A ketopantoate dehydrogenase mutant with high yield of d-pantoic acid, construction method and application thereof

CN122811133APending Publication Date: 2026-09-25ZHEJIANG UNIV OF TECH
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202611164930.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-08-03
Publication Date
2026-09-25

AI Technical Summary

Technical Problem

其化学结构上比另一前体酮异戊酸(KIV)多出一个羟甲基,因此分子更大、结构更复杂

Benefits of technology

[0056](1)本发明通过蛋白结构及和底物的结合特点筛选了进行改造的位点;

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses a ketopantoate dehydrogenase mutant with high D-pantoic acid yield, a construction method and application thereof, utilizes molecular docking to predict the catalytic efficiency of amino acid residues within 10 Å around a substrate binding pocket, combines with conservative sequence analysis, screens residues around a substrate hydroxymethyl and a methyl group for alanine scanning and saturation mutation, and obtains mutants T119I and I183S. The application has the beneficial effects that: the sites for modification are screened, the mutant I183S and the mutant T119I are determined; the mutation improves the catalytic efficiency by providing a more stable catalytic environment, a closer combination with a catalytic unit, an expansion of an active cavity and a shortening of a substrate channel length; the mutant I183S produces D-pantoic acid at a yield of 36.12 g / L in a 5L fermenter for 80 hours, a yield of 0.45 g / L / h and a conversion rate of 0.178 g / g.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and relates to a ketopantoacid dehydrogenase mutant that produces high levels of D-pantothenic acid, its construction method, and its applications. Background Technology

[0002] Protein engineering enables precise modification of the structure and function of enzymes at the molecular level, serving as a crucial means to improve enzyme catalytic efficiency, alter substrate specificity, and enhance stability. Through rational design, directed evolution, or semi-rational modification, researchers can reshape the active pocket, substrate channel, or regulatory domain of enzymes to meet specific catalytic needs, thereby obtaining mutants with superior performance. In recent years, protein engineering has shown broad application prospects in fields such as industrial biocatalysis, pharmaceutical synthesis, and green manufacturing. For example, studies on fatty acid dehydratases (such as FabA) have shown that reshaping the substrate binding pocket affects selectivity. The L28F mutant has a contracted pocket that enhances interactions with short-chain substrates, while the F21G mutant has an enlarged pocket, exhibiting higher activity for short-chain substrates while retaining some activity for long-chain substrates (Finzel, K., Nguyen, C., Jackson, DR, et al (2015) Probing the substrate specificity and protein-protein interactions of the e. Coli fatty acid dehydratase, faba. Chem. Biol. 22: 1453-1460). In a pathway for the artificial synthesis of benzyl benzoate, carboxyl reductase (Car) was modified to convert benzoic acid (BA) to benzyl alcohol (BALC). However, it was found that Car nonspecifically metabolized the structurally similar precursor, cinnamic acid (CA), resulting in substrate waste. To improve the selectivity for the smaller substrate BA relative to CA, researchers employed a computer-aided channel remodeling strategy. The resulting Q302Y / I303Y mutant introduced larger amino acid residues at the bottleneck of the channel, forming an optimal channel size that facilitated BA entry while simultaneously hindering CA entry due to steric hindrance, thereby improving the efficiency of the entire pathway (Lu, L., Wang, X., Wang, T., et al (2024) A bacterial platform for producing aromatic esters from glycerol. Nat. Chem. Eng. 1: 751-764).

[0003] Ketopantolytic acid (KPL) is a key direct precursor in the biosynthetic pathway of D-pantothenic acid (vitamin B5). Its chemical structure contains an additional hydroxymethyl group compared to its precursor, ketoisovalerate (KIV), resulting in a larger and more complex molecule. In microorganisms, KPL undergoes a reduction reaction catalyzed by ketopantolytic acid reductase (KPR) to generate pantothenic acid, which then condenses with β-alanine to form D-pantothenic acid. Therefore, the conversion efficiency of KPL directly affects the final yield of D-pantothenic acid. The catalytic process of KPL is roughly as follows: After the substrate KPL enters the active pocket, its Si face faces the hydride anion at the C4 position of NADPH. Lys176 acts as a universal acid / base catalyst; it changes shape and forms a hydrogen bond with the carbonyl group at the C2 position of the substrate KPL, thus neutralizing the negative charge generated in the reaction and facilitating the transfer of the hydride anion from NADPH to the C2 position. Additionally, the conserved Ser244 forms a hydrogen bond with the carboxylic acid group of the substrate, effectively "locking" the substrate in place. Asn98 is also crucial; it helps bind substrates, stabilizes the active conformation of Lys176, and promotes NADP. + It detaches from the enzyme.

[0004] Therefore, there is an urgent need for a strain and method to modify the ketopantolytic acid dehydrogenase EcPanE to increase D-pantothenic acid production. Summary of the Invention

[0005] To address the aforementioned issues, this invention presents a ketopantolytic acid dehydrogenase mutant that produces high levels of D-pantothenic acid, its construction method, and its applications.

[0006] The technical solution adopted in this invention is:

[0007] The first objective of this invention is to provide a method for constructing a ketopantolate dehydrogenase mutant that produces high levels of D-pantothenic acid, comprising the following steps:

[0008] Step 1: Using the EcPanE crystal structure PDB: 1KS9 from E. coli as a template, the protein crystal was combined with the substrate ketopanolic acid and the coenzyme NADPH through molecular docking technology.

[0009] Step 2: Screen amino acids within 10 Å of the substrate binding site and predict the corresponding K+ of these amino acids. cat / K m Value, and analyze K cat / K m Values ​​were selected based on the amino acid distribution that ranked in the top 55% overall.

[0010] Step 3: Based on the amino acids in Step 2, select amino acids from specific secondary structures near the substrate binding pocket and predict the conservation of the amino acid sequence;

[0011] Step 4: From the amino acids in Step 3, select the amino acids that encapsulate the hydroxymethyl group and two methyl groups of ketopantolytic acid and perform an alanine scan; the amino acids include T119, H120, A121, K176, V179, N180, I183, N184, N194, V234, T238, N241 and S243;

[0012] Step 5: Perform saturation mutations on the sites T119, I183, S243, N241 and A121 that showed relatively significant alanine scanning effects in Step 4, and screen to obtain mutants I183S and T119I.

[0013] As a preferred embodiment of this application, the host bacterium in step 1 is Escherichia coli (E. coli) W3110 DE3.

[0014] As a preferred embodiment of this application, the specific secondary structure is an α-helix, β-sheet, or similar structure.

[0015] As a preferred embodiment of this application, after screening for mutants in step 5, the method further includes verifying the catalytic activity and elucidating the molecular mechanism of the mutants, specifically including:

[0016] The mutants I183S and T119I were constructed on plasmid pET28a and transformed into E. coli BL21(DE3) competent cells. After heterologous expression, the catalytic activities of each enzyme on the substrate ketopantolytic acid were tested and compared.

[0017] The spatial structures of mutants I183S and T119I were simulated using the SWISS-MODEL website and AlphaFold, respectively. Molecular docking of the protein and its ligand-coenzyme was performed using Autodock Vina, and the docking results were visualized and analyzed using PyMOL.

[0018] The substrate channel parameters of the mutant were calculated using Caver Dock, and the area of ​​the protein active pocket was calculated using ProteinsPlus to analyze the mechanism by which the mutation affects the enzyme's catalytic performance.

[0019] As a preferred embodiment of this application, the nucleotide sequence of EcpanE derived from E. coli is shown in SEQ ID NO.1.

[0020] As a preferred embodiment of this application, step 2 uses the CatPred website to predict K. cat / K m value.

[0021] As a preferred embodiment of this application, in step 3, the conservation of its amino acid sequence is predicted using the WebLogo website.

[0022] As is preferred in this application, step 5 is performed according to the following steps:

[0023] (1) Using plasmid pECXK99E as a template, the gene cluster BspanBC from Bacillus subtilis 168 and the promoter P from C. glutamicum ATCC 13032 were cloned in one step. 4-N14 The ketoplasmin dehydrogenase alanine scanning mutant was ligated to obtain a series of recombinant expression plasmids;

[0024] (2) The obtained recombinant expression plasmid was electroporated into competent cells of strain DPAg-15, and the recombinant strain after transformation was tested by shake flask fermentation. The synthesis yield of D-pantothenic acid and the accumulation level of by-product α-ketoisovalerate were used as dual screening indicators to screen out four key functional sites that have the most significant impact on the synthesis of the target product, namely T119, I183, S243 and N241.

[0025] (3) Saturation mutations were performed on site A121 and sites T119, I183, S243 and N241 obtained in step (2) to obtain the best and second best mutants for improving D-pantothenic acid production, namely mutant I183S and mutant T119I.

[0026] (4) The mutants I183S and T119I were transformed into competent cells of strain DPAj-2. The production stability of the transformed recombinant strain was verified by shake-flask fermentation. Finally, the mutants I183S and T119I were confirmed as the target mutants.

[0027] As a preferred embodiment of this application, the mutation site of the ketopantolytic acid dehydrogenase alanine scanning mutant is selected from one or more of H120A, A121A, K176A, V179A, N180A, I183A, N184A, N194A, V234A, T238A, N241A and S243A.

[0028] As a preferred embodiment of this application, the nucleotide sequence of the gene cluster BspanBC is shown in SEQ ID NO.2.

[0029] As a preferred embodiment of this application, the promoter P 4-N14 The nucleotide sequence is shown in SEQ ID NO.3.

[0030] A second objective of this invention is to provide a ketopantoacid dehydrogenase mutant obtained by the aforementioned construction method.

[0031] A third objective of the present invention is to provide a genetically engineered bacterium that produces high levels of D-pantothenic acid, comprising a ketopantothenic acid dehydrogenase mutant.

[0032] As a preferred embodiment of this application, the ketopantoacid dehydrogenase mutant is mutant I183S.

[0033] The fourth objective of this invention is to provide a method for constructing a genetically engineered bacterium that produces high levels of D-pantothenic acid, comprising a ketopantothenic acid dehydrogenase mutant, specifically including the following steps:

[0034] (1) Using the EcPanE crystal structure (PDB: 1KS9) from Escherichia coli as a template, the protein crystal was combined with the substrate ketopanolic acid and coenzyme NADPH by molecular docking technology;

[0035] (2) Select amino acids within 10 Å of the substrate binding pocket and use the CatPred website to predict K. cat / K m Value, analysis of K cat / K m Values ​​were selected based on the amino acid distribution that ranked in the top 55% overall.

[0036] (3) Select amino acids with specific secondary structures (such as α-helices, β-sheets, etc.) near the substrate binding pocket and use the WebLogo website to predict the conservation of their amino acid sequences;

[0037] (4) Among the amino acids in step (3), amino acids that encapsulate the hydroxymethyl group and two methyl groups of ketopantolytic acid, including T119, H120, A121, K176, V179, N180, I183, N184, N194, V234, T238, N241, and S243, are selected for alanine scanning. The sites that have a significant impact on the catalytic effect are screened using the yield of D-pantolytic acid and the accumulation level of the byproduct α-ketoisovaleric acid as indicators.

[0038] (5) Perform saturation mutations on the sites T119, I183, S243, N241 and A121 that have relatively significant effects in step (4) to further determine the mutant with the best effect, I183S and the second best mutant, T119I, which are the target mutants.

[0039] (6) Using plasmid pECXK99e as a vector, the gene cluster BspanBC from Bacillus subtilis 168 and the promoter P from C. glutamicum ATCC 13032 were transferred to the vector. 4-N14The plasmids were ligated with EcpanE, mutant I183S, and mutant T119I derived from E. coli, respectively, to obtain recombinant expression plasmids, named pECX-wt, pECX-I183S, and pECX-T119I.

[0040] (7) Transform the recombinant expression plasmid obtained in step (6) into competent cells of strain DPAj-2, and perform shake-flask fermentation test on the transformed recombinant strain. Based on the D-pantothenic acid production level, screen out the recombinant strain with the highest yield, which is the genetically engineered strain with high D-pantothenic acid production.

[0041] Preferably, the construction method further includes a step of analyzing the catalytic mechanism of the target mutant:

[0042] EcpanE, mutant I183S, and mutant T119I were constructed on plasmid pET28a and transformed into E. coli BL21 competent cells to compare the catalytic activity of wild-type and mutant cells on substrates.

[0043] The spatial structures of the two mutants were simulated using the SWISS-MODEL website and AlphaFold, molecular docking of the protein and ligand coenzyme was performed using AutodockVina, and PyMOL was used for visualization analysis.

[0044] The substrate channels were calculated using Caver Dock, and the area of ​​the protein activity pockets was calculated using ProteinsPlus.

[0045] The fifth objective of this invention is to provide the application of the aforementioned ketopantothenic acid dehydrogenase mutant or the aforementioned genetically engineered bacteria in the preparation of D-pantothenic acid.

[0046] As a preferred embodiment of this application, the application is as follows: the genetically engineered bacteria are inoculated into a fermentation medium and fermented at 30°C and 200 rpm for 48-60 h. After fermentation, the supernatant of the fermentation broth is separated and purified to obtain the D-pantothenic acid. The fermentation medium has the following composition: glucose: 10-30 g / L, corn steep liquor: 10-20 g / L, ammonium sulfate: 10-20 g / L, yeast extract: 1-5 g / L, KH2PO4: 0.2-1 g / L, MgSO4: 0.5-5 g / L, sodium acetate: 5-8 g / L, β-alanine: 0.5-2 g / L, CaCO3: 3-5 g / L, and a 0.5-2 mL / L trace element solution in deionized water with a natural pH. The trace element solution has the following composition: NiCl2·7H2O 0.02 g / L, CuCl2 10 g / L, FeSO4·7H2O 10 g / L. The concentrations of the following components were: g / L ZnSO4·7H2O 10 g / L, CuSO4 0.2 g / L, and the solvent was deionized water.

[0047] As a preferred embodiment of this application, the fermentation culture medium comprises: 30 g / L glucose, 16 g / L ammonium sulfate, 10 g / L corn steep liquor, 2 g / L yeast extract, 0.8 g / L KH₂PO₄, 0.5 g / L MgSO₄, 5 g / L sodium acetate, 2 g / L β-alanine, 3 g / L CaCO₃, and a 1 mL / L trace element solution in deionized water with a natural pH. The trace element solution consists of: 0.02 g / L NiCl₂·7H₂O, 10 g / L CuCl₂, 10 g / L FeSO₄·7H₂O, 10 g / L ZnSO₄·7H₂O, and 0.2 g / L CuSO₄ in deionized water.

[0048] As a preferred embodiment of this application, the fermentation is carried out in a fermenter using fed-batch fermentation: the genetically engineered bacteria are inoculated into BHIS test tube medium containing 25 mg / L kanamycin resistance and 12 mg / L chloramphenicol resistance, and cultured at 30°C for 18 h to obtain the seed culture; the seed culture is then inoculated into BHIS medium at a volume concentration of 5% and cultured at 30°C for 12 h to obtain the seed culture for the upper fermenter; the seed culture from the upper fermenter is then inoculated into the fermenter containing fermentation medium at a volume concentration of 10%, and fermented at 30°C, 400 rpm, and an aeration rate of 1.0 V / V·min, with dissolved oxygen controlled at 20%~40%. A constant-rate feeding method is used to maintain the glucose concentration below 5 g / L, and fermentation is continued for 63 h to obtain a fermentation broth containing D-pantothenic acid. The fermentation medium consisted of: glucose 40 g / L, ammonium sulfate 20 g / L, corn steep liquor 20 g / L, yeast extract 2 g / L, KH₂PO₄ 0.8 g / L, MgSO₄ 0.5 g / L, sodium acetate 5 g / L, β-alanine 2 g / L, CaCO₃ 3 g / L, and a 1 mL / L trace element solution in deionized water at a natural pH. The trace element solution composition was: NiCl₂·7H₂O 0.02 g / L, CuCl₂ 10 g / L, FeSO₄·7H₂O 10 g / L, ZnSO₄·7H₂O 10 g / L, CuSO₄ 0.2 g / L in deionized water. The feed medium consists of 500 g / L glucose, 20 g / L (NH4)2SO4, 1 g / L MgSO4, and 30 g / L β-alanine, dissolved in deionized water and adjusted to pH 6.8 with 50% ammonia.

[0049] As a preferred embodiment of this application, the application is a method for determining the catalytic activity of a ketopantolytic acid dehydrogenase mutant, comprising the following steps:

[0050] (1) Induction of bacterial expression: The genetically engineered bacteria were inoculated into LB liquid medium containing a final concentration of 50 μg / mL kanamycin and cultured overnight at 37°C and 220 rpm; the bacterial culture was then transferred to 100 mL of LB liquid medium at a volume fraction of 1% and cultured at 37°C and 220 rpm until OD was obtained. 600 Once the concentration reached 0.6, a final concentration of 0.5 mM IPTG was added for induction; induction was performed at 30℃ and 150 rpm for 16 h.

[0051] (2) Collection of bacterial strains: After induction, centrifuge, discard the supernatant, collect the bacterial cells, add 20 mL of PBS buffer to the collected bacterial cells to completely suspend the bacterial cells, centrifuge at 6000 rpm and 4℃ for 6 min; after centrifugation, discard the supernatant and collect the bacterial cells; the composition of the induction medium is as follows: 10.0 g of peptone, 5.0 g of yeast extract, 5.0 g of NaCl, and deionized water as the solvent, and bring the volume to 1000 mL.

[0052] (3) Substrate-catalyzed enzyme activity test: 20 g / L bacterial culture, 5 g / L ketopantolytic acid, 5 mM NADPH and 20 mM Tris-HCl buffer (pH 7.0); D-pantolytic acid was prepared by reacting at 30°C and 200 rpm for 5 h; 100 μL of the reaction solution was taken and the reaction was terminated in 20 μL HCl (6M); the reaction solution was filtered through a 0.22 μm organic filter membrane, and the ketopantolytic acid content was detected by high performance liquid chromatography (HPLC) to calculate enzyme activity; one unit of enzyme activity (U) is defined as the amount of enzyme required to catalyze the conversion of 1 μmol of substrate (ketopantolytic acid) per minute under specified conditions (30°C, pH 7.0). Enzyme activity was determined by measuring the amount of ketopantolytic acid consumed.

[0053] As a preferred embodiment of this application, the detection conditions for the high-performance liquid chromatography are as follows: C18 column (250×4.6 mm, 5 μm), detection wavelength of 200 nm; column temperature of 30 ℃; flow rate of 1 ml / min; mobile phase of acetonitrile / water / phosphoric acid (volume ratio 80 / 919 / 1); data acquisition time of 20 min; and dilution with ultrapure water before sample processing to maintain the D-pantothenic acid content between 0.2 g / L and 1 g / L.

[0054] Molecular docking and molecular dynamics revealed the advantages of mutants: 1) Wild-type enzymes exhibit greater fluctuations during reactions, while mutants demonstrate a more stable catalytic environment, with I183S showing superior stability compared to T119I. 2) The shorter substrate-binding distance of mutants not only further stabilizes the catalytic environment but also shortens the proton transfer distance, thereby improving enzyme activity. 3) Both mutants have larger active pocket volumes than the wild type, with I183S exhibiting the largest volume. This larger active pocket is more conducive to the binding and catalysis of large-volume substrates like KPL. 4) CAVER analysis showed that the substrate channel length and distance to the protein surface in I183S are both smaller than in the wild type, which facilitates substrate entry and product release, thus improving catalytic efficiency. In summary, these mechanisms indicate that beneficial mutants such as I183S not only provide a more stable catalytic environment but also better accommodate larger substrates like KPL by expanding the active pocket. This synergistic effect explains the superior activity of I183S and provides a reasonable framework for modifying KPR and related enzymes to improve DPA yield. The final mutant produced 36.12 g / L of D-pantothenic acid in a 5L fermenter for 80 hours, with a yield of 0.45 g / L / h and a conversion rate of 0.178 g / g.

[0055] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0056] (1) This invention screens sites for modification based on protein structure and binding characteristics to substrates;

[0057] (2) The best mutant I183S and the second best mutant T119I were determined by alanine scanning and saturation mutagenesis;

[0058] (3) Molecular dynamics simulations show that these mutations improve catalytic efficiency by providing a more stable catalytic environment, a tighter binding with the catalytic unit, an expanded active cavity, and a shortened substrate channel length;

[0059] (4) The optimal mutant produced 36.12 g / L of D-pantothenic acid in a 5 L fermenter for 80 hours, with a yield of 0.45 g / L / h and a conversion rate of 0.178 g / g. Attached Figure Description

[0060] Figure 1 Predicted docking diagrams of EcPanE with coenzymes and substrates;

[0061] Figure 2 K was predicted using amino acid saturation mutations 10 Å from the substrate in the EcPanE dataset from the CatPred website. cat / K m value;

[0062] Figure 3Predict K cat / K m Distribution map of amino acids with higher values;

[0063] Figure 4 Conserved amino acid profiles of secondary structures near the substrate-binding region in EcPanE;

[0064] Figure 5 Amino acids that encapsulate specific hydroxymethyl and methyl groups of the substrate;

[0065] Figure 6 The effect of alanine scanning on D-pantothenic acid production;

[0066] Figure 7 The effect of saturation mutation on D-pantothenic acid production;

[0067] Figure 8 The effect of single mutants, i.e. iterative mutants, on D-pantothenic acid production in DPAj-2;

[0068] Figure 9 Test specific activities of wild-type and mutant strains to substrates in BL21;

[0069] Figure 10 Root mean square deviation (RMSD) simulation of molecular dynamics;

[0070] Figure 11 The analysis of mutant mechanisms includes the stability of the reaction process, the interaction between the substrate and surrounding amino acids, the size of the active pocket, and the length of the substrate channel;

[0071] Figure 12 Fermentation diagram of an engineered strain containing a mutant. Detailed Implementation

[0072] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0073] It should be noted that the process equipment or apparatus not specifically mentioned in the following embodiments are all conventional equipment or apparatus in the art.

[0074] Furthermore, it should be understood that the existence of other method steps before or after the combined steps, or the insertion of other method steps between these explicitly mentioned steps, does not preclude the existence of other method steps before or after the combined steps, or the insertion of other method steps between these explicitly mentioned steps, unless otherwise stated. It should also be understood that the combined connection relationship between one or more devices / apparatus mentioned in this invention does not preclude the existence of other devices / apparatus before or after the combined devices / apparatus, or the insertion of other devices / apparatus between these explicitly mentioned devices / apparatus, unless otherwise stated. Moreover, unless otherwise stated, the numbering of each method step is merely a convenient tool for identifying each method step, and not for limiting the order of the method steps or limiting the scope of the invention. Changes or adjustments to their relative relationships, without substantially altering the technical content, should also be considered within the scope of the invention.

[0075] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.

[0076] Unless otherwise specified, the experimental materials used in the following examples are all conventional biochemical reagents.

[0077] In the following examples, the final concentration of kanamycin in the culture medium was 0.025 mg / L.

[0078] LB medium: 10 g / L peptone, 5 g / L yeast extract, 5 g / L NaCl, solvent is deionized water, solid medium with 2% agar powder, pH is natural.

[0079] BHIS liquid culture medium: 10 g / L peptone, 5 g / L yeast extract, 5 g / L NaCl, 10 g / L glucose, 10 g / L brain and heart extract powder, solvent: deionized water, pH: natural.

[0080] BHIS plates: 10 g / L peptone, 5 g / L yeast extract, 5 g / L NaCl, 10 g / L glucose, 10 g / L brain and heart extract powder, solvent: deionized water, 2% agar powder, pH: natural.

[0081] The strain Corynebacterium glutamicum ATCC13032 (C. glutamicum ATCC 13032, purchased from the ATCC Collection). Strains DPAj-2 and DPAg-15 were laboratory-preserved strains, and their construction methods are disclosed in patent CN121825841A. E. coli BL21(DE3) was purchased from Sangon Biotech (Shanghai) Co., Ltd., catalog number B528414-0100.

[0082] Table 1: Genes involved in gene editing and corresponding pathways

[0083] Gene name Involved methods EcpanE panE gene from E. coli BspanB panB gene from B. subsills BspanC panC gene from B. subsills

[0084] The primer sequence information used in Examples 2-7 is shown in Table 2:

[0085] Table 2: Primer sequences

[0086] Primers Sequence (5'-3') PECXK99E-F GAATTCAGCTTGGCTGTTTTGGCGGATGAGAGAAGATTTTC PECXK99E-R CTATATCTCCTTCATGGTCCATGGTCTGTTTCCTGTGTGAAATTG RBS-BspanBCD-F GACCATGAAGGAGATATAGATGAAAACAAAACTGGATTTTC RBS-BspanC-R CTATATCTCCTTCATGGTCTTATATTTCCTCCATTTCTC pECXK99E-EcpanE-R AACAGCCAAGCTGAATTCCTACCAGGGGCGAGGCAAACC RBS-EcpanE-F GACCATGAAGGAGATATAGATGAAAATTACCGTATTGG P4-N14-T2ter-R CCCAGCTGGCAACGTCCATATCCTTAATGTTGATTTGGAATGTATTTAGAAAAATAAAC P4-N14RBS-F TGGACGTTGCCAGCTGGGATGGTTAGAGACCATGAAGGAGATATAGATGAAAATTAC EcpanE(119-121)-F GCCCGCCGCGACGGCAATG EcpanE(176)-F CTGGCAGTCAACTGCGTGATTAATC EcpanE(179,180)-F TGCGTGATTAATCCACTGACTGCC EcpanE(183,184)-F CCACTGACTGCCATCTGGAATTG EcpanE(194)-F GGTGAATTACGTCATCATCCG EcpanE(234)-F ATTGATGCCACAGCGGAAAATATC EcpanE(238,241,243)-F TCGATGTTGCAGGATATCCGCG EcpanE(A121C)-R CATTGCCGTCGCGGCGGGCgcaATGGGTGGTTGGTGCCCATC EcpanE(A121D)-R CATTGCCGTCGCGGCGGGCgtcATGGGTGGTTGGTGCCCATC EcpanE(A121E)-R CATTGCCGTCGCGGCGGGCttcATGGGTGGTGGTGCCCATC EcpanE(A121F)-R CATTGCCGTCGCGGCGGGCgaaATGGGTGGTGGTGCCCATC EcpanE(A121G)-R CATTGCCGTCGCGGCGGGCaccATGGGTGGTGGTGCCCATC EcpanE(A121H)-R CATTGCCGTCGCGGCGGGCgtgATGGGTGGTGGTGCCCATC EcpanE(A121I)-R CATTGCCGTCGCGGCGGGCgatATGGGTGGTGGTGCCCATC EcpanE(A121K)-R CATTGCCGTCGCGGCGGGCcttATGGGTGGTGGTGCCCATC EcpanE(A121L)-R CATTGCCGTCGCGGCGGGCgagATGGGTGGTGGTGCCCATC EcpanE(A121M)-R CATTGCCGTCGCGGCGGGCcatATGGGTGGTGGTGCCCATC EcpanE(A121N)-R CATTGCCGTCGCGGCGGGCgttATGGGTGGTGGTGCCCATC EcpanE(A121P)-R CATTGCCGTCGCGGCGGGCcggATGGGTGGTGGTGCCCATC EcpanE(A121Q)-R CATTGCCGTCGCGGCGGGCctgATGGGTGGTGGTGCCCATC EcpanE(A121R)-R CATTGCCGTCGCGGCGGGCtcgATGGGTGGTGGTGCCCATC EcpanE(A121S)-R CATTGCCGTCGCGGCGGGCggaATGGGTGGTGGTGCCCATC EcpanE(A121T)-R CATTGCCGTCGCGGCGGGCggtATGGGTGGTGGTGCCCATC EcpanE(A121V)-R CATTGCCGTCGCGGCGGGCaacATGGGTGGTGGTGCCCATC EcpanE(A121W)-R CATTGCCGTCGCGGCGGGCccaATGGGTGGTGGTGCCCATC EcpanE(A121Y)-R CATTGCCGTCGCGGCGGGCgtaATGGGTGGTGGTGCCCATC EcpanE(H120A)-R ATTGCCGTCGCGGCGGGCTGCtgcGGTGGTGGTGCCCATCAGTAATG EcpanE(I183A)-R CCAGATGGCAGTCAGTGGATTtgcCACGCAGTTGACTGCCAG EcpanE(K176A)-R ACGCAGTTGACTGCCAGtgcGCGCCACAGCTCGGCGCGAATATTG EcpanE(N180A)-R CAGTGGATTAATCACGCAtgcGACTGCCAGCTTGCGCCAC EcpanE(N184A)-R CCAGATGGCAGTCAGTGGtgcAATCACGCAGTTGACTGCCAG EcpanE(N194A)-R GATGATGACGTAATTCACCtgcCGGGCAATTCCAGATGGC EcpanE(N241A)-R GATATCCTGCAACATCGACGAGATtgcTTCCGCTGTGGCATCAATC EcpanE(S243A)-R GATATCCTGCAACATCGAtgcGATATTTTCCGCTGTGGCATC EcpanE(T119A)-R ATTGCCGTCGCGGCGGGCTGCATGtgcGGTGGTGCCCATCAGTAATG EcpanE(T238A)-R GATATCCTGCAACATCGACGAGATATTTTCCGCtgcGGCATCAATCACCTGCATC EcpanE(V179A)-R TGGATTAATCACGCAGTTtgcTGCCAGCTTGCGCCAC EcpanE(V234A)-R TTCCGCTGTGGCATCAATtgcCTGCATCACGTAATCACGC EcpanE(T119c)-F TTACTGATGGGCACCACCtgcATGCAGCCCGCCGCGACGG EcpanE(T119d)-F TTACTGATGGGCACCACCgacATGCAGCCCGCCGCGACGG EcpanE(T119e)-F TTACTGATGGGCACCACCGAATGCAGCCCGCCGCGACGG EcpanE(T119f)-F TTACTGATGGGCACCACCttcCATGCAGCCCGCCGCGACGG EcpanE(T119g)-F TTACTGATGGGCACCACCggtATGCAGCCCGCCGCGACGG EcpanE(T119h)-F TTACTGATGGGCACCACCcacATGCAGCCCGCCGCGACGG EcpanE(T119i)-F TTACTGATGGGCACCACCatcCATGCAGCCCGCCGCGACGG EcpanE(T119k)-F TTACTGATGGGCACCACCaagCATGCAGCCCGCCGCGACGG EcpanE(T119l)-F TTACTGATGGGCACCACCctcCATGCAGCCCGCCGCGACGG EcpanE(T119m)-F TTACTGATGGGCACCACCatgCATGCAGCCCGCCGCGACGG EcpanE(T119n)-F TTACTGATGGGCACCACCaacATGCAGCCCGCCGCGACGG EcpanE(T119p)-F TTACTGATGGGCACCACCccgCATGCAGCCCGCCGCGACGG EcpanE(T119q)-F TTACTGATGGGCACCACCcagATGCAGCCCGCCGCGACGG EcpanE(T119r)-F TTACTGATGGGCACCACCcgaATGCAGCCCGCCGCGACGG EcpanE(T119s)-F TTACTGATGGGCACCACCtccCATGCAGCCCGCCGCGACGG EcpanE(T119V)-F TTACTGATGGGCACCACCgttCATGCAGCCCGCCGCGACGG EcpanE(T119W)-F TTACTGATGGGCACCACCtggCATGCAGCCCGCCGCGACGG EcpanE(T119Y)-F TTACTGATGGGCACCACCtacCATGCAGCCCGCCGCGACGG EcpanE119-R GGTGGTGCCCATCAGTAATGGCTG EcpanE(N241c)-F ATTGATGCCACAGCGGAAtgcATCTCGTCGATGTTGCAGG EcpanE(N241d)-F ATTGATGCCACAGCGGAAgacATCTCGTCGATGTTGCAGG EcpanE(N241e)-F ATTGATGCCACAGCGGAAgaaATCTCGTCGATGTTGCAGG EcpanE(N241f)-F ATTGATGCCACAGCGGAAttcATCTCGTCGATGTTGCAGG EcpanE(N241g)-F ATTGATGCCACAGCGGAAggtATCTCGTCGATGTTGCAGG EcpanE(N241h)-F ATTGATGCCACAGCGGAAcacATCTCGTCGATGTTGCAGG EcpanE(N241i)-F ATTGATGCCACAGCGGAAatcATCTCGTCGATGTTGCAGG EcpanE(N241k)-F ATTGATGCCACAGCGGAAaagATCTCGTCGATGTTGCAGG EcpanE(N241l)-F ATTGATGCCACAGCGGAActcATCTCGTCGATGTTGCAGG EcpanE(N241m)-F ATTGATGCCACAGCGGAAatgATCTCGTCGATGTTGCAGG EcpanE(N241p)-F ATTGATGCCACAGCGGAAccgATCTCGTCGATGTTGCAGG EcpanE(N241q)-F ATTGATGCCACAGCGGAAcagATCTCGTCGATGTTGCAGG EcpanE(N241r)-F ATTGATGCCACAGCGGAAcgaATCTCGTCGATGTTGCAGG EcpanE(N241s)-F ATTGATGCCACAGCGGAAtccATCTCGTCGATGTTGCAGG EcpanE(N241t)-F ATTGATGCCACAGCGGAAaccATCTCGTCGATGTTGCAGG EcpanE(N241v)-F ATTGATGCCACAGCGGAAgttATCTCGTCGATGTTGCAGG EcpanE(N241w)-F ATTGATGCCACAGCGGAAtggATCTCGTCGATGTTGCAGG EcpanE(N241y)-F ATTGATGCCACAGCGGAAtacATCTCGTCGATGTTGCAGG EcpanE(214)-R TTCCGCTGTGGCATCAATCACC EcpanE(243)-R GATATTTTCCGCTGTGGCATC EcpanE(S243c)-F GCCACAGCGGAAAATATCtgcTCGATGTTGCAGGATATCCG EcpanE(S243d)-F GCCACAGCGGAAAATATCgacTCGATGTTGCAGGATATCCG EcpanE(S243e)-F GCCACAGCGGAAAATATCgaaTCGATGTTGCAGGATATCCG EcpanE(S243f)-F GCCACAGCGGAAAATATCttcTCGATGTTGCAGGATATCCG EcpanE(S243g)-F GCCACAGCGGAAAATATCggtTCGATGTTGCAGGATATCCG EcpanE(S243h)-F GCCACAGCGGAAAATATCcacTCGATGTTGCAGGATATCCG EcpanE(S243i)-F GCCACAGCGGAAAATATCatcTCGATGTTGCAGGATATCCG EcpanE(S243k)-F GCCACAGCGGAAAATATCaagTCGATGTTGCAGGATATCCG EcpanE(S243l)-F GCCACAGCGGAAAATATCctcTCGATGTTGCAGGATATCCG EcpanE(S243m)-F GCCACAGCGGAAAATATCatgTCGATGTTGCAGGATATCCG EcpanE(S243n)-F GCCACAGCGGAAAATATCaacTCGATGTTGCAGGATATCCG EcpanE(S243p)-F GCCACAGCGGAAAATATCccgTCGATGTTGCAGGATATCCG EcpanE(S243q)-F GCCACAGCGGAAAATATCcagTCGATGTTGCAGGATATCCG EcpanE(S243r)-F GCCACAGCGGAAAATATCcgaTCGATGTTGCAGGATATCCG EcpanE(S243t)-F GCCACAGCGGAAAATATCaccTCGATGTTGCAGGATATCCG EcpanE(S243v)-F GCCACAGCGGAAAATATCgttTCGATGTTGCAGGATATCCG EcpanE(S243w)-F GCCACAGCGGAAAATATCtggTCGATGTTGCAGGATATCCG EcpanE(S243y)-F GCCACAGCGGAAAATATCtacTCGATGTTGCAGGATATCCG EcpanE(183)-R CACGCAGTTGACTGCCAGCTTG EcpanE(I183c)-F CTGGCAGTCAACTGCGTGtgcAATCCACTGACTGCCATCTG EcpanE(I183d)-F CTGGCAGTCAACTGCGTGgacAATCCACTGACTGCCATCTG EcpanE(I183e)-F CTGGCAGTCAACTGCGTGgaaAATCCACTGACTGCCATCTG EcpanE(I183f)-F CTGGCAGTCAACTGCGTGttcAATCCACTGACTGCCATCTG EcpanE(I183g)-F CTGGCAGTCAACTGCGTGggtAATCCACTGACTGCCATCTG EcpanE(I183h)-F CTGGCAGTCAACTGCGTGcacAATCCACTGACTGCCATCTG EcpanE(I183k)-F CTGGCAGTCAACTGCGTGaagAATCCACTGACTGCCATCTG EcpanE(I183l)-F CTGGCAGTCAACTGCGTGctcAATCCACTGACTGCCATCTG EcpanE(I183m)-F CTGGCAGTCAACTGCGTGatgAATCCACTGACTGCCATCTG EcpanE(I183n)-F CTGGCAGTCAACTGCGTGaacAATCCACTGACTGCCATCTG EcpanE(I183p)-F CTGGCAGTCAACTGCGTGccgAATCCACTGACTGCCATCTG EcpanE(I183q)-F CTGGCAGTCAACTGCGTGcagAATCCACTGACTGCCATCTG EcpanE(I183r)-F CTGGCAGTCAACTGCGTGcgaAATCCACTGACTGCCATCTG EcpanE(I183s)-F CTGGCAGTCAACTGCGTGtccAATCCACTGACTGCCATCTG EcpanE(I183t)-F CTGGCAGTCAACTGCGTGaccAATCCACTGACTGCCATCTG EcpanE(I183v)-F CTGGCAGTCAACTGCGTGgttAATCCACTGACTGCCATCTG EcpanE(I183w)-F CTGGCAGTCAACTGCGTGtggAATCCACTGACTGCCATCTG EcpanE(I183y)-F CTGGCAGTCAACTGCGTGtacAATCCACTGACTGCCATCTG pET28a-EcpanE-F AGAAGGAGATATACCATGGATGAAAATTACCGTATTGGGATG pET28a-EcpanE-R CTTTGTTAGCAGCCGGATCTCACCAGGGGCGAGGCAAAC pET28b-F GATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAG pET28b-R CCATGGTATATCTCCTTCTTAAAGTTAAAC

[0087] Example 1: Determination of the content of α-hydroxyvalerate (KIV), D-pantothenic acid (D-PA) and amino acids

[0088] The detection methods for KIV and D-pantothenic acid are as follows: Chromatographic conditions: C18 column (250×4.6 mm, particle size 5 μm, Agilent Technologies Co., Santa Clara, CA, USA); detection wavelength: 200 nm; column temperature: 30℃; flow rate: 1 ml / min; mobile phase: acetonitrile / water / phosphoric acid: (80 / 919 / 1); data acquisition time: 20 min. Sample preparation: Dilute the sample with ultrapure water to maintain the D-pantothenic acid content between 0.2 g / L and 1 g / L.

[0089] Example 2: Site Screening

[0090] Using the EcPanE crystal structure (PDB: 1KS9) derived from *E. coli* as a template, molecular docking of the protein and ligand coenzyme was performed using Autodock Vina, followed by visualization analysis using PyMOL. Figure 1 The diagram shows the binding of proteins to coenzymes and ligands. Amino acids within 10 Å of the substrate binding site were selected, and KB was predicted using the CatPred website. cat / K m Value, analyze larger K cat / K m The distribution of amino acids with the highest overall value (top 55%). For example... Figure 2 As shown, K predicted by different amino acid saturation mutations cat / K m Value. Select amino acids with higher average values ​​and analyze their distribution as follows: Figure 3 As shown, most of these amino acids were found to be located near the substrate-binding pocket, indicating that amino acids near the substrate binding pocket are important for substrate catalysis. Next, the conservation of amino acids in specific secondary structures near the active pocket was analyzed, and the conservation of their amino acid sequences was predicted using the WebLogo website. Figure 4As shown, most amino acids in these structures exhibit high conservation. Since these structures are closely related to substrate binding, this indicates that the relevant residues participate in or influence the enzyme's catalytic process of the substrate. Ketopantoacid dehydrogenase not only catalyzes the conversion of ketopantoacid but also competes with the D-pantothenic acid biosynthesis pathway for the common precursor α-ketoisovalerate. Compared to α-ketoisovalerate, ketopantoacid has an additional hydroxymethyl group, resulting in a longer and more complex molecule. Based on these results, a group of amino acids involved in forming the substrate pocket was further screened, including T119, H120, A121, K176, V179, N180, I183, N184, N194, V234, T238, N241, and S243. These selected amino acids happen to surround the hydroxymethyl and methyl groups of KPL, as shown in the image. Figure 5 As shown.

[0091] Example 3: Alanine Scan

[0092] The amino acid sites selected in Example 2 were scanned for alanine, where A121 is alanine, and saturation mutation was directly performed.

[0093] (1) Construction of plasmid pECXK99E-BspanBC-P 4-N14 -EcpanE(T119A) plasmid: Using pECXK99E plasmid as a template, amplification was performed using primers ECXK99E-F / pEXK99E-nolaq-R to obtain a linearized plasmid, which was named pEXK99E; using Bacillus subtilis 168 strain as a template, amplification was performed using primers RBS-BspanBCD-F / RBS-BspanC-R to obtain a fragment named BspanBC; using C. glutamicum ATCC 13032 strain as a template, amplification was performed using primers P4-N14RBS-F / P4-N14-T2ter-R to obtain a fragment named P 4-N14 Using *E. coli* strain as a template, and primers RBS-EcpanE-F / EcpanE(T119A)-R and EcpanE(119-121)-F / pECXK99E-EcpanE-R were used for amplification, and the obtained fragments were named EcpanE119-F and EcpanE119-R. The amplified PCR products were purified by gel extraction to obtain the purified fragments. Following the Clon Express® (One step clone kit, Vazyme Biotech, Nanjing, China) instructions, the fragments were ligated together and transformed into *E. coli* DH5α. After kanamycin plate selection and sequencing verification, the correct pECXK99E-BspanBC-P was obtained. 4-N14-EcpanE(T119A) plasmid (abbreviated as T119A);

[0094] (2) Construct other plasmids: Repeat step (1) of Example 3 to construct plasmids H120A, A121A, K176A, V179A, N180A, I183A, N184A, N194A, V234A, T238A, N241A, S243A;

[0095] (3) Preparation of competent cells of strain DPAg-15: A single colony of DPAj-2 was picked and placed in 10 mL of BHIS liquid medium and cultured at 30 °C and 100 r / min for about 10 h. 3 mL of the above culture solution was then inoculated into 100 mL of BHIS liquid medium and cultured at 30 °C and 200 rpm until OD. 600 ≈0.9 (approximately 5 h of culture); transfer the culture medium to sterile centrifuge tubes and incubate on ice for approximately 30 min, then centrifuge at 4°C, 4000 r / min for 10 min, discard the supernatant, and collect the bacterial cells; then add 30 mL of pre-chilled 10% glycerol solution to the bacterial cells, gently agitate in ice water to resuspend the cells, and centrifuge at 4°C, 4000 r / min for 10 min after complete resuscitation, discard the supernatant, and collect the bacterial cells. Wash the collected bacterial cells once more with pre-chilled 10% glycerol solution. Resuspend the collected bacterial cells in a certain amount of pre-chilled 10% glycerol solution, aliquot into 100 μL tubes, and store at -80°C. These are the electrocompetent cells, ready for use.

[0096] (4) Electroporate the plasmids constructed in Examples 3 (1) and (2) and the empty plasmid pEXK99E into the competent cells prepared in Example 3 (3): Take 2 μg of the plasmids prepared in steps (1) and (2) and 100 μL of the electroporation competent cells prepared in step (4), mix them, and transfer them into a 1 mm electroporation cuvette pre-cooled at 4 ℃. Incubate on ice for 1 min and perform electroporation transformation using an electroporator (Micro Pluser, BIO-RAD). After two consecutive electroporations, immediately add the medium to 1 mL of BHIS medium pre-cooled at 4 ℃ and immediately transfer it to a sterile 1.5 mL centrifuge tube. After recovery at 30 ℃ and 200 rpm for 2 h, spread it on a BHIS plate containing 25 μg / L kanamycin and incubate upside down at 30 ℃ for 48 h until single colonies appear.

[0097] (5) Shake-flask fermentation: The strains obtained in step (4), with the starting strain pEXK99E as the control group, were inoculated into 5 mL of BHIS medium and cultured at 30 ℃ and 200 rpm as pre-cultures. After 12 h-24 h, 2 mL of the pre-culture was inoculated into a 500 mL shake flask containing 50 mL of MS medium at a 4% inoculation rate. The flasks were then cultured in a constant temperature shaker at 30 ℃ and 200 rpm for 48 h for fermentation. After fermentation, 1 mL of the fermentation broth was taken to determine the OD. 600 Simultaneously, 1 mL of fermentation broth was pipetted and centrifuged at 12000 rpm for 3 min at room temperature. After removing impurities using an aqueous filter membrane, the sample was analyzed by HPLC according to Example 1. OD 600 and the formation of metabolites in the fermentation broth supernatant, such as Figure 3 As shown;

[0098] Depend on Figure 6 As can be seen, the mutants T119A, I183A, and S243A showed a slight increase in D-pantothenic acid production, indicating that mutations at these three sites favored the conversion of ketopantolytic acid. In contrast, the N241A mutant reduced D-pantothenic acid production but did not induce α-ketoisovaleric acid accumulation, while most other alanine substitutions reduced D-pantothenic acid production and left α-ketoisovaleric acid residues. Based on these results, four sites (T119, I183, S243, and N241) were selected for saturation mutation.

[0099] Fermentation medium: glucose: 30 g / L, ammonium sulfate: 16 g / L, corn steep liquor: 10 g / L, yeast extract: 2 g / L, KH₂PO₄: 0.8 g / L, MgSO₄: 0.5 g / L, sodium acetate: 5 g / L, β-alanine: 2 g / L, CaCO₃: 3 g / L, 1 mL / L trace element solution, solvent: deionized water, pH: natural. The trace element solution composition is: NiCl₂·7H₂O 0.02 g / L, CuCl₂ 10 g / L, FeSO₄·7H₂O 10 g / L, ZnSO₄·7H₂O 10 g / L, CuSO₄ 0.2 g / L, solvent: deionized water.

[0100] Example 4: Saturation Mutation

[0101] Saturation mutations were performed at five sites: T119, I183, S243, N241, and A121.

[0102] (1) Constructing a saturated mutant plasmid at the T119 site: Using the plasmid constructed in step (1) of Example 3 as a template, and using the corresponding primers, repeat the process of step (1) of Example 3 to construct a saturated mutant plasmid;

[0103] (2) Construct saturated mutant plasmids for the remaining 4 sites: Repeat step (1) of Example 4 to construct saturated mutant plasmids for the remaining 4 sites;

[0104] (3) Transform the plasmids constructed in steps (1) and (2) into competent cells of strain DPAg-15 prepared in step (3) of Example 3, and carry out shake-flask fermentation of the obtained strain. Repeat step (5) of Example 3.

[0105] Depend on Figure 7 It is evident that any mutation at the A121 site failed to increase yield; some variants even reduced D-pantothenic acid levels and led to the accumulation of α-ketoisovalerate, indicating that this site affects the enzyme's activity for both substrates. The mutant I183S showed a significant advantage in D-pantothenic acid production. In contrast, saturation mutations at the N241 or S243 sites failed to increase D-pantothenic acid production. Among the T119 variants, the mutant T119I showed the greatest improvement in D-pantothenic acid production. Two mutants with significant advantages, I183S and T119I, were identified.

[0106] Fermentation medium: glucose: 30 g / L, ammonium sulfate: 16 g / L, corn steep liquor: 10 g / L, yeast extract: 2 g / L, KH₂PO₄: 0.8 g / L, MgSO₄: 0.5 g / L, sodium acetate: 5 g / L, β-alanine: 2 g / L, CaCO₃: 3 g / L, 1 mL / L trace element solution, solvent: deionized water, pH: natural. The trace element solution composition is: NiCl₂·7H₂O 0.02 g / L, CuCl₂ 10 g / L, FeSO₄·7H₂O 10 g / L, ZnSO₄·7H₂O 10 g / L, CuSO₄ 0.2 g / L, solvent: deionized water.

[0107] Example 5: Iterative Mutation

[0108] The wild-type, single mutant, and iterative mutant identified in Example 4 were transformed into strain DPAj-2 to test their effects. Additionally, the activity of the wild-type and mutant strains on substrate-catalyzed enzymes was tested in *E. coli*.

[0109] (1) Construction of iterative saturation mutant plasmid: Using the mutant I183S constructed in Example 4 as a template, the iterative mutant plasmid I183S / T119I was constructed using the corresponding primers;

[0110] (2) Preparation of competent cells of strain DPAj-2: The operation process is the same as step (3) in Example 3;

[0111] (3) Electroporate wild-type, single-mutant, and iterative saturation mutant plasmids into DPAj-2 competent cells: repeat the procedure in Example 3 (4).

[0112] Depend on Figure 8 As can be seen, compared with the wild type, the D-pantothenic acid production of the two single mutants was significantly increased, with the production of the single mutant T119I increasing to 4.62 g / L and the production of the single mutant I183S increasing to 5.08 g / L. The production of the iterative double mutants, however, decreased, and precursor substances were observed, indicating that the coupling effect of the double mutants was poor.

[0113] Example 6: Assay of substrate catalytic enzyme activity in wild-type and mutant Escherichia coli

[0114] The above determined the dominant single mutants and tested their catalytic effects on substrates in E. coli.

[0115] (1) Plasmid construction: Using the pet28a plasmid (Plasmid #141289) as a template, the linearized plasmid pet28a was amplified using pET28b-F / pET28b-R; using the mutant I183S or T119I constructed in Example 4 as a template, the fragment I183S was amplified using pET28a-EcpanE-F / pET28a-EcpanE-R as primers. Repeat step (1) of Example 3 to construct the plasmids of pet28a-panE (I183S) or pet28a-panE (T119I) and the wild-type Escherichia coli BL21 competent cells pet28a-panE;

[0116] (2) Preparation of Escherichia coli BL21 competent cells: Activate Escherichia coli BL21 strain, pick a single colony of BL21 from a fresh LB plate that has been cultured overnight at 37 ℃, and inoculate it into 3 mL of LB liquid medium. Incubate overnight at 37 ℃ with shaking at 200 r / min. Take 1 mL of the overnight culture and inoculate it into 100 mL of liquid LB medium. Incubate at 37 ℃ with shaking at 200 r / min until D600 nm = 0.3-0.5 (about 3 h). Transfer the culture medium to a sterile 50 mL centrifuge tube and place it on ice for 10 min. Centrifuge at 4 ℃ and 6000 r / min for 5 min and discard the supernatant. Resuspend the bacterial cells in 10 mL of pre-cooled sterile TSS. Place on ice for 10 min, dispense 120 μL / tube (operate on ice), and store at -80 ℃ for later use.

[0117] (3) Transformation: Take competent BL21(DE3) cells and thaw them in an ice bath. After thawing, add 50 ng of the plasmid constructed in step (1), gently tap the bottom of the tube about 2-3 times to mix, and immediately place it in an ice bath for 30 minutes. Then, quickly place the centrifuge tube in a 42°C water bath and heat shock it for 45 seconds. Immediately transfer it to an ice-water bath and let it cool rapidly to near zero degrees Celsius for 2 minutes. Add 900 μl of antibiotic-free LB liquid medium, invert several times to mix, and revive it in a shaker at about 150 rpm at 37°C for 1 hour. Then, centrifuge at about 5000×g at room temperature for 1 minute to precipitate the bacteria. Aspirate about 950 μl of supernatant, leaving about 50 μl of supernatant. Gently pipette and resuspend the bacteria, then spread it on an LB plate containing kanamycin (final concentration 50 μg / mL) and incubate it upside down in a 37°C incubator overnight. The single colony on the plate is the desired strain.

[0118] (4) Induction of bacterial expression: Take a single colony from step (3) and incubate it overnight at 37°C and 220 rpm in LB liquid medium containing kanamycin (final concentration 50 μg / mL). Transfer the bacterial culture to 100 mL of LB liquid medium at an inoculation rate of 1% (V / V) and incubate it at 37°C and 220 rpm. Measure the bacterial OD using a UV spectrophotometer. 600 Value, cultured to OD 600 The initial concentration was approximately 0.6, and 0.5 mM IPTG was added for induction. Induction was performed at 30℃ and 150 rpm for 16 h. After induction, the bacterial OD was recorded. 600 .

[0119] (5) Collection of bacterial strains: Pour the induced fermentation cells into a 50 mL centrifuge tube, centrifuge at 6000 rpm and 4℃ for 6 min; after centrifugation, discard the supernatant, collect the bacterial cells, add 20 mL of PBS buffer to the collected bacterial cells to completely suspend the bacterial cells, centrifuge at 6000 rpm and 4℃ for 6 min; after centrifugation, discard the supernatant and collect the bacterial cells.

[0120] (6) Substrate-catalyzed enzyme activity test: 20 g / L bacterial culture, 5 g / L ketopantolytic acid, 5 mM NADPH and 20 mM Tris-HCl buffer (pH 7.0). D-Pantholytic acid was prepared by reacting at 30°C and 200 rpm for 5 h; 100 μl of the reaction solution was taken and the reaction was terminated in 20 μl HCl (6M); the reaction solution was filtered through a 0.22 μm organic filter membrane, and the ketopantolytic acid content was detected by high performance liquid chromatography (HPLC). Enzyme activity was tested on mutants and wild types. One unit of enzyme activity (U) is defined as the amount of enzyme required to catalyze the conversion of 1 μmol of substrate (ketopantolytic acid) per minute under specified conditions (30°C, pH 7.0). Enzyme activity was determined by measuring the amount of ketopantolytic acid consumed.

[0121] LB medium (1 L): 10.0 g tryptone (OXCID); 5.0 g yeast extract (OXCID); 5.0 g NaCl; add deionized water to a final volume of 1000 mL, autoclave at 121 °C for 20 min. Add 2% agar when preparing the solid medium.

[0122] Transformation and Storage Solution (TSS): Liquid LB medium, pH adjusted to 6.5, containing 10% PEG3350, 5% dimethyl sulfoxide (DMSO), 10% glycerol, MgCl2 10 mmol / L, MgSO4 10 mmol / L, autoclaved.

[0123] Depend on Figure 9 As can be seen, the specific activity of the wild type was 1.34 U / g, while the specific activities of the T119I and I183S mutants were 1.84 U / g and 3.01 U / g, respectively. Specifically, the activity of T119I was 1.84 times that of the wild type, while the activity of I183S was 2.25 times higher. These results further indicate that these mutations are more favorable for substrate catalysis compared to the wild type.

[0124] Example 7: Mutant Structure Analysis

[0125] The spatial structures of the two mutants were simulated using the SWISS-MODEL website and AlphaFold. Molecular docking of the protein and ligand coenzyme was performed using AutodockVina, and PyMOL was used for visualization analysis. The substrate channels were calculated using Caver Dock, and the area of ​​the protein active pocket was calculated using ProteinsPlus.

[0126] Depend on Figure 10 As can be seen from the root mean square deviation (RMSD) results, the enzyme-product complex reached stability after 20 ns, and the equilibrium structure was subsequently extracted to analyze the binding mode of the active site. Figure 11 This study analyzed the differences between wild-type and mutants (T119I, I183S) in the catalytic process of KPL. The results showed that the mutants had a more stable catalytic environment than the wild-type, with shorter distances between the substrate and key catalytic residues (such as Lys176) and the coenzyme NADPH, which facilitates rapid proton transfer and accelerates the catalytic reaction. Furthermore, the mutants had larger active pockets, especially I183S, which is more suitable for binding to the large substrate KPL. Tunneling analysis (CAVER) indicated that the substrate channel length and distance to the protein surface of I183S were both shorter than those of the wild-type, facilitating substrate entry and product release. Taken together, these structural features explain why I183S exhibits the highest enzyme activity.

[0127] Example 8: Fermentation test containing mutant engineered strains

[0128] The strain containing the single mutant I183S in step (3) of Example 5 was tested in a fermenter.

[0129] (1) Fermentation tank test: Fresh single colonies from the plate were inoculated into BHIS test tube medium containing 25 mg / L kanamycin resistance and 12 mg / L chloramphenicol resistance, and cultured at 30℃ for 18 h as seed culture; 5% by volume was inoculated into BHIS medium and cultured at 30℃ for 12 h as seed culture for the upper tank; the seed culture from the upper tank was inoculated into the fermentation tank containing fermentation medium at 10% by volume, and fermented at 30℃, 400 rpm, and an aeration rate of 1.0 V / V·min, with dissolved oxygen controlled at 20%~40%. Constant feed rate was used to keep the glucose concentration below 5 g / L, and fermentation was continued for 63 h to obtain fermentation broth containing D-pantothenic acid.

[0130] The fermentation medium consisted of: glucose 40 g / L, ammonium sulfate 20 g / L, corn steep liquor 20 g / L, yeast extract 2 g / L, KH₂PO₄ 0.8 g / L, MgSO₄ 0.5 g / L, sodium acetate 5 g / L, β-alanine 10 g / L, CaCO₃ 3 g / L, and a 1 mL / L trace element solution in deionized water at a natural pH. The trace element solution composition was: NiCl₂·7H₂O 0.02 g / L, CuCl₂ 10 g / L, FeSO₄·7H₂O 10 g / L, ZnSO₄·7H₂O 10 g / L, CuSO₄ 0.2 g / L in deionized water. The feed medium consists of 500 g / L glucose, 20 g / L (NH4)2SO4, 1 g / L MgSO4, and 40 g / L β-alanine, dissolved in deionized water and adjusted to pH 6.8 with 50% ammonia.

[0131] Depend on Figure 12 It can be seen that D-pantothenic acid was produced at a rate of 36.12 g / L in 63 hours, with a yield of 0.45 g / L / h and a conversion rate of 0.178 g / g. Its highest OD value was... 600 It reached 101.4.

[0132] In summary, this invention first functionally characterizes endogenous CgPanE and BsPanE2 as primarily α-hydroxy acid dehydrogenases, rather than ketopantoacid reductases; while heterologous EcPanE and BsPanE possess larger active cavities and exhibit bifunctionality for both ketoisovaleric acid and ketopantoacid. We employed a stationary promoter (P4-N14) to delay ketopantoacid reductase expression, thereby reducing precursor consumption. Through screening using various strategies, specific amino acids for alanine scanning and saturation mutagenesis were identified, yielding two beneficial mutants: T119I and I183S. The I183S mutant exhibited a specific activity 2.25 times higher than the wild type. Molecular dynamics simulations showed that these mutations improved catalytic efficiency by providing a more stable catalytic environment, tighter binding to the catalytic unit, enlarged active cavities, and shortened substrate channel length. The final engineered strain achieved a DPA yield of 36.12 g / L in a 5 L bioreactor. This study establishes a robust foundation for sustainable DPA production and provides a generalizable framework for the engineering modification of other valuable biochemicals.

[0133] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications listed herein, as well as variations in the methods and compositions of the invention, will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.

Claims

1. A method for constructing a ketopantolate dehydrogenase mutant that produces high levels of D-pantothenic acid, characterized in that, Includes the following steps: Step 1: Using the EcPanE crystal structure PDB: 1KS9 from E. coli as a template, the protein crystal was combined with the substrate ketopanolic acid and the coenzyme NADPH through molecular docking technology. Step 2: Screen amino acids within 10 Å of the substrate binding pocket, predict the corresponding Kcat / Km values ​​of these amino acids, and analyze K. cat / K m Values ​​were selected based on the amino acid distribution that ranked in the top 55% overall. Step 3: Based on the amino acids in Step 2, select amino acids from specific secondary structures near the substrate binding pocket and predict the conservation of the amino acid sequence; Step 4: From the amino acids in Step 3, select the amino acids that encapsulate the hydroxymethyl group and the two methyl groups of ketopantolytic acid and perform an alanine scan; the amino acids include T119, H120, A121, K176, V179, N180, I183, N184, N194, V234, T238, N241 and S243; Step 5: Perform saturation mutations on the sites T119, I183, S243, N241 and A121 that showed relatively significant alanine scanning effects in Step 4, and screen to obtain the target mutants I183S and T119I.

2. The construction method according to claim 1, characterized in that, Step 5 is performed as follows: (1) Using plasmid pECXK99E as a template, the gene cluster BspanBC from Bacillus subtilis 168 and the promoter P from C. glutamicum ATCC 13032 were cloned in one step. 4-N14 The ketoplasmin dehydrogenase alanine scanning mutant was ligated to obtain a series of recombinant expression plasmids; (2) The obtained recombinant expression plasmid was electroporated into competent cells of strain DPAg-15, and the recombinant strain after transformation was tested by shake flask fermentation. The synthesis yield of D-pantothenic acid and the accumulation level of by-product α-ketoisovalerate were used as dual screening indicators to screen out four key functional sites that have the most significant impact on the synthesis of the target product, namely T119, I183, S243 and N241. (3) Saturation mutations were performed on site A121 and sites T119, I183, S243 and N241 obtained in step (2) to obtain the best and second best mutants for improving D-pantothenic acid production, namely mutant I183S and mutant T119I. (4) The mutants I183S and T119I were transformed into competent cells of strain DPAj-2. The production stability of the transformed recombinant strain was verified by shake-flask fermentation. Finally, the mutants I183S and T119I were confirmed as the target mutants.

3. The construction method according to claim 1, characterized in that, Step 5 is followed by steps to verify the catalytic activity of the target mutant and to elucidate its molecular mechanism, specifically including: The mutants I183S and T119I were constructed on plasmid pET28a and transformed into E. coli BL21(DE3) competent cells. After heterologous expression, the catalytic activities of each enzyme on the substrate ketopantolytic acid were tested and compared. The spatial structures of mutants I183S and T119I were simulated using the SWISS-MODEL website and AlphaFold, respectively. Molecular docking of the protein and ligand coenzyme was performed using Autodock Vina, and the docking results were visualized and analyzed using PyMOL. Furthermore, substrate channel parameters of the mutants were calculated using Caver Dock, and the area of ​​the protein active pocket was calculated using ProteinsPlus to elucidate the mechanism by which the mutation affects enzyme catalytic performance.

4. The construction method according to claim 3, characterized in that, The nucleotide sequence of EcpanE from E. coli is shown in SEQ ID NO.1; the nucleotide sequence of the gene cluster BspanBC from Bacillus subtilis 168 is shown in SEQ ID NO.2; The nucleotide sequence of promoter P4-N14 from Corynebacterium glutamicum ATCC 13032 is shown in SEQ ID NO.

3.

5. The ketopantolytic acid dehydrogenase mutant obtained by the construction method according to any one of claims 1-4.

6. The use of the ketopantolysin dehydrogenase mutant according to claim 5 in the preparation of D-pantothenic acid.

7. A genetically engineered bacterium that produces high levels of D-pantothenic acid, comprising the ketopantothenic acid dehydrogenase mutant of claim 5.

8. The use of the genetically engineered bacteria according to claim 7 in the preparation of D-pantothenic acid.

9. The application according to claim 8, characterized in that, The application involves inoculating the genetically engineered bacteria into a fermentation medium and fermenting it at 30°C and 200 rpm for 48-60 h. After fermentation, the supernatant of the fermentation broth is collected, separated, and purified to obtain the D-pantothenic acid. The fermentation medium consists of the following components: glucose: 10-30 g / L, corn steep liquor: 10-20 g / L, ammonium sulfate: 10-20 g / L, yeast extract: 1-5 g / L, KH₂PO₄: 0.2-1 g / L, MgSO₄: 0.5-5 g / L, sodium acetate: 5-8 g / L, β-alanine: 0.5-2 g / L, CaCO₃: 3-5 g / L, and a 0.5-2 mL / L trace element solution in deionized water at a natural pH. The trace element solution consists of: NiCl₂·7H₂O 0.02 g / L, CuCl₂ 10 g / L, FeSO₄·7H₂O 10 g / L. The concentrations of the following ingredients were: g / L ZnSO4·7H2O 10 g / L, CuSO4 0.2 g / L, and the solvent was deionized water.

10. The application according to claim 7, characterized in that, The application is a method for determining the catalytic activity of ketopantolytic acid dehydrogenase mutants, comprising the following steps: (1) Induction of bacterial expression: The genetically engineered bacteria were inoculated into LB liquid medium containing a final concentration of 50 μg / mL kanamycin and cultured overnight at 37°C and 220 rpm; the bacterial culture was then transferred to 100 mL of LB liquid medium at a volume fraction of 1% and cultured at 37°C and 220 rpm until OD was obtained. 600 Once the concentration reached 0.6, a final concentration of 0.5 mM IPTG was added for induction; induction was performed at 30℃ and 150 rpm for 16 h. (2) Collection of bacterial strains: After induction, centrifuge, discard the supernatant, collect the bacterial cells, add 20 mL of PBS buffer to the collected bacterial cells to completely suspend the bacterial cells, centrifuge at 6000 rpm and 4℃ for 6 min; after centrifugation, discard the supernatant and collect the bacterial cells; the composition of the induction medium is as follows: 10.0 g of peptone, 5.0 g of yeast extract, 5.0 g of NaCl, and deionized water as the solvent, and bring the volume to 1000 mL; (3) Substrate-catalyzed enzyme activity test: 20 g / L bacterial culture, 5 g / L ketopantolytic acid, 5 mM NADPH and 20 mM Tris-HCl buffer (pH 7.0); D-pantolytic acid was prepared by reacting at 30°C and 200 rpm for 5 h. 100 μL of the reaction solution was taken and the reaction was terminated in 20 μL HCl (6 M); the reaction solution was filtered using a 0.22 μm organic filter membrane, and the ketopantolytic acid content was detected by high performance liquid chromatography, and the enzyme activity was calculated; one enzyme activity unit (U) is defined as the amount of enzyme required to catalyze the conversion of 1 μmol of substrate (ketopantolytic acid) per minute under specified conditions (30°C, pH 7.0); enzyme activity was determined by measuring the amount of ketopantolytic acid consumed.

Citation Information

Patent Citations

  • Genetically engineered bacterium for producing D-pantothenic acid based on corynebacterium glutamicum CPSPC system as well as construction method and application of genetically engineered bacterium

    CN121825841A