recover at 28°C for 2 hours. The culture was then spread onto Kan + Rif resistant medium and grown for 48 hours. Agrobacterium strains containing the GmUbox-YFP overexpression vector were screened. Similarly, 1 μg of the vector pEarleyGate104 was mixed with 50 μL of Agrobacterium competent cells (GV3101 strain) to obtain Agrobacterium strains containing the empty YFP vector.

[0029] 2. Preparation of soybean anthracnose spore suspension

[0030] Using sterile toothpicks, mycelial blocks of the anthracnose bacterium isolate XZ-1 (strain source: Identification of the pathogen of soybean anthracnose and evaluation of disease resistance in soybean germplasm resources. Li Yiyang, Wu Mian, Wang Xing, Gu Heping, Chen Xin, Cui Xiaoyan. (2024). Acta Phytopathologica Sinica, 54(06), 1167-1178. https: / / doi.org / 10.13926 / j.cnki.apps.001636.) were picked onto potato dextrose agar (PDA) medium and incubated in the dark at 25℃ for 10-15 days. Spore production was examined under a microscope, and those producing the most spores were selected for subsequent experiments. 5 mL of sterile ddH2O was added to each dish. The mycelial layer was scraped off using a spreader, and conidia were continuously detached from the sporangia using a pipette. Under a microscope, the spore concentration was adjusted to 8 × 10⁻⁶ using sterile water. 5 Approximately [number] cells / mL.

[0031] 3. Transient expression of GmUbox enhances plant resistance to soybean anthracnose.

[0032] To investigate the role of GmUbox in anthracnose infection, GmUbox-YFP was transiently expressed in *Tobacco Benedictineum* leaves and co-infected with *Bacillus anthracis*. Specifically, *Agrobacterium* containing the GmUbox-YFP overexpression vector and *Agrobacterium* with the empty YFP vector obtained in step 1 were cultured overnight at 28℃ and 200 rpm. The OD600 of each *Agrobacterium* strain was adjusted to 0.6. These were then injected into 3-4 week old *Tobacco Benedictineum* leaves until a 2 cm diameter water spot was formed. After 2 days of expression, 10 μL of the *Bacillus anthracis* spore suspension obtained in step 2 was inoculated onto the *Tobacco Benedictineum* leaves. DNA was extracted from inoculated leaves 72 hours after inoculation with spore suspension. Anthracnose DNA was detected in the inoculated leaves by qPCR. The internal control primers for Nicotiana benthamiana were: NbActin-F: GGGATGTGAAGGAGAAGTTGGC and NbActin-R: ATCAGCAATGCCCGGGAACA; the anthrax detection primers were: TUB-F: CCACTTCCCTTTGGTCGCTTAC and TUB-R: CATGGTCATCTCCTGGACAGAGT.

[0033] The specific steps for qPCR detection are as follows: Add 10 μL of 2×ChamQ Universal SYBR qPCRMaster Mix, 0.4 μL each of F-terminal and R-terminal primers, and 2.0 μL of template DNA to a 96-well plate, and bring the total volume to 20 μL with ddH2O. The qPCR reaction program is: 95℃, 30 s; 95℃, 10 sec, 60℃, 20 sec, 40 cycles; 95℃, 15 sec; 60℃, 60 sec; 95℃, 15 sec. Each sample is tested in triplicate, using 2... -ΔΔCT The relative expression levels of genes were analyzed.

[0034] The results showed that, compared with the control YFP, transient expression of GmUbox-YFP significantly reduced the biomass of Bacillus anthracis. Figure 1 Therefore, transient expression of GmUbox-YFP in tobacco leaves can enhance tobacco's immunity to anthrax and inhibit anthrax infection.

[0035] Eight days after inoculation with spore suspension, observe the size of the lesions at the inoculation site. Figure 2 The YFP control group showed obvious water-soaked lesions, while the leaves of transiently expressing GmUbox-YFP only showed some small water-soaked spots and exhibited smaller anthracnose lesions.

[0036] Eight days after inoculation with spore suspension, tissue necrosis was observed using trypan blue staining. Inoculated tobacco leaves were transferred to plastic containers, and the prepared trypan blue solution was poured in to submerge the samples. After a boiling water bath, the samples were left to stand overnight for approximately 8 hours. After staining, the samples were placed in a decolorizing solution of hydrated trichloroacetaldehyde, and the decolorizing solution was changed until the samples became translucent. Figure 3 The results showed that the YFP control area had extensive tissue necrosis, while the transiently expressed GmUbox-YFP area only had small and clear blue spots, indicating that the pathogen was effectively suppressed at the infection point and that overexpression of GmUbox significantly enhanced resistance to anthrax.

[0037] The results above indicate that transient overexpression of GmUbox can significantly enhance the resistance of Nicotiana benthamiana to anthracnose.

[0038] Example 2: Overexpression of GmUbox in soybean confers anthracnose resistance in soybean

[0039] Using the same primers and methods as in Example 1, the 1059bp GmUbox fragment shown in SEQ ID NO.1 was ligated into the pBA-Flag-Myc4 vector (from the article: Linhao Ge, Mingxuan Jia, Hongying Shan, Weifang Gao, LuJiang, Hongguang Cui, Xiaofei Cheng, Marilyne Uzest, Xueping Zhou, Aiming Wang, Fangfang Li, Viral RNA polymerase as a SUMOylation decoy inhibits RNAquality control to promote potyvirus infection, Nature Communications, (2025)16:157) to obtain the GmUbox-pBA overexpression vector. Add 10 μl of the ligation product to 50 μl of competent *E. coli* cells (DH5α strain), mix well, and incubate on ice for 30 min, 42°C for 60 s, and on ice for 2 min. Immediately add antibiotic-free LB broth, incubate at 37°C for 1 hour, then plate onto antibiotic-resistant medium (Kan + antibiotic-resistant LB broth) and incubate overnight. Select samples that are positive by bacterial PCR, extract plasmids, and send for sequencing. Add 1 μl of the GmUbox-pBA overexpression vector plasmid to 50 μl of competent *Agrobacterium* cells (GV3101 strain), mix well, and incubate on ice, in liquid nitrogen, 37°C for 5 min, and on ice for 5 min. Immediately add antibiotic-free LB broth, incubate at 28°C for 2 hours, then plate onto antibiotic-resistant medium and grow for 48 hours. Select positive *Agrobacterium* cells.

[0040] The above-mentioned positive single colonies were transferred to 5 ml of liquid resistance medium (LB medium resistant to rifampicin Rif and spectinomycin Kan), and cultured at 28°C and 100 rpm for 24 h. This 5 ml of inoculum was then transferred to 100 ml of liquid resistance medium and cultured at 28°C and 100 rpm for 12 h. The OD600 of Agrobacterium was adjusted to 0.6-1.0. The bacterial suspension was centrifuged at 3600 rpm and 25°C for 10 min, the supernatant was discarded, and the suspended bacteria were precipitated in liquid resistance medium. The OD600 of Agrobacterium was adjusted to 0.8, and the suspension was inoculated into soybean Williams82. Infected soybean cotyledonary nodes were obtained, and differentiation culture yielded clustered shoots. Resistant shoots were selected through screening culture, followed by rooting culture to obtain seedlings. After hardening off, the seedlings were transplanted and cultured again to obtain soybean T0 generation regenerated plants.

[0041] Leaves from soybean plants overexpressing Williams 82 and GmUbox (OE-GmUbox) were taken and inoculated with spore solution (concentration 2×10⁻⁶). 6 (number / mL), results were obtained 8 days after inoculation. Figure 4 The size of the lesions showed significant differences. The WT leaf lesions enlarged significantly, appearing as round or oval light brown lesions with obvious black conidiophores around them, and large areas of yellowing appeared near the inoculation point; 8 days after OE-GmUbox inoculation, the leaves remained green and only necrotic spots appeared at the inoculation point, and the lesions did not spread.

[0042] The results in summary indicate that overexpression of GmUbox enhances the resistance of tobacco and soybean to anthracnose.

Claims

1. Application of soybean GmUbox protein with amino acid sequence as shown in SEQ ID NO.2 in improving plant resistance to anthracnose.

2. The application of the GmUbox gene encoding the soybean GmUbox protein of claim 1 in plant anthracnose resistance, characterized in that, The nucleotide sequence of the GmUbox gene is shown in SEQ ID NO.

1.

3. The application of expression cassettes, recombinant vectors, recombinant cells, recombinant bacteria, or transgenic plants in plant anthracnose resistance, characterized in that, The expression cassette, recombinant vector, recombinant cell, recombinant bacteria, or transgenic plant contains the GmUbox gene, and the nucleotide sequence of the GmUbox gene is shown in SEQ ID NO.

1.

4. The application according to claim 3, characterized in that, The recombinant vector is a plant expression vector.

5. The application according to claim 3, characterized in that, The recombinant vector is obtained by introducing the GmUbox gene into the pEarleyGate104 vector or pBA-Flag-Myc4.

6. The application according to any one of claims 3 to 5, characterized in that, The recombinant bacteria are obtained by introducing the recombinant vector into a host bacterium, preferably Agrobacterium or Escherichia coli.

7. The application according to any one of claims 3 to 5, characterized in that, The plants mentioned include soybeans or tobacco.

8. A method for obtaining anthracnose-resistant plants, characterized in that, The method includes: upregulating the expression or activity of GmUbox protein, the amino acid sequence of which is shown in SEQ ID NO.

2.

9. The method according to claim 8, characterized in that, The method for upregulating the expression or activity of the GmUbox protein is to overexpress the GmUbox gene in the genome of a plant, the nucleotide sequence of which is shown in SEQ ID NO.

1.

10. The method according to claim 8 or 9, characterized in that, The plants mentioned include soybeans or tobacco.

Images