Method for biosynthesis of porphyrin-degrading enzyme and application thereof in pearl whitening
Patent Information
- Application Number
- CN202610681832.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-18
- Publication Date
- 2026-09-25
AI Technical Summary
现有技术主要集中在利用纳米酶模拟过氧化物酶活性降解含卟啉结构的染料,但尚未见可用于降解珍珠内部卟啉色素的生物酶及其制备方法的报道
[0019]1、本发明首次提供了可用于卟啉色素降解的生物酶及其制备方法,填补了珍珠生物增白技术中卟啉降解酶的空白;
Abstract
Description
Technical Field
[0001] This invention relates to the field of enzyme engineering technology, and in particular to a method for the biosynthesis of porphyrin-degrading enzymes and their application in pearl whitening. Background Technology
[0002] The color of pearls is mainly determined by three types of pigments: carotenoids (yellow, orange), melanin (black, gray), and porphyrins (pink, purple). Whitening processes using enzymes that degrade carotenoids and melanin, as well as their complex enzymes, have been developed. However, the enzymatic hydrolysis of porphyrin pigments remains a challenge and a gap in pearl whitening technology.
[0003] Porphyrins are a class of large conjugated cyclic compounds consisting of four pyrrole rings linked by methylene bridges. They are widely found in organisms, such as heme (iron porphyrin) and chlorophyll (magnesium porphyrin). In pearls, porphyrins exist primarily in a free state or bound to metal ions, giving pearls their pink to purple hues. Due to the highly stable structure of porphyrin rings, conventional enzyme preparations are difficult to achieve effective degradation. Currently, there are few reports on porphyrin-degrading enzymes. Existing technologies mainly focus on using nanozymes to mimic peroxidase activity to degrade dyes containing porphyrin structures, but there are no reports of bioenzymes that can be used to degrade porphyrin pigments inside pearls, nor their preparation methods. Therefore, developing a bioenzyme capable of specifically cleaving porphyrin rings is of great significance for improving the pearl bio-whitening technology system. Summary of the Invention
[0004] Therefore, it is necessary to provide a biosynthetic method for porphyrin-degrading enzymes and their application in pearl whitening to address the above problems. Through microbial fermentation and enzyme engineering technology, an enzyme preparation with porphyrin ring cleavage activity can be obtained and applied to the pearl whitening process. It can be combined with carotenoid degrading enzymes and melanin degrading enzymes to achieve comprehensive degradation of various pigments in pearls.
[0005] To achieve the above objectives, the present invention adopts the following technical solution:
[0006] A method for biosynthesizing a porphyrin-degrading enzyme, comprising the following steps:
[0007] (1) Culture of strain: Ensiferadhaerens PPD-1 was inoculated into the culture medium and cultured. The preservation number of the strain is CGMCC No. 6315; (2) Gene cloning and expression: Genomic DNA of the strain was extracted and cloned by PCR to obtain the porphyrin degrading enzyme gene ppdA, the nucleotide sequence of which is shown in SEQ ID NO.1; The porphyrin degrading enzyme gene ppdA was constructed into a recombinant expression vector and transformed into the host bacteria to form a recombinant engineered bacteria to achieve heterologous expression;
[0008] (3) Fermentation production: The recombinant engineered bacteria are inoculated into the fermentation medium for high-density fermentation to induce the expression of porphyrin degrading enzyme; (4) Purification: The fermented cells are collected and purified by cell disruption, centrifugation, chromatography and ultrafiltration to obtain porphyrin degrading enzyme.
[0009] Preferably, in step (2), the amino acid sequence encoded by the porphyrin degrading enzyme gene ppdA is shown in SEQ ID NO.2.
[0010] Preferably, in step (2), the host bacterium is Escherichia coli and the expression vector is pET28a.
[0011] Preferably, in step (3), the fermentation medium comprises: 10g / L-15g / L tryptone, 5g / L-10g / L yeast extract, 5g / L-10g / L NaCl, 5g / L-10g / L glycerol, 2g / L-5g / L K2HPO4, and 0.5g / L-1g / L MgSO4·7H2O; the fermentation conditions are: temperature 35℃-37℃, pH 7.0-7.5, dissolved oxygen 30-50%, final concentration of IPTG inducer 0.1mM-0.5mM, and induction time 4-8 hours.
[0012] As a preferred embodiment, in step (4), the fermentation cells are collected, resuspended in lysis buffer, and the cells are sonicated and centrifuged to obtain the supernatant. The supernatant is purified by Ni-NTA affinity chromatography column, eluted with imidazole-containing elution buffer, and the target protein peak is collected. The purified porphyrin degrading enzyme is obtained by ultrafiltration, desalting and concentration.
[0013] A porphyrin-degrading enzyme prepared by a biosynthetic method of the porphyrin-degrading enzyme as described above.
[0014] Application of a porphyrin-degrading enzyme as described above in pearl whitening.
[0015] Preferably, the porphyrin-degrading enzyme, carotenoid-degrading enzyme, and melanin-degrading enzyme are used in combination, and the weight ratio of the porphyrin-degrading enzyme, carotenoid-degrading enzyme, and melanin-degrading enzyme is: porphyrin-degrading enzyme: carotenoid-degrading enzyme: melanin-degrading enzyme = (0.5-2): (1-5): (1-3).
[0016] As a preferred option, the carotenoid degrading enzyme is carotenoid lysin dioxygenase, and the melanin degrading enzyme is laccase.
[0017] Preferably, the pearl is immersed in a complex enzyme solution containing the porphyrin-degrading enzyme, carotenoid-degrading enzyme and melanin-degrading enzyme, and treated for 4 to 24 hours at a temperature of 30-50°C and a pH of 5.0-7.0.
[0018] The present invention, by adopting the above technical solution, has the following beneficial effects:
[0019] 1. This invention provides for the first time a bio-enzyme that can be used to degrade porphyrin pigments and its preparation method, filling the gap in porphyrin-degrading enzymes in pearl bio-whitening technology;
[0020] 2. This invention achieves efficient enzyme production through microbial fermentation and genetic engineering, resulting in low cost, short cycle time, and easy industrial scaling.
[0021] 3. The porphyrin-degrading enzyme prepared by this invention has a good synergistic effect with carotenoid-degrading enzymes and melanin-degrading enzymes, and can construct a complete pearl complex enzyme whitening system. Moreover, the enzyme treatment conditions are mild, do not damage the pearl structure, and are environmentally friendly. Detailed Implementation
[0022] The embodiments of this application are described in detail below. The described embodiments are exemplary and intended to explain the present invention, and should not be construed as limiting the present invention.
[0023] In this invention, except for the components specifically described for synthesis, all other components and reagents involved are conventional commercially available products or can be obtained through conventional technical means in the art. Unless otherwise stated, the materials, methods, and embodiments of this invention are exemplary only and not limiting.
[0024] The effects of the technical solution of this application will be further illustrated below through several specific application examples.
[0025] Example 1: Screening of porphyrin-degrading enzyme-producing bacteria
[0026] 1. Preparation of screening culture medium
[0027] Inorganic salt culture medium with protoporphyrin IX as the sole carbon and nitrogen source: protoporphyrin IX 0.5 g / L, Na2HPO4 2.0 g / L, KH2PO4 1.0 g / L, MgSO4·7H2O 0.2 g / L, CaCl2 0.01 g / L, FeSO4·7H2O 0.001 g / L, agar 15 (solid medium), pH 7.0.
[0028] 2. Sample Collection and Enrichment
[0029] 10g of each of the following samples were collected: activated sludge from a wastewater treatment plant, soil from a livestock farm, and rhizosphere soil from decaying plants. Each sample was added to a conical flask containing 100mL of enrichment medium (0.1% yeast extract added to the screening medium) and cultured at 30℃ with shaking for 7 days.
[0030] 3. Separation and purification
[0031] After serially diluting the enrichment culture, spread it onto selection medium plates and incubate at 30°C for 5-7 days. Select well-grown colonies with a clear zone around them, streak them onto fresh plates for purification, and obtain pure culture strains.
[0032] 4. Degradation capacity rescreening
[0033] The purified strain was inoculated into liquid selection medium and cultured at 30°C with shaking for 5 days. The change in absorbance (characteristic absorption peak of protoporphyrin IX) at 400 nm was measured. The strain with the most significant decrease in absorbance was selected and named PPD-1. 16S rDNA identification confirmed that PPD-1 was *Ensifer adhaerens*, and it is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 6315.
[0034] Example 2: Cloning and Recombinant Expression of Porphyrin Degrading Enzyme Gene
[0035] 1. Genomic DNA extraction
[0036] PPD-1 strain was inoculated into LB medium and cultured at 30°C with shaking for 24 hours. The bacterial cells were collected by centrifugation, and genomic DNA was extracted using a bacterial genomic DNA extraction kit.
[0037] 2. Primer design and PCR amplification
[0038] By analyzing the whole genome sequence of *Arctium affine* and combining it with the conserved domains of porphyrin degradation-related enzymes reported in the literature, degenerate primers were designed. The degenerate primers are: F: 5'-AAYGCnACnGGnACnGG-3', R: 5'-CCnGTnCCnGTnGCnRTT-3'. After multiple rounds of PCR optimization, a specific amplification band of approximately 900 bp was obtained. Specifically, the PCR conditions in this invention are: pre-denaturation: 95℃ for 5 min; 35 cycles, each cycle including: denaturation: 95℃ for 30 s, annealing at 52℃ for 30 s, extension at 72℃ for 1 min; final extension: 72℃ for 10 min.
[0039] Sequencing analysis showed that the gene encodes 299 amino acids and is named the porphyrin-degrading enzyme gene ppdA. The nucleotide sequence of the porphyrin-degrading enzyme gene ppdA is shown in SEQ ID NO.1, and the amino acid sequence encoded by the porphyrin-degrading enzyme gene ppdA is shown in SEQ ID NO.2.
[0040] 3. Construction of expression vector
[0041] Using the porphyrin-degrading enzyme gene ppdA as a template, primers with restriction enzyme sites were designed. NdeI restriction endonuclease was introduced upstream, and XhoI restriction endonuclease was introduced downstream. The target fragment was amplified by PCR. The purified PCR product was digested with the pET28a vector using NdeI and XhoI, respectively, ligated, transformed into *E. coli* DH5α, and positive clones were screened and sequenced for verification. The recombinant expression plasmid pET28a-ppdA was obtained.
[0042] 4. Recombinant protein-induced expression
[0043] The recombinant plasmid was transformed into Escherichia coli BL21(DE3) to form recombinant engineered bacteria. Single colonies were picked and inoculated into LB medium containing 50 μg / mL kanamycin and cultured at 37°C with shaking until OD. 600 ≈0.6, add IPTG to a final concentration of 0.2 mM, and continue induction culture at 28℃ for 6 h. Centrifuge to collect bacterial cells, and SDS-PAGE analysis showed a clear target protein band at approximately 35 kDa.
[0044] Example 3: Purification and Activity Assay of Porphyrin Degrading Enzyme
[0045] 1. Enzyme purification
[0046] The recombinant engineered bacteria, after induction of expression, were resuspended in lysis buffer (50 mM Tris-HCl, 300 mM NaCl, 10 mM imidazole, pH 8.0), and sonicated (400W, 3 s on, 5 s off, 30 min total). The mixture was then centrifuged at 12000 rpm for 30 min at 4°C, and the supernatant was collected. The supernatant was loaded onto a Ni-NTA affinity chromatography column. Impurities were washed with buffer containing 20 mM imidazole, followed by elution of the target protein with buffer containing 250 mM imidazole. The elution peak was collected, and the mixture was ultrafiltered, desalted, and concentrated to obtain purified porphyrin-degrading enzyme (purity >90%).
[0047] 2. Enzyme activity assay
[0048] An enzyme activity assay system was established using protoporphyrin IX as a substrate: 50 mM phosphate buffer (pH 6.0), 0.1 mM protoporphyrin IX, and an appropriate amount of purified enzyme, with a total volume of 1 mL. After reacting at 40℃ for 30 min, an equal volume of methanol was added to terminate the reaction. The residual amount of protoporphyrin IX was detected by HPLC. Chromatographic conditions: C18 column (4.6 × 250 mm, 5 μm), mobile phase: methanol:0.1% trifluoroacetic acid aqueous solution (85:15), flow rate: 1.0 mL / min, detection wavelength: 400 nm.
[0049] The results showed that the porphyrin-degrading enzyme obtained by recombinant engineered bacteria had significant degradation activity against protoporphyrin IX, with a degradation rate of 65.3% after 30 min of reaction. Enzyme activity was defined as the amount of enzyme required to degrade 1 μmol of protoporphyrin IX per minute at 40℃ and pH 6.0, which is 1 enzyme activity unit (U). The specific activity of the purified porphyrin-degrading enzyme was calculated to be 25.6 U / mg.
[0050] 3. Enzymatic characterization of porphyrin-degrading enzymes obtained from recombinant engineered bacteria
[0051] Optimal pH: Enzyme activity was measured in the pH range of 4.0-8.0. The results showed that the porphyrin degrading enzyme obtained from the recombinant engineered bacteria had the highest activity in the pH range of 5.5-6.5, and the optimal pH was 6.0.
[0052] Optimal temperature: Enzyme activity was measured in the range of 20-60℃. The results showed that the porphyrin degrading enzyme obtained from the recombinant engineered bacteria had the highest activity in the range of 35-45℃, and the optimal temperature was 40℃.
[0053] Stability: The porphyrin-degrading enzyme obtained from the recombinant engineered bacteria retained more than 80% of its activity after being stored at 4℃ for 7 days; after incubation at 30-40℃ for 1 hour, the activity retention was >85%.
[0054] Example 4: Application of porphyrin-degrading enzyme in pearl whitening
[0055] The present invention also discloses the application of the porphyrin-degrading enzyme obtained from the above-mentioned recombinant engineered bacteria in pearl whitening.
[0056] A method for pearl whitening using porphyrin-degrading enzymes obtained from the above-mentioned recombinant engineered bacteria includes the following steps:
[0057] (1) Select light pink freshwater pearls with uniform color (5-6 mm in diameter). Preliminary tests showed that they contained obvious porphyrin characteristic absorption peaks (Soret band ~400 nm). Clean them with deionized water by ultrasonication for 10 min and dry them at room temperature.
[0058] (2) Enzyme treatment: The porphyrin-degrading enzyme prepared in Example 3 was dissolved in 0.1M phosphate buffer (pH 6.0) with an enzyme concentration of 20 U / mL. The pearls from step (1) were immersed in the enzyme solution (solid-to-solid ratio 1:10, w / v) and reacted in a constant temperature shaker at 40℃ for 12 h. A blank control group and a chemical bleaching group were set up at the same time.
[0059] In the blank control group, the pearls from step (1) were immersed in 0.1M phosphate buffer (pH 6.0) and reacted in a constant temperature shaker at 40℃ for 12h.
[0060] In the chemical bleaching group, the pearls from step (1) were immersed in 1% hydrogen peroxide and treated at 40°C for 4 hours.
[0061] (3) Post-processing: After the reaction is complete, remove the pearl, wash it with deionized water, and dry it at room temperature.
[0062] Pearl powder extract was prepared from pearl samples treated with porphyrin-degrading enzyme, in a blank control group, and in a chemical bleaching group. The specific preparation method is as follows:
[0063] Pearl samples were ultrasonically washed with deionized water for 10 min, dried, and then pulverized at low temperature. The powder was passed through a 100-mesh sieve to obtain pearl powder. 0.1 mol / L acetate-sodium acetate buffer (pH 5.0) was added at a material-to-liquid ratio of 1:10 (g / mL), and the mixture was extracted at 4℃ for 12 h. The mixture was centrifuged at 10000 r / min for 15 min, and the supernatant was collected. The supernatant was filtered through a 0.22 μm aqueous filter membrane to obtain the pearl powder extract, which was stored at 4℃ for later use.
[0064] The absorbance of pearl powder extracts treated with porphyrin-degrading enzyme, in the blank control group, and in the chemical bleaching group was determined by ultraviolet-visible spectrophotometry, and the porphyrin residue rate was calculated. The L* value (whiteness) and a* value (redness-greenness, negative values are greenish and positive values are reddish) of pearls were determined by colorimeter. The results are shown in Table 1.
[0065] Table 1. Whitening effect of pearls treated with porphyrin-degrading enzyme, in the blank control group, and in the chemical bleaching group.
[0066] Porphyrin-degrading enzyme treatment 7.5 -5.3 41.2 Blank control group 0.3 -0.2 96.8 Chemical bleaching group 11.2 -8.1 23.5
[0067] The results showed that the porphyrin-degrading enzyme prepared in this invention could effectively degrade porphyrin pigments in pearls (residual rate 41.2%), significantly reduce the redness value of pearls (a* value decreased by 5.3), increase whiteness by 7.5, and maintain the luster of the pearl surface. Although the chemical bleaching group showed a more significant effect, the luster of the pearl surface decreased.
[0068] Example 5: Synergistic treatment with a composite enzyme system
[0069] The porphyrin-degrading enzyme obtained from recombinant engineered bacteria is used in combination with carotenoid-degrading enzymes and melanin-degrading enzymes. In this embodiment, the carotenoid-degrading enzyme is a carotenoid lysin dioxygenase, and the melanin-degrading enzyme is laccase. The specific steps include:
[0070] (1) Preparation of compound enzyme solution
[0071] Take 1 part of porphyrin-degrading enzyme, 2 parts of carotenoid lysing dioxygenase (CCD), and 1 part of laccase prepared in Example 3, mix them and dissolve them in 0.1M acetate-sodium acetate buffer (pH 5.5) to make the total enzyme activity concentration 50 U / mL.
[0072] (2) Processing technology
[0073] Select freshwater pearls containing discoloration (yellow, pink, and gray spots), ultrasonically clean them with deionized water for 10 minutes, and dry them at room temperature. Immerse the pearls in the compound enzyme solution prepared in step (1) at a material-to-liquid ratio of 1:10, and react them at 45°C for 16 hours.
[0074] Simultaneously, groups were set up including a porphyrin-degrading enzyme-only treatment group, a carotenoid-cleaving dioxygenase-only treatment group, a laccase-only treatment group, an untreated control group, and a chemical bleaching group.
[0075] In the porphyrin-degrading enzyme-treated group, pearls were immersed in 0.1M acetate-sodium acetate buffer (pH 5.5) containing only porphyrin-degrading enzyme, with a total enzyme activity concentration of 50 U / mL, a material-to-liquid ratio of 1:10, and reacted at 45℃ for 16 h.
[0076] In the group treated only with carotenoid lysin dioxygenase, pearls were immersed in 0.1M acetate-sodium acetate buffer (pH 5.5) containing only carotenoid lysin dioxygenase, with a total enzyme activity concentration of 50 U / mL, a material-to-liquid ratio of 1:10, and reacted at 45℃ for 16 h.
[0077] In the laccase-only treatment group, pearls were immersed in 0.1M acetate-sodium acetate buffer (pH 5.5) containing only laccase, with a total enzyme activity concentration of 50 U / mL, a material-to-liquid ratio of 1:10, and reacted at 45℃ for 16 h.
[0078] In the untreated control group, pearls were immersed in 0.1M acetate-sodium acetate buffer (pH 5.5) at a material-to-liquid ratio of 1:10 and reacted at 45°C for 16 hours.
[0079] In the chemical bleaching group, pearls were immersed in 2% hydrogen peroxide at a material-to-liquid ratio of 1:10 and treated at 45°C for 8 hours.
[0080] 3. Effectiveness Evaluation
[0081] The treated pearls were measured using a colorimeter to determine their L*, a*, and b* values (yellowish-blue tint; negative values indicate a bluish tint, and positive values indicate a yellowish tint). The total color difference ΔE* (ΔE* = √[(ΔL*)² + (Δa*)² + (Δb*)²]) was calculated to comprehensively reflect the whitening effect. The results are shown in Table 2.
[0082] Table 2. Whitening effect of pearls treated with compound enzyme solution, porphyrin-degrading enzyme alone, carotenoid-cleaving dioxygenase alone, laccase alone, and untreated control group.
[0083] Blank control group - - - - The surface shows obvious yellow and pink variegation, with no loss of gloss or cracks. Porphyrin-degrading enzyme-treated group only 7.2 -5.1 -1.2 8.9 The pink hue has diminished, while the yellow hue remains; the surface shows no loss of shine or cracks. Carotenoid cleavage dioxygenase treatment group only 8.1 -0.8 -4.6 9.3 The yellow tint has diminished, while the pink tint remains; the surface shows no loss of shine or cracks. Laccase-treated group only 5.5 -2.3 -2.1 6.3 The gray tone has lessened, but the mixed colors remain; the surface shows no loss of gloss or cracks. Compound enzyme solution treatment group 16.3 -7.8 -6.5 19.1 The surface is uniformly whitened, impurities disappear, and there is no loss of gloss or cracks. Chemical bleaching group 13.2 -2.0 -5.3 17.5 The overall whitening is uniform, and impurities have disappeared, but the pearl surface shows slight loss of luster and micro-cracks.
[0084] The results showed that the treatment effect of the compound enzyme solution group was significantly better than that of the single enzyme treatment group, with a ΔE* of 19.1. The pearls were uniformly whitened and various impurities were basically eliminated. Although the ΔE* of the chemical bleaching group was similar to that of the compound enzyme solution group, it caused slight loss of luster and microcracks on the surface of the pearls after treatment.
[0085] Example 6: Enzyme Immobilization and Reuse
[0086] 1. Preparation of immobilized enzymes
[0087] A composite enzyme (with the same proportions as in Example 5) was immobilized on aminated magnetic nanoparticles using a glutaraldehyde cross-linking method. The specific steps were as follows: the composite enzyme solution was mixed with the carrier, and the mixture was shaken at 4°C for 2 hours to allow adsorption. Glutaraldehyde was then added to a final concentration of 0.3%, and cross-linking continued for 3 hours. After magnetic separation and washing, the immobilized enzyme was obtained.
[0088] 2. Reuse Experiment
[0089] Immobilized enzymes were used for pearl whitening treatment (under the same conditions as in Example 5). After each batch of treatment, the enzymes were magnetically recovered and reused for the next batch of fresh pearls.
[0090] The L* value (whiteness) of the pearls was determined using a colorimeter. The results are shown in Table 3.
[0091] Table 3. Whitening effect of immobilized enzyme on pearls after 5 consecutive uses.
[0092] 1 15.8 100 2 14.5 91.8 3 12.9 81.6 4 11.2 70.9 5 8.7 55.1
[0093] The results showed that after the immobilized enzyme was used four times, the increase in pearl whiteness (ΔL*) remained at more than 70% of the initial value (Table 3), demonstrating good operational stability.
[0094] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions, alterations, deletions of some features, additions of features, or recombinations of features to the above embodiments within the scope of the present invention without departing from the principles and spirit of the present invention. Any simple modifications, equivalent changes, and alterations made to the above embodiments based on the innovative principles of the present invention shall still fall within the scope of the technical solutions of the present invention.
[0095] SEQ ID NO.1:
[0096] ATGAAAGAAATCGCTATCGGTGGCGGCACCGGCACCGGTACCGGCACCGGCACCGGCACCGGCACCGGCACCGGTGGTGGCGGTATCGGTATCGACAAGGCCAACCTGGCCGAGCTGGCCGAGGCCAACCTGGCCGAGAACCTGGAAGACATCAACGGCAAGCTGACCGGCAAGCTGACCGGCAAGCTGACCGGCAAGCTGACCGGCAAGCTGACCGGCAAGCTGACCGGCAAGCTGACCGGCAAGCTGACCGGCAAGCTGACCGGCAAGCTGACCGGCAAGCTGACCGGCAAGCTGACCGGCAAGCTGACCGGCAAGCTGACCGGCAAGCTGACCGGCAAGCTG
[0097] SEQ ID NO.2:
[0098] MKEIIGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTIKANKLAELAANLAENLEDINGKLTGKLAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKA
Claims
1. A method for the biosynthesis of a porphyrin-degrading enzyme, characterized in that, Includes the following steps: (1) Culture of strain: Ensiferadhaerens PPD-1 was inoculated into the culture medium for culture. The preservation number of the strain is CGMCC No.6315. (2) Gene cloning and expression: Genomic DNA of the strain was extracted and cloned by PCR to obtain the porphyrin degrading enzyme gene ppdA, the nucleotide sequence of which is shown in SEQ ID NO.1; the porphyrin degrading enzyme gene ppdA was constructed into a recombinant expression vector and transformed into a host bacterium to form a recombinant engineered bacterium to achieve heterologous expression; (3) Fermentation production: The recombinant engineered bacteria are inoculated into the fermentation medium for high-density fermentation to induce the expression of porphyrin-degrading enzymes; (4) Purification: Collect fermentation cells, and purify them by cell disruption, centrifugation, chromatography and ultrafiltration to obtain porphyrin degrading enzyme.
2. The method according to claim 1, characterized in that, In step (2), the amino acid sequence encoded by the porphyrin degrading enzyme gene ppdA is shown in SEQ ID NO.
2.
3. The method for biosynthesizing a porphyrin-degrading enzyme according to claim 1, characterized in that, In step (2), the host bacterium is Escherichia coli, and the expression vector is pET28a.
4. The method for biosynthesizing a porphyrin-degrading enzyme according to claim 1, characterized in that, In step (3), the fermentation medium consists of: 10 g / L-15 g / L tryptone, 5 g / L-10 g / L yeast extract, 5 g / L-10 g / L NaCl, 5 g / L-10 g / L glycerol, 2 g / L-5 g / L K2HPO4, and 0.5 g / L-1 g / L MgSO4·7H2O; the fermentation conditions are: temperature 35℃-37℃, pH 7.0-7.5, dissolved oxygen 30-50%, final concentration of IPTG inducer 0.1 mM-0.5 mM, and induction time 4-8 hours.
5. The method for biosynthesizing a porphyrin-degrading enzyme according to claim 1, characterized in that, In step (4), the fermentation cells are collected, resuspended in lysis buffer, and the cells are sonicated and centrifuged to obtain the supernatant. The supernatant is purified by Ni-NTA affinity chromatography column, eluted with imidazole-containing elution buffer, and the target protein peak is collected. The purified porphyrin degrading enzyme is obtained by ultrafiltration, desalting and concentration.
6. A porphyrin-degrading enzyme prepared by the biosynthetic method of any one of claims 1-5.
7. The application of the porphyrin-degrading enzyme as described in claim 6 in pearl whitening.
8. The application of the porphyrin-degrading enzyme according to claim 7 in pearl whitening, characterized in that, The porphyrin-degrading enzyme, carotenoid-degrading enzyme, and melanin-degrading enzyme are used in combination, and the weight ratio of the porphyrin-degrading enzyme, carotenoid-degrading enzyme, and melanin-degrading enzyme is: porphyrin-degrading enzyme: carotenoid-degrading enzyme: melanin-degrading enzyme = (0.5-2): (1-5): (1-3).
9. The application of the porphyrin-degrading enzyme according to claim 8 in pearl whitening, characterized in that, The carotenoid degrading enzyme is carotenoid lysin, and the melanin degrading enzyme is laccase.
10. The application of the porphyrin-degrading enzyme according to claim 8 in pearl whitening, characterized in that, The pearls are immersed in a complex enzyme solution containing the porphyrin-degrading enzyme, carotenoid-degrading enzyme, and melanin-degrading enzyme, and treated for 4 to 24 hours at a temperature of 30-50°C and a pH of 5.0-7.0.