A zearalenone-degrading enzyme mutant and application thereof

Abstract

The present application relates to the technical field of genetic engineering and protein engineering, and specifically provides a zearalenone degrading enzyme mutant and application thereof.The zearalenone degrading enzyme mutant contains a V158I single mutation site, and the specific activity is significantly higher than that of the wild type, which is conducive to the wide application of the zearalenone degrading enzyme mutant in detoxification treatment in the fields of feed, food processing, aquaculture and the like.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and protein engineering, specifically to a zearalenone-degrading enzyme mutant and its applications. Background Technology

[0002] Zearalenone (ZEN), also known as F-2 toxin, is one of the most serious and widely distributed mycotoxins in agricultural products and their processed products. Primarily produced by Fusarium, it is characterized by high stability, widespread contamination, and long-lasting harmful effects, posing a long-term risk to food safety and livestock production. ZEN's chemical structure is highly similar to estradiol, allowing it to bind to estrogen receptors on animal cell membranes, exhibiting significant estrogenic activity and thus exerting toxic effects on the reproductive and developmental systems, seriously threatening human and animal health.

[0003] ZEN causes significant economic losses and seriously threatens the health of humans and animals, making the development of rapid and efficient ZEN detoxification methods crucial. Current research categorizes ZEN detoxification methods into physical methods (e.g., high-temperature treatment, pressure treatment, and adsorbent adsorption), chemical methods (e.g., acid-base treatment), and biological methods (e.g., microbial degradation and enzymatic degradation). However, traditional physical and chemical detoxification methods have limitations, such as potential damage to the nutritional components of grains and feed, or secondary pollution due to chemical residues. In contrast, biological detoxification methods offer milder reaction conditions, are environmentally friendly, and economically viable, attracting widespread attention. With the continuous advancement of biotechnology and molecular biology research, an increasing number of microbial resources and key enzymes capable of degrading ZEN have been discovered, successfully cloned, and expressed. In 2002, ZHD101 was isolated from *Clonostachys rosea* IFO 7063 by TAKAHASHI-ANDO et al. In 2014, researchers successfully resolved the crystal structure of ZHD101, clarifying its mechanism of ZEN degradation. Under the action of ZHD101, ZEN first undergoes a lactone ring hydrolysis reaction, generating the hydrolysis intermediate HZEN; subsequently, HZEN undergoes further decarboxylation, releasing CO2, and finally forming the degradation product DHZEN. Thus, the degradation mechanism of ZEN by ZHD101 mainly involves catalyzing the opening of its lactone ring and further decarboxylation, thereby destroying ZEN's original key toxic structures. This discovery laid the molecular foundation for subsequent research. With the continuous advancement of related technologies, more and more ZEN degrading enzymes have been discovered and studied. However, the types of ZEN degrading enzymes reported so far are still relatively limited, making it difficult to meet the needs of industrial and food processing industries. Furthermore, most existing ZEN degrading enzymes lack sufficient thermal stability and are easily inactivated at high temperatures, making them unsuitable for industrial processes such as feed and food processing. Therefore, further screening and development of more ZEN degrading enzymes suitable for industrial production remains an important research direction in this field.

[0004] Zearalenone-degrading enzymes, as an emerging biological detoxification tool, possess numerous advantages such as specificity, high efficiency, safety, and sustainability. They are of great significance in ensuring food security, improving livestock productivity, and promoting green agricultural development, and represent a biotechnology direction with great development potential. Summary of the Invention

[0005] To address the problems of existing technologies, this invention provides a mutant of zearalenone-degrading enzyme. The specific activity of this mutant is significantly higher than that of the wild type, thereby helping to reduce the production cost of the enzyme and promoting its widespread application in detoxification treatments in feed, food processing, aquaculture, and other fields.

[0006] One aspect of this invention relates to a mutant of zearalenone-degrading enzyme, wherein the mutant is a zearalenone-degrading enzyme with the amino acid sequence SEQ ID NO:1 in which the 158th amino acid is mutated from Val to Ile.

[0007] The present invention also relates to a DNA molecule encoding the above-mentioned zearalenone-degrading enzyme mutant.

[0008] The present invention also relates to recombinant expression plasmids comprising the above-described DNA molecules.

[0009] The present invention also relates to a host cell comprising the above-described recombinant expression plasmid.

[0010] When the above plasmids were transferred into host cells, the specific activity of the recombinant expressed zearalenone-degrading enzyme mutant was significantly improved.

[0011] The host cell is Pichia pastoris ( Pichia pastoris ).

[0012] This invention also relates to the application of the zearalenone-degrading enzyme mutant in feed or food production. Compared with wild-type zearalenone degrading enzyme Y1, the zearalenone degrading enzyme containing a single V158I mutation site provided by this invention has a 58.18% higher specific activity, reaching 13882 U / mg. This is beneficial for reducing the production cost of the enzyme and promoting its widespread application in detoxification treatment in feed, food processing, aquaculture and other fields. Detailed Implementation

[0013] This invention discloses a zearalenone-degrading enzyme mutant, its preparation method and application, the DNA molecule encoding the zearalenone-degrading enzyme mutant, the vector, and the host cell. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0014] This invention utilizes conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in *MOLECULAR CLONING: A LABORATORY MANUAL, 3rd Ed.* (Sambrook, 2001) and *CURRENTPROTOCOLS IN MOLECULAR BIOLOGY* (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can utilize other conventional methods, experimental protocols, and reagents based on the technical solutions described in this invention, without being limited to the specific embodiments of this invention.

[0015] For example, the following experimental materials and reagents may be used in this invention: Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vector pPIC9k, Amp, and G418 were purchased from Invitrogen.

[0016] Enzymes and kits: PCR enzymes and ligases were purchased from Takara, restriction endonucleases from Fermentas, plasmid extraction kits and gel purification and recovery kits from Omega, and GeneMorph II random mutagenesis kits from Beijing Bomais Biotechnology Co., Ltd.

[0017] The culture medium formula is as follows: Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0; Yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose; Yeast selection medium (MD medium): 2% peptone, 2% agarose; BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4 × 10⁻⁶ ppm -5 1% Biotin, 1% Glycerin; BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4 × 10⁻⁶ ppm -5 % Biotin, 0.5% Methanol; LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0; LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0.

[0018] The present invention will be further illustrated below with reference to the embodiments: Example 1 Construction of recombinant plasmid The source is from pink broom mold ( Clonostachysrosea The zearalenone-degrading enzyme gene of *Pichia pastoris* was optimized based on codon bias, with the addition of 6 bases GAATTC (EcoR I restriction site) before its start codon ATG and GCGGCCGC (Not I restriction site) after its stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Biotechnology Co., Ltd., named Y1, with its amino acid sequence SEQ ID NO: 1 and encoding nucleotide sequence SEQ ID NO: 2.

[0019] The zearalenone-degrading enzyme Y1 gene was digested with restriction endonucleases EcoRI and Not I (Fermentas); simultaneously, plasmid pPIC9K was digested with the same restriction endonucleases EcoRI and Not I. The digestion products were purified using a gel purification kit, and the two digestion products were ligated using T4 DNA ligase (Fermentas). The ligation products were transformed into DH5α *E. coli* (Invitrogen), and selection was performed using ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen).

[0020] The plasmid was purified from the correctly sequenced E. coli clone using the Plasmid Mini-Preparation Kit (Omega) to obtain one recombinant plasmid, named pPIC9K-Y1.

[0021] Example 2 Screening of high specific activity mutants To further improve the enzyme activity of zearalenone-degrading enzyme Y1, the applicant conducted protein structure analysis. A large number of mutants of this enzyme were screened using directed evolution technology.

[0022] 2.1 Design of PCR primers Primer 1(F): GCGC GAATTC ATGAGAACTCGCAGTACTATTTCTA; Primer 1(R): TAAA GCGGCCGC TTACAAATGCTTTTGAGTAGTTTCA.

[0023] Using the Y1 gene (SEQ ID NO: 2) as a template, PCR amplification was performed using the above primers with the GeneMorph II random mutagenesis PCR kit (Bomais). The PCR product was recovered from the gel, digested with EcoRI and NotI, and then ligated into the pET21a vector digested with the same enzymes. The ligation product was then transformed into Escherichia coli BL21(DE3), plated on LB-Amp plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one with a toothpick and transferred to a 96-well plate. 150 μL of LB-Amp medium containing 0.1 mM IPTG was added to each well. The plate was incubated at 37°C and 220 rpm for about 6 h. After centrifugation, the supernatant was discarded, and the cells were resuspended in buffer. The cells were repeatedly frozen and thawed to break up the cell walls and obtain Escherichia coli cell lysate containing zearalenone degrading enzyme.

[0024] 2.2 Determination of enzyme activity levels and protein content Take 30 μL of lysis buffer into two new 96-well plates. Add 30 μL of substrate to one 96-well plate and react at 37 °C for 30 min. Then, determine the reducing sugar produced by the DNS method. Add 150 μL of Coomassie Brilliant Blue solution to the other plate and let it stand for 10 min. Then, determine the protein content by the Coomassie Brilliant Blue (Bradford) binding method. Calculate the enzyme activity level and protein content of different mutants.

[0025] Experimental results showed that some mutations had no effect on the specific activity of zearalenone-degrading enzyme Y1, while others even reduced its specific activity. Ultimately, based on the aforementioned wild-type zearalenone-degrading enzyme Y1, the applicant screened and obtained a mutation site that significantly increased the specific activity: V158I.

[0026] Example 3 Expression of zearalenone-degrading enzyme in Pichia pastoris 3.1 Construction of expression plasmids Based on the codon preference of Pichia pastoris, the gene sequences of zearalenone degrading enzyme Y1 and its mutants were optimized and synthesized by Shanghai Jierui Biotechnology Co., Ltd., with EcoRI and NotI restriction sites added at the 5' and 3' ends of the synthesized sequences, respectively.

[0027] Following the method described in Example 1, the gene sequences of the synthesized zearalenone degrading enzyme Y1 and its mutants were digested with EcoRI and NotI, respectively. Then, they were ligated with the pPIC-9K vector, which had been digested with the same enzymes, overnight at 16°C, and transformed into E. coli DH5α. The transformed samples were plated on LB-Amp plates and incubated upside down at 37°C. After the transformants appeared, colony PCR was performed (reaction system: single clones picked from the template, rTaq DNA polymerase 0.5 μL, 10× Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5' AOX primer (10 mM) 0.5 μL, 3' AOX primer 0.5 μL, ddH2O 14.5 μL, reaction program: 95°C pre-denaturation for 5 min, 30 cycles: 94°C for 30 sec, 55°C for 30 sec, 72°C for 2 min, 72°C for 10 min). The positive clone was verified, and the correct recombinant expression plasmid was obtained after sequencing.

[0028] 3.2 Construction of Pichia pastoris engineered strains 3.2.1 Preparation of competent yeast cells Pichia pastoris strain GS115 was activated on YPD plates and cultured at 30°C for 48 h. Afterward, a single activated GS115 colony was inoculated into 6 mL of YPD medium and cultured at 30°C and 220 rpm for approximately 12 h. The culture was then transferred to an Erlenmeyer flask containing 30 mL of YPD medium and cultured at 30°C and 220 rpm for approximately 5 h. Cell density was measured using a UV spectrophotometer, and the OD value was determined as follows. 600 After the value is in the range of 1.1~1.3, centrifuge at 4℃ and 9000 rpm for 2 min to collect 4 mL of bacterial cells into sterile EP tubes. Gently discard the supernatant, blot the remaining supernatant with sterile filter paper, and resuspend the bacterial cells in 1 mL of pre-cooled sterile water. Centrifuge at 4℃ and 9000 rpm for 2 min, gently discard the supernatant, wash once more with 1 mL of sterile water, centrifuge at 4℃ and 9000 rpm for 2 min, gently discard the supernatant, and resuspend the bacterial cells in 1 mL of pre-cooled sorbitol (1 mol / L). Centrifuge at 4℃ and 9000 rpm for 2 min, gently discard the supernatant, and gently resuspend the bacterial cells in 100~150 μL of pre-cooled sorbitol (1 mol / L).

[0029] 3.2.2 Conversion and Screening The recombinant expression plasmids constructed in 3.1 were linearized with Sac I. After purification and recovery of the linearized fragments, they were transformed into Pichia pastoris GS115 by electroporation. Recombinant Pichia pastoris strains were screened on MD plates, and multi-copy transformants were then screened on YPD plates (0.5 mg / mL~8 mg / mL) containing different concentrations of genimycin.

[0030] The obtained transformants were transferred to BMGY medium and cultured at 30℃ and 250 rpm for 1 day with shaking. They were then transferred to BMMY medium and cultured at 30℃ and 250 rpm with shaking. 0.5% methanol was added daily to induce expression for 4 days. The cells were removed by centrifugation at 9000 rpm for 10 min to obtain fermentation supernatants containing zearalenone degrading enzyme Y1 and zearalenone degrading enzyme mutant, respectively. The enzyme activity and protein content of zearalenone degrading enzyme in the supernatants were determined, and the specific activity was calculated.

[0031] 1. Method for determining the enzyme activity of zearalenone-degrading enzyme (1) Definition of enzyme activity unit The amount of enzyme required to degrade 1 pmol ZEN per minute at pH 7.0 and 37°C is one unit of enzyme activity (U / g or U / mL).

[0032] (2) Sample processing methods Liquid samples: Centrifuge and collect the supernatant, which can be used directly for subsequent determinations.

[0033] (3) Experimental steps of enzyme reaction Table 1. Enzyme Reaction Experimental Procedures and Reaction System

[0034] Note: When performing enzyme reaction tests, you can first accurately take 45 mL of buffer solution (0.02 M citrate - 0.04 M disodium hydrogen phosphate, pH=7.0) and mix it with 2.5 mL of ZEN standard stock solution (50 μg / mL) (i.e., 18:1), and then accurately measure 1.9 mL to reduce the test deviation.

[0035] (4) Enzyme activity calculation method .

[0036] In the formula: U represents enzyme activity, U / mL; F represents the dilution factor; C 对 ZEN concentration (ppb) in the control group; C 测 ZEN concentration in the experimental group, ppb; V represents the sampling volume, in mL.

[0037] 2. Protein content determination method The enzyme solution and Coomassie Brilliant Blue solution were mixed at a volume ratio of 1:5, allowed to stand for 10 minutes, and then the protein content was determined using the Coomassie Brilliant Blue (Bradford) binding method. 3. Calculation of specific vitality "Specific Activity" refers to the number of enzyme activity units per unit weight of protein, usually expressed as U / mg protein.

[0038] Specific activity calculation formula: Specific activity (U / mg) = enzyme activity (U / mL) / protein content (mg / mL).

[0039] The specific calculation results are shown in Table 2.

[0040] Table 2 Comparison of specific activities of zearalenone-degrading enzymes and their mutants Wild type Y1 8776 V158I single-point mutant 13882 As can be seen from the results in Table 2, compared with the wild-type zearalenone degrading enzyme Y1, the zearalenone degrading enzyme mutant containing the V158I single-point mutation provided by this invention has a specific activity increased by 58.18%, reaching 13882 U / mg, achieving unexpected technical results.

[0041] In summary, the specific activity of the zearalenone-degrading enzyme mutant provided by this invention is significantly improved, which helps to reduce the production cost of the enzyme and promotes its widespread application in detoxification treatment in feed, food processing, aquaculture and other fields.

Claims

1. A mutant of zearalenone-degrading enzyme, characterized in that, The mutant is the zearalenone degrading enzyme with the amino acid sequence SEQ ID NO:1, in which the 158th amino acid is mutated from Val to Ile.

2. A DNA molecule encoding the zearalenone-degrading enzyme mutant of claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid as described in claim 3; the host cell is Pichia pastoris ( Pichia pastoris ).

5. The application of the zearalenone-degrading enzyme mutant of claim 1 in feed production.

6. The application of the zearalenone-degrading enzyme mutant of claim 1 in food production.

Images