A gene editing system targeting lipc and applications thereof

Abstract

The present disclosure belongs to the field of biological medicine and gene editing technology, and particularly relates to a gene editing system targeting LIPC gene and application thereof. The gene editing system targeting LIPC gene of the present disclosure targets the adenine at the codon of the 97th amino acid of the LIPC gene and replaces it with guanine in a manner without generating DNA double-strand break through adenine base editing (ABE) or prime editing (PE), so as to introduce a protective variation of mutating the 97th amino acid of the encoded hepatic lipase from glutamic acid to glycine (E97G).

Description

Technical Field

[0001] This disclosure belongs to the field of biomedicine and gene editing technology, specifically relating to a gene editing system targeting the LIPC gene and its application. Background Technology

[0002] Atherosclerotic cardiovascular disease is one of the leading causes of death and disability worldwide, and its development is generally considered to be closely related to plasma lipid metabolism disorders. Among the various factors related to lipid metabolism, elevated circulating cholesterol levels, especially low-density lipoprotein cholesterol (LDL-C), are often considered an important risk factor for atherosclerosis; while high-density lipoprotein cholesterol (HDL-C)-mediated reverse cholesterol transport is generally considered to be associated with cardiovascular protection. Therefore, intervention in key genes involved in lipid metabolism regulation is considered one of the potential strategies for treating or preventing hypercholesterolemia and atherosclerotic cardiovascular disease.

[0003] The LIPC gene encodes hepatic lipase (HL), which is primarily expressed in the liver and is a key enzyme in lipid metabolism. Hepatic lipase hydrolyzes triglycerides and phospholipids in lipoprotein particles, participates in the metabolism and remodeling of intermediate-density lipoprotein (MDL), low-density lipoprotein (LDL), and high-density lipoprotein (HDL), and plays a role in cholesterol reverse transport. Previous studies have suggested that certain naturally occurring sequence variations in the LIPC gene may be associated with alterations in plasma lipid profiles and changes in cardiovascular disease risk.

[0004] In this disclosure, one type of variant of interest involves a change in the 97th amino acid of the protein encoded by the LIPC gene, specifically a change from glutamate (Glu, E) to glycine (Gly, G), referred to herein as the E97G variant. Introducing such variants can help obtain a relatively favorable lipid metabolism phenotype in subjects, thereby providing new avenues for the treatment or prevention of hypercholesterolemia and / or atherosclerotic cardiovascular disease. Summary of the Invention

[0005] Given the important role of the LIPC gene and its encoded hepatic lipase in lipid metabolism, and the potential for beneficial phenotypes in regulating lipid metabolism by introducing specific protective variants into the LIPC gene, this disclosure aims to provide a gene editing system targeting LIPC, a guide polynucleotide, a polynucleotide, a recombinant expression vector, an LNP composition, a cell, a pharmaceutical composition, and the use and method of the gene editing system and pharmaceutical composition in the treatment or prevention of hypercholesterolemia and / or atherosclerotic cardiovascular disease.

[0006] In one aspect, this disclosure provides a gene editing system targeting LIPC, wherein the gene editing system targets the LIPC gene and mutates the 97th amino acid of the LIPC gene expression protein from glutamic acid to glycine.

[0007] In some embodiments, the gene editing system targets the first adenine in the codon encoding the 97th amino acid of the LIPC gene, replacing the adenine with guanine.

[0008] In some embodiments, the gene editing system targets the nucleotide sequence at positions 58541752-58541851 of human chromosome 15 of the NCBI reference genome GRCh38, or the complementary sequence of the nucleotide sequence, or the nucleotide sequence having homology of not less than 80%, 90%, 95%, 98%, or 99% with the nucleotide sequence, including but not limited to splice variants, mutants, or conserved substitution-derived sequences of the natural sequence.

[0009] In some embodiments, the gene editing system targets a nucleotide sequence consisting of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides in the aforementioned nucleotide sequence.

[0010] In some embodiments, the gene editing system is selected from adenine base editing (ABE) systems or prime editing (PE) systems.

[0011] In some embodiments, the adenine base editing (ABE) system includes a single-base editor that includes a programmable DNA-binding protein and an adenine deaminase.

[0012] In some embodiments, the programmable DNA-binding protein is selected from any one of the following or a variant thereof: Cas protein, zinc finger nuclease (ZFN), transcription activator-like effector (TALE), meganuclease, Argonaute, HYER, IscB, IsrB, TnpB, or Fanzor.

[0013] In some embodiments, the programmable DNA-binding protein is a nicking enzyme with single-strand nicking enzyme activity, or an inactive protein without nucleic acid cleavage activity.

[0014] In some embodiments, the adenine deaminase is selected from TadA, TadA At least one of TadA7.10, TadA8e, TadA8.20, TadA9, TadA8r, TadA16 and their variants.

[0015] In some embodiments, the pilot editing (PE) system includes a pilot editor and a pilot editing guide RNA (pegRNA), wherein the pilot editor includes a nucleic acid programmable DNA-binding protein (napDNAbp) and a polymerase; The napDNAbp is covalently linked to the polymerase in the form of a fusion protein, or functionally bound via RNA aptamer-mediated trans-recruitment. The pegRNA contains, from the 5' to the 3' end, a guide sequence, a backbone sequence, a reverse transcription template (RT template) sequence, and a primer binding site (PBS) sequence.

[0016] In some embodiments, the guide sequence of the pegRNA has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% sequence identity with any of the sequences shown in SEQ ID NO: 207 to SEQ ID NO: 246; the RT template sequence is selected from any of the sequences shown in SEQ ID NO: 247 to SEQ ID NO: 316; and the PBS sequence is selected from any of the sequences shown in SEQ ID NO: 221 to SEQ ID NO: 300.

[0017] In some embodiments, the guide sequence, RT template sequence, and PBS sequence are combined as shown in any of the combinations in Table 3.

[0018] According to one aspect of this disclosure, a gRNA is provided having a guide sequence that has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% sequence identity with any of the sequences shown in SEQ ID NO: 1 to SEQ ID NO: 110, or the guide sequence of the gRNA has 1 to 5 base mismatches with SEQ ID NO: 1 to SEQ ID NO: 110, or a degenerate variant thereof, a variant having specific sequence identity, or a chemically modified form thereof.

[0019] According to one aspect of this disclosure, a guide polynucleotide is provided, said guide polynucleotide being selected from gRNA as defined above, pegRNA as defined above, or chemically modified forms thereof, or complementary sequences, degenerate variants, or variants having specific sequence identity.

[0020] According to one aspect of this disclosure, a polynucleotide is provided that encodes an editor and / or the guide polynucleotide in a gene editing system as described above, or a complementary sequence, degenerate variant, variant having specific sequence identity, or a chemically modified form thereof.

[0021] According to one aspect of this disclosure, a recombinant expression vector is provided, which comprises the polynucleotides described above.

[0022] According to one aspect of this disclosure, a lipid nanoparticle (LNP) composition is provided, comprising mRNA encoding an editor of the gene editing system as described above, the guide polynucleotide, and / or at least one of the polynucleotides.

[0023] According to one aspect of this disclosure, a cell is provided comprising the gene editing system described above, and / or obtained by editing with the gene editing system described above, or its progeny cells or derived cell populations.

[0024] According to one aspect of this disclosure, a pharmaceutical composition is provided comprising the gene editing system as described above, the guide polynucleotide, the polynucleotide, the recombinant expression vector, the lipid nanoparticle composition and / or the cell, and a pharmaceutically acceptable carrier or excipient.

[0025] According to one aspect of this disclosure, the use of the gene editing system described above, the guide polynucleotide, the polynucleotide, the recombinant expression vector, the lipid nanoparticle composition, the cell, and / or the pharmaceutical composition in the preparation of a medicament for treating hypercholesterolemia and / or atherosclerotic cardiovascular disease is provided.

[0026] According to one aspect of this disclosure, a method for editing the LIPC gene is provided, wherein the method edits the LIPC gene such that the 97th amino acid of the LIPC gene-expressed protein is mutated from glutamic acid to glycine.

[0027] According to one aspect of this disclosure, a method for treating hypercholesterolemia and / or atherosclerotic cardiovascular disease is provided, the method comprising administering to a subject in need a therapeutically effective amount of the gene editing system as described above, the guide polynucleotide, the polynucleotide, the recombinant expression vector, the lipid nanoparticle composition, the cells, and / or the pharmaceutical composition. Attached Figure Description

[0028] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0029] Figure 1 The bar chart shows the ABE editing efficiency of LIPC target sites in Huh7 cells using ABE8e as an adenine base editor and different gRNAs.

[0030] Figure 2 The bar chart shows the ABE editing efficiency of LIPC target sites in Huh7 cells using ABE16 as an adenine base editor and different gRNAs.

[0031] Figure 3 The bar chart shows the ABE editing efficiency of LIPC target sites in Huh7 cells using ABE8r as an adenine base editor and different gRNAs.

[0032] Figure 4 The bar chart shows the ABE editing efficiency of LIPC target sites in Huh7 cells with ABE8e as an adenine base editor and gRNA modified with or without LNA. Detailed Implementation

[0033] This invention provides a gene editing system targeting LIPC and its application.

[0034] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0035] definition

[0036] As used herein, the term "LIPC gene" refers to the gene encoding hepatic lipase (HL). Hepatic lipase is primarily expressed in the liver and hydrolyzes triglycerides and phospholipids in lipoprotein particles, participating in the metabolism and remodeling of intermediate-density lipoprotein, low-density lipoprotein, and high-density lipoprotein, and playing a role in cholesterol reverse transport. In this disclosure, the LIPC gene includes, but is not limited to, the human LIPC gene and its alleles, splice variants, mutants, or conserved substitution-derived sequences, as well as corresponding orthologous genes in non-human mammals. Unless otherwise stated, the nucleotide position of the human LIPC gene in this disclosure is referenced to the NCBI reference genome GRCh38.

[0037] As used herein, the term "E97G variant" refers to an amino acid change that alters the 97th amino acid of the protein encoded by the LIPC gene from glutamic acid (Glu, E) to glycine (Gly, G), and the corresponding sequence change at the nucleotide level, such as replacing the first adenine (A) in the codon encoding the 97th amino acid of the LIPC gene with guanine (G). In this disclosure, the E97G variant is considered a protective variant whose introduction contributes to obtaining a relatively favorable lipid metabolism phenotype in subjects.

[0038] As used herein, the term "gene editing system" refers to an effector molecule or combination of effector molecules capable of sequence altering a target nucleic acid sequence, and its associated guide component. In this disclosure, gene editing systems include, but are not limited to, adenine base editing (ABE) systems and lead editing (PE) systems, and may be provided in protein form, in nucleic acid form encoding the protein (e.g., mRNA or DNA), or in the form of a ribonucleoprotein complex.

[0039] As used herein, the terms "sequence identity" or "homology" refer to the matching of sequences between two polypeptides or two nucleic acids. Two compared sequences are considered identical at that position when a position is occupied by the same base or amino acid monomer subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine). The "percent identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared, multiplied by 100%. For example, if six out of ten positions in two sequences match, then the two sequences have 60% sequence identity. Typically, two sequences are compared to produce the maximum sequence identity. Such alignments can be made using publicly available and commercially available alignment algorithms and programs, such as, but not limited to, Clustal Ω, MAFFT, Probcons, T-Coffee, Probalign, and BLAST, which can be reasonably chosen by those skilled in the art. Those skilled in the art can determine suitable parameters for the alignment of sequences, including any algorithm required to achieve a better or better alignment of the entire length of the sequences being compared, and any algorithm required to achieve a better or better alignment of a local portion of the sequences being compared.

[0040] As used herein, the term "adenine base editing" or "ABE" refers to an editing method or system that achieves the A-to-G conversion by deamination of target adenine (A) within an editing window using an adenine deaminase without causing DNA double-strand breaks. An ABE system typically includes a programmable DNA-binding protein and an adenine deaminase, and may optionally further include a uracil glycosylase inhibitor (UGI), Gam, and / or a nuclear localization signal (NLS).

[0041] As used herein, the term "adenine deaminase" refers to an enzyme that catalyzes the hydrolysis and deamination of adenine or deoxyadenine to inosine or deoxyinosine, respectively. Adenine deaminases include, but are not limited to, TadA and TadA2. At least one of TadA7.10, TadA8e, TadA8.20, TadA9, TadA8r, TadA16, and their variants. The aforementioned adenine deaminases may also include their functional variants, conserved substitution variants, or functionally active fragments thereof.

[0042] As used herein, the term "programmable DNA-binding protein" refers to a protein or its domain that can be designed or programmed to recognize and bind to a predetermined nucleotide sequence. Programmable DNA-binding proteins can be guide RNA-dependent DNA-binding domains (e.g., Cas proteins, Argonaute, IscB, IsrB, TnpB, or Fanzor) or guide RNA-independent protein-DNA direct recognition DNA-binding domains (e.g., zinc finger nuclease (ZFN) binding modules, transcription activator-like effector (TALE) binding modules, or meganucleases). Programmable DNA-binding proteins can possess full nuclease activity, be cleavage enzymes with single-strand cleavage activity, or be inactive proteins lacking nucleic acid cleavage activity.

[0043] As used herein, the term "Cas protein" refers to a CRISPR-related protein or a variant thereof. Cas proteins include, but are not limited to, Cas9, CasX, CasY, Cpf1 (Cas12a), C2c1 (Cas12b), Cas12b2, Cas12h, Cas12i, Cas12g, C2c3, C2c5, C2c8, C2c9, fragments thereof, and mutants or fragments thereof. In some embodiments, the Cas protein is selected from SpRY Cas9, SpCas9 (WT), SpCas9-NG, or SpG Cas9, and their cleavage enzyme forms (nCas9). Cas proteins may have an optimal protospacer adjacent motif (PAM) site, or may not be limited to an optimal PAM site.

[0044] As used herein, the term "guide RNA" or "gRNA" refers to an RNA molecule capable of interacting with a programmable DNA-binding protein that depends on the guide RNA and guides it to recognize or act on a target nucleic acid sequence. It typically contains a guide sequence complementary to the target sequence and a backbone sequence. Guide RNAs can be single guide RNAs (sgRNAs), or they can consist of crRNA and tracrRNA, or exist in functionally equivalent forms. In some embodiments, the guide RNA may contain only crRNA and no tracrRNA. sgRNA is a type of guide RNA.

[0045] As used herein, the term "transcription activator-like effector" or "TALE" refers to a polypeptide containing one or more TALE repeat domains / units. The monomeric polypeptide is typically 33, 34, or 35 amino acids long and differs primarily from each other at positions 12 and 13 (i.e., repeating variable double residues, RVDs). The type of RVD determines its base recognition specificity. TALE recognition modules can be engineered to bind to predetermined nucleotide sequences.

[0046] As used herein, the term "zinc finger nuclease" or "ZFN" refers to a programmable DNA-binding module based on zinc finger proteins or a nuclease containing such a module; the term "meganuclease" or "meganuclease" refers to a homing endonuclease or its engineered form that recognizes longer target sequences. These binding modules can be modified through protein engineering or directed evolution to recognize target nucleotide sequences of the LIPC gene.

[0047] As used herein, the term "edit window" refers to the area within which the target adenine can be effectively edited during the editing process. In this disclosure, "edit site localization" (target adenine editing localization) is denoted by Cx as defined in the terminology definition section of this document.

[0048] As used herein, the term "edit site localization" (i.e., target adenine localization) refers to the distance from the complementary sequence position of the target sequence corresponding to the 3' end of the gRNA guide sequence to the site to be edited in the LIPC gene sequence, specifically the x-th nucleotide from the complementary sequence position of the target sequence corresponding to the 3' end of the gRNA guide sequence, abbreviated as Cx. It should be understood that the above localization method is merely a convention used for ease of description in this disclosure and does not constitute a limitation on the editing window or target site.

[0049] As used herein, the term "prime editing" (PE) refers to a method of gene editing using a nucleic acid programmable DNA-binding protein (napDNAbp, such as Cas enzyme, TALEN, zinc finger nuclease, etc.), a polymerase (such as reverse transcriptase), and a specialized guide RNA, i.e., gene editing based on a prime editing system (PE system). The specialized guide RNA contains a DNA synthesis template on the extension arm of a conventional guide RNA or sgRNA for encoding the desired new genetic information (or deleting genetic information), which is then introduced into the target DNA.

[0050] As used herein, the term "nucleic acid programmable DNA-binding protein" or "napDNAbp" refers to a protein that targets and binds to specific sequences in a DNA molecule through nucleic acid hybridization. Each napDNAbp associates with at least one guide nucleic acid (e.g., guide RNA) and is thereby located at a DNA sequence containing a DNA strand complementary to or partially complementary to the guide nucleic acid; by "programming" the guide nucleic acid, the napDNAbp (e.g., Cas9 or a functional derivative thereof) can be located and bound to different target DNAs. Exemplary napDNAbps with different nuclease activities include Cas9 nickase (nCas9) and inactivated Cas9 (dCas9) which does not have nuclease activity.

[0051] As used herein, the term "lead editor" or "lead editing effector protein" refers to a fusion construct comprising napDNAbp (e.g., Cas9 nickase) or a functional derivative thereof and a DNA polymerase or a functional derivative thereof, capable of leading editing of a target nucleotide sequence in the presence of pegRNA (or "extended guide RNA"). In some embodiments, the DNA polymerase is a reverse transcriptase, such as Moloney murine leukemia virus reverse transcriptase (M-MLV RT) or a variant thereof.

[0052] As used herein, the term "guide RNA" or "pegRNA" (also written as PEgRNA) refers to a specialized guide RNA that can associate with a guide editor, target a DNA sequence, and guide the guide editor to perform guide editing on the target DNA sequence. A pegRNA contains a spacer (guide) sequence that can hybridize complementaryly with the target DNA sequence, and extends to one or both sides of it, with one or more DNA synthesis templates (e.g., reverse transcription templates, RT templates) and primer binding sites (PBS). The DNA synthesis templates contain new genetic information for replacing the corresponding endogenous DNA strand at the target site and may be located at the 3' end, 5' end, or within the sequence of a conventional guide RNA sequence. PegRNAs may also optionally further contain adapters or additional structural elements, such as aptamers, stem-loops, hairpins, or RNA-protein recruitment domains (e.g., MS2 hairpins).

[0053] As used herein, the term "reverse transcriptase" refers to a polymerase capable of catalyzing the synthesis of DNA using RNA as a template. In some embodiments, the reverse transcriptase is M-MLV RT. In some embodiments, the M-MLV RT is wild-type M-MLV RT, or a variant of wild-type M-MLV RT, such as comprising an M-MLV RT variant equivalent to any one, multiple, or all of the mutations selected from D200N, T330P, L603W, T306K, and W313F; in some embodiments, the reverse transcriptase is a truncated version of wild-type M-MLV RT or a variant thereof.

[0054] As used herein, the term "Argonaute" refers to an AGO protein that binds to small interfering RNA (siRNA) and acts on target nucleotides by binding siRNA to target nucleic acids, thereby possessing the characteristics of the "programmable DNA-binding protein" disclosed herein.

[0055] As used herein, the term "nuclear localization signal" or "NLS" refers to a peptide that directs a protein to the cell nucleus. An NLS can be located anywhere on the peptide chain and can fuse with adjacent domains via one or more linkers, or without linkers.

[0056] As used herein, the term "linker" or "linking peptide" refers to an amino acid sequence segment or chemical group that links two or more structural units. Linkers include, but are not limited to, flexible linkers (e.g., the GS linker containing glycine and serine residues) and recombinant peptide linkers lacking hydrophobic amino acid residues (e.g., the XTEN linker).

[0057] As used herein, the term "chemical modification" in relation to nucleic acids refers to modifications made to the ends, bases, sugars, or backbones of nucleotides. Chemical modifications include, but are not limited to, one or more of the following: 3'-thiophosphate, 2'-O-methyl ester, 2'-O-methyl, 2'-F modification, 2'-ribose 3'-thiophosphate, deoxy, and 5'-phosphate modification.

[0058] As used herein, the term "guide polynucleotide" refers to a nucleic acid molecule that can guide a gene editing system to act on a target site, including but not limited to gRNA, pegRNA, and their chemically modified forms.

[0059] As used herein, the terms "polynucleotide" and "nucleic acid" are used interchangeably and refer to polymer molecules composed of nucleotide units, which can be DNA, RNA, or combinations thereof, and can be single-stranded or double-stranded. The term "coding nucleic acid" refers to a nucleic acid molecule, such as mRNA or DNA, containing a nucleic acid sequence capable of expressing or producing a protein or functional nucleic acid product; the coding sequence may be codon-optimized.

[0060] As used herein, the term "recombinant expression vector" refers to a nucleic acid molecule, such as a plasmid or viral vector, capable of transporting another nucleic acid linked to it. Recombinant expression vectors may optionally contain non-coding regions selected from introns, regulatory elements, promoters, enhancers, termination sequences, and 5' and 3' untranslated regions.

[0061] As used herein, the term "lipid nanoparticle" or "LNP" refers to a particle comprising a plurality of lipid molecules physically bound together by intermolecular forces, capable of encapsulating and delivering nucleic acid, protein, and / or ribonucleoprotein complexes to target cells. In some embodiments, the LNP comprises one or more of ionizable lipids, neutral lipids, structural lipids, and polymer-bound lipids (e.g., PEG lipids).

[0062] As used herein, the term "cell" includes primary cells, cell lines, and daughter cells derived therefrom. The term "daughter cell" refers to a cell produced by the division or reproduction of edited cells and retaining the corresponding genetic alterations.

[0063] As used herein, the term "variant" or "mutant" refers to a polypeptide that, compared to a reference protein or reference enzyme, has one or more alterations in its amino acid sequence, such as substitution, deletion, or insertion, but retains at least one biological activity of the reference protein or reference enzyme. A "variant" is a group of highly similar protein members that are derived from a single protein or protein family and have the same or similar biological functions. In some embodiments, variants or mutants retain enzyme activity, and their activity levels may be comparable to, enhanced by, or reduced from those of the reference protein or reference enzyme. In some embodiments, variants or mutants have altered activity. Variants of the Cas protein of this invention represent CRISPR / Cas homologs, which are nucleic acid-binding proteins programmed to target any desired nucleotide sequence within the genome. Deaminase variants as used herein represent deaminase homologs with base deamination functionality. For example, a protein containing a Cas protein or a fragment thereof may be referred to as a "Cas protein variant," such as the Cas9 variant. Cas protein variants share homology with Cas proteins or fragments thereof. For example, the sequence of the Cas protein variant is at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.5%, or at least about 99.9% identical to the sequence of the wild-type Cas protein.

[0064] As used in this article, a "PAM" (Protospacer Adjacent Motif) is a short nucleic acid fragment, typically 3-5 nucleotides in length, located on the non-target strand. PAMs are considered key markers for the binding and cleavage of target DNA by Cas proteins such as Cas9 and Cas12. Their presence is crucial for the editing function of target DNA; the PAM sequence is recognized by Cas proteins to determine the cleavage site of the nuclease on the target DNA. In Cas9 derived from the common *Streptococcus pyogenes* (S. pyogenes), the typical PAM sequence is NGG (N for any nucleotide, G for guanine), meaning that Cas9 proteins primarily recognize target DNA sequences ending in NGG. Other types of Cas proteins may have different PAM sequence preferences; therefore, the PAM sequence in the target DNA sequence needs to be considered based on the type of Cas protein selected.

[0065] As used herein, the term "pharmaceutically acceptable carrier or excipient" means a substance that is compatible with the active ingredient and / or delivery carrier under the intended administration conditions and is of acceptable safety to the subject, including but not limited to diluents, solvents, buffers, isotonic modifiers, stabilizers, lyophilization protectants, or combinations thereof.

[0066] As used herein, the term "subject" means an individual who needs or is deemed fit to receive the product or method of this disclosure, and may be a human or a non-human animal. In some embodiments, the subject is a human subject, particularly a subject with hypercholesterolemia and / or atherosclerotic cardiovascular disease or at risk of developing such disease.

[0067] As used herein, the term "therapeutic effective dose" refers to the amount or range of doses that, given a dosing regimen, will achieve the expected therapeutic effect or expected biological effect in a subject. The term "hypercholesterolemia" refers to a state of elevated plasma cholesterol levels; the term "atherosclerotic cardiovascular disease" refers to cardiovascular diseases caused by or related to atherosclerosis, including but not limited to coronary artery disease, myocardial infarction, stroke, and peripheral artery disease.

[0068] When referring to an RNA sequence, the "t" in the sequence can be used interchangeably with "u". When referring to a "guide sequence", the "t" in the sequence can also be used interchangeably with "u".

[0069] Gene editing systems targeting LIPC

[0070] In one aspect, this disclosure relates to a gene editing system that targets the LIPC gene, causing the 97th amino acid of the LIPC gene-expressed protein to be mutated from glutamic acid to glycine.

[0071] In some embodiments, the gene editing system targets adenine in the first codon of the LIPC gene that encodes the 97th amino acid, replacing adenine with guanine, thereby achieving the aforementioned amino acid alteration.

[0072] In some embodiments, the gene editing system targets the nucleotide sequence at positions 58541752-58541851 of human chromosome 15 in the NCBI reference genome GRCh38, or a complementary sequence of the nucleotide sequence, or a nucleotide sequence with at least 80% homology to the nucleotide sequence; preferably, the homology is at least 90%; more preferably, at least 95%; more preferably, at least 98%; particularly preferably, at least 99%. The nucleotide sequence includes, but is not limited to, splice variants, mutants, or conserved substitution-derived sequences of the natural sequence.

[0073] In some embodiments, the gene editing system targets the nucleotide sequence at positions 58541752-58541851 of human chromosome 15 of the NCBI reference genome GRCh38 as actagtgcgaccctccctctgtcccctcctcaggtggacggcgtgctagaaaactggatctggcagatggtggccgcgctgaagtctcagccggcccagc (SEQ ID NO:397).

[0074] In some embodiments, the gene editing system targets a nucleotide sequence consisting of at least 15 consecutive nucleotides in the aforementioned nucleotide sequence; preferably at least 16, at least 17, or at least 18 consecutive nucleotides; more preferably at least 19, at least 20, or at least 21 consecutive nucleotides; and more preferably a nucleotide sequence consisting of at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides.

[0075] In some embodiments, the target nucleotide sequence of the gene editing system is: actagtgcgaccctccctctgtcccctcctcaggtggacggcgtgctagAaaactggatctggcagatggtggccgcgctgaagtctcagccggcccagc (SEQ ID NO:397), where the uppercase bold underline A represents the target adenine to be edited.

[0076] In some embodiments, the target nucleotide sequence of the gene editing system is: ccctccctctgtcccctcctcaggtggacggcgtgctagAaaactggatctggcagatggtggccgcgctgaagtctcag (SEQ ID NO:398), where the uppercase bold underscore A represents the target adenine to be edited.

[0077] In some embodiments, the target nucleotide sequence of the gene editing system is: gtcccctcctcaggtggacggcgtgctagAaaactggatctggcagatggtggccgcgct (SEQ ID NO:399), where the uppercase bold underline A represents the target adenine to be edited.

[0078] In some embodiments, the gene editing system is selected from adenine base editing (ABE) systems or leader editing (PE) systems.

[0079] Adenine base editing (ABE) system

[0080] In some embodiments, the ABE system includes a single-base editor (ABE editor) that includes a programmable DNA-binding protein and an adenine deaminase.

[0081] In some embodiments, the ABE editor of the ABE system is a fusion protein, in which adenine deaminase is fused to a programmable DNA-binding protein via an optional linker, and may optionally further include UGI, Gam, and / or one or more nuclear localization signals (NLS).

[0082] In some embodiments, the programmable DNA-binding protein is selected from any one or a variant of Cas protein, zinc finger nuclease (ZFN), transcription activator-like effector (TALE), meganuclease, Argonaute, HYER, IscB, IsrB, TnpB, or Fanzor.

[0083] In some embodiments, the programmable DNA-binding protein is a nicking enzyme with single-strand nicking enzyme activity; in other embodiments, the programmable DNA-binding protein is an inactive protein that does not have nucleic acid cleavage activity and is only used for its localization function.

[0084] In some embodiments, the adenine deaminase is selected from TadA, TadA At least one of TadA7.10, TadA8e, TadA8.20, TadA9, TadA8r, TadA16, and variants thereof. In some embodiments, the fusion protein is selected from SpRY-ABE-16, SpRY-ABE8e, or SpRY-ABE8r.

[0085] In some embodiments, the programmable DNA-binding protein is a DNA-binding domain dependent on guide RNA (gRNA), and the ABE system further includes guide RNA (gRNA). In some embodiments, the guide sequence of the gRNA has at least 80% sequence identity with any of the sequences shown in SEQ ID NO: 1 to SEQ ID NO: 110; preferably at least 85%; more preferably at least 90% or at least 92%; more preferably at least 95% or at least 97%; particularly preferably at least 98%, at least 99%, or at least 99.5%; and most preferably 100% sequence identity.

[0086] In some embodiments, the guide sequence of the gRNA is selected from SEQ ID NO: 1 to SEQ ID NO: 110, and / or mismatched sequences that have 1 to 5 base mismatches with SEQ ID NO: 1 to SEQ ID NO: 110.

[0087] In some embodiments, the gRNA-dependent programmable DNA-binding protein is selected from Cas proteins.

[0088] In some embodiments, the Cas protein includes at least one or a combination of the following: Cas9, CasX, CasY, Cpf1 (Cas12a), C2c1 (Cas12b), Cas12b2, Cas12h, Cas12i, Cas12g, C2c3, C2c5, C2c8, C2c9, fragments thereof, and mutants thereof or fragments thereof.

[0089] In some embodiments, the Cas protein is selected from SpRY Cas9, SpCas9 (WT), SpCas9-NG, or the nickase form of SpGCas9 (nCas9).

[0090] In some implementations, the target adenine is located at C9-C18, and the guide sequence of the gRNA is 16-25 bp in length.

[0091] In some implementations, the target adenine is located at C9, and the guide sequence of the gRNA is 16-25 bp in length.

[0092] In some implementations, the target adenine is located at C9, and the guide sequence of the gRNA is 17-25 bp in length.

[0093] In some implementations, the target adenine is located at C9, and the guide sequence of the gRNA is 18-25 bp in length.

[0094] In some implementations, the target adenine is located at C9, and the guide sequence of the gRNA is 19-25 bp in length.

[0095] In some implementations, the target adenine is located at C9, and the guide sequence of the gRNA is 20-25 bp in length.

[0096] In some implementations, the target adenine is located at C9, and the guide sequence of the gRNA is 20-24 bp in length.

[0097] In some implementations, the target adenine is located at C9, and the guide sequence of the gRNA is 20-23 bp in length.

[0098] In some implementations, the target adenine is located at C9, and the guide sequence of the gRNA is 20-22 bp in length.

[0099] In some implementations, the target adenine is located at C10, and the guide sequence of the gRNA is 16-25 bp in length.

[0100] In some implementations, the target adenine is located at C10, and the guide sequence of the gRNA is 17-25 bp in length.

[0101] In some implementations, the target adenine is located at C10, and the guide sequence of the gRNA is 18-25 bp in length.

[0102] In some implementations, the target adenine is located at C10, and the guide sequence of the gRNA is 19-25 bp in length.

[0103] In some implementations, the target adenine is located at C10, and the guide sequence of the gRNA is 20-25 bp in length.

[0104] In some implementations, the target adenine is located at C10, and the guide sequence of the gRNA is 20-24 bp in length.

[0105] In some implementations, the target adenine is located at C10, and the guide sequence of the gRNA is 20-23 bp in length.

[0106] In some implementations, the target adenine is located at C10, and the guide sequence of the gRNA is 20-22 bp in length.

[0107] In some implementations, the target adenine is located at C11, and the guide sequence of the gRNA is 16-25 bp in length.

[0108] In some implementations, the target adenine is located at C11, and the guide sequence of the gRNA is 17-25 bp in length.

[0109] In some implementations, the target adenine is located at C11, and the guide sequence of the gRNA is 18-25 bp in length.

[0110] In some implementations, the target adenine is located at C11, and the guide sequence of the gRNA is 19-25 bp in length.

[0111] In some implementations, the target adenine is located at C11, and the guide sequence of the gRNA is 20-25 bp in length.

[0112] In some implementations, the target adenine is located at C11, and the guide sequence of the gRNA is 20-24 bp in length.

[0113] In some implementations, the target adenine is located at C11, and the guide sequence of the gRNA is 20-23 bp in length.

[0114] In some implementations, the target adenine is located at C11, and the guide sequence of the gRNA is 20-22 bp in length.

[0115] In some implementations, the target adenine is located at C12, and the guide sequence of the gRNA is 16-25 bp in length.

[0116] In some implementations, the target adenine is located at C12, and the guide sequence of the gRNA is 17-25 bp in length.

[0117] In some implementations, the target adenine is located at C12, and the guide sequence of the gRNA is 18-25 bp in length.

[0118] In some implementations, the target adenine is located at C12, and the guide sequence of the gRNA is 19-25 bp in length.

[0119] In some implementations, the target adenine is located at C12, and the guide sequence of the gRNA is 20-25 bp in length.

[0120] In some implementations, the target adenine is located at C12, and the guide sequence of the gRNA is 20-24 bp in length.

[0121] In some implementations, the target adenine is located at C12, and the guide sequence of the gRNA is 20-23 bp in length.

[0122] In some implementations, the target adenine is located at C12, and the guide sequence of the gRNA is 20-22 bp in length.

[0123] In some implementations, the target adenine is located at C13, and the guide sequence of the gRNA is 16-25 bp in length.

[0124] In some implementations, the target adenine is located at C13, and the guide sequence of the gRNA is 17-25 bp in length.

[0125] In some implementations, the target adenine is located at C13, and the guide sequence of the gRNA is 18-25 bp in length.

[0126] In some implementations, the target adenine is located at C13, and the guide sequence of the gRNA is 19-25 bp in length.

[0127] In some implementations, the target adenine is located at C13, and the guide sequence of the gRNA is 20-25 bp in length.

[0128] In some implementations, the target adenine is located at C13, and the guide sequence of the gRNA is 20-24 bp in length.

[0129] In some implementations, the target adenine is located at C13, and the guide sequence of the gRNA is 20-23 bp in length.

[0130] In some implementations, the target adenine is located at C13, and the guide sequence of the gRNA is 20-22 bp in length.

[0131] In some implementations, the target adenine is located at C14, and the guide sequence of the gRNA is 16-25 bp in length.

[0132] In some implementations, the target adenine is located at C14, and the guide sequence of the gRNA is 17-25 bp in length.

[0133] In some implementations, the target adenine is located at C14, and the guide sequence of the gRNA is 18-25 bp in length.

[0134] In some implementations, the target adenine is located at C14, and the guide sequence of the gRNA is 19-25 bp in length.

[0135] In some implementations, the target adenine is located at C14, and the guide sequence of the gRNA is 20-25 bp in length.

[0136] In some implementations, the target adenine is located at C14, and the guide sequence of the gRNA is 20-24 bp in length.

[0137] In some implementations, the target adenine is located at C14, and the guide sequence of the gRNA is 20-23 bp in length.

[0138] In some implementations, the target adenine is located at C14, and the guide sequence of the gRNA is 20-22 bp in length.

[0139] In some implementations, the target adenine is located at C15, and the guide sequence of the gRNA is 16-25 bp in length.

[0140] In some implementations, the target adenine is located at C15, and the guide sequence of the gRNA is 17-25 bp in length.

[0141] In some implementations, the target adenine is located at C15, and the guide sequence of the gRNA is 18-25 bp in length.

[0142] In some implementations, the target adenine is located at C15, and the guide sequence of the gRNA is 19-25 bp in length.

[0143] In some implementations, the target adenine is located at C15, and the guide sequence of the gRNA is 20-25 bp in length.

[0144] In some implementations, the target adenine is located at C15, and the guide sequence of the gRNA is 20-24 bp in length.

[0145] In some implementations, the target adenine is located at C15, and the guide sequence of the gRNA is 20-23 bp in length.

[0146] In some implementations, the target adenine is located at C15, and the guide sequence of the gRNA is 20-22 bp in length.

[0147] In some implementations, the target adenine is located at C16, and the guide sequence of the gRNA is 16-25 bp in length.

[0148] In some implementations, the target adenine is located at C16, and the guide sequence of the gRNA is 17-25 bp in length.

[0149] In some implementations, the target adenine is located at C16, and the guide sequence of the gRNA is 18-25 bp in length.

[0150] In some implementations, the target adenine is located at C16, and the guide sequence of the gRNA is 19-25 bp in length.

[0151] In some implementations, the target adenine is located at C16, and the guide sequence of the gRNA is 20-25 bp in length.

[0152] In some implementations, the target adenine is located at C16, and the guide sequence of the gRNA is 20-24 bp in length.

[0153] In some implementations, the target adenine is located at C16, and the guide sequence of the gRNA is 20-23 bp in length.

[0154] In some implementations, the target adenine is located at C16, and the guide sequence of the gRNA is 20-22 bp in length.

[0155] In some implementations, the target adenine is located at C17, and the guide sequence of the gRNA is 16-25 bp in length.

[0156] In some implementations, the target adenine is located at C17, and the guide sequence of the gRNA is 17-25 bp in length.

[0157] In some implementations, the target adenine is located at C17, and the guide sequence of the gRNA is 18-25 bp in length.

[0158] In some implementations, the target adenine is located at C17, and the guide sequence of the gRNA is 19-25 bp in length.

[0159] In some implementations, the target adenine is located at C17, and the guide sequence of the gRNA is 20-25 bp in length.

[0160] In some implementations, the target adenine is located at C17, and the guide sequence of the gRNA is 20-24 bp in length.

[0161] In some implementations, the target adenine is located at C17, and the guide sequence of the gRNA is 20-23 bp in length.

[0162] In some implementations, the target adenine is located at C17, and the guide sequence of the gRNA is 20-22 bp in length.

[0163] In some implementations, the target adenine is located at C18, and the guide sequence of the gRNA is 16-25 bp in length.

[0164] In some implementations, the target adenine is located at C18, and the guide sequence of the gRNA is 17-25 bp in length.

[0165] In some implementations, the target adenine is located at C18, and the guide sequence of the gRNA is 18-25 bp in length.

[0166] In some implementations, the target adenine is located at C18, and the guide sequence of the gRNA is 19-25 bp in length.

[0167] In some implementations, the target adenine is located at C18, and the guide sequence of the gRNA is 20-25 bp in length.

[0168] In some implementations, the target adenine is located at C18, and the guide sequence of the gRNA is 20-24 bp in length.

[0169] In some implementations, the target adenine is located at C18, and the guide sequence of the gRNA is 20-23 bp in length.

[0170] In some implementations, the target adenine is located at C18, and the guide sequence of the gRNA is 20-22 bp in length.

[0171] In some implementations, the target adenine is located at C10-C16.

[0172] In some implementations, the target adenine is located at C10-C15.

[0173] In some implementations, the target adenine is located at C10-C14.

[0174] In some implementations, the target adenine is located at C10-C13.

[0175] In some implementations, the target adenine is localized to C10-C12.

[0176] In some implementations, the target adenine is localized to C10-C11.

[0177] In some implementations, the target adenine is located at C11-C16.

[0178] In some implementations, the target adenine is located at C11-C15.

[0179] In some implementations, the target adenine is located at C11-C14.

[0180] In some implementations, the target adenine is localized to C11-C13.

[0181] In some implementations, the target adenine is localized to C11-C12.

[0182] In some implementations, the target adenine is located at C12-C16.

[0183] In some implementations, the target adenine is located at C12-C15.

[0184] In some implementations, the target adenine is located at C12-C14.

[0185] In some implementations, the target adenine is localized to C12-C13.

[0186] In some implementations, the target adenine is located at C13-C16.

[0187] In some implementations, the target adenine is located at C13-C15.

[0188] In some implementations, the target adenine is localized to C13-C14.

[0189] In some implementations, the target adenine is located at C14-C16.

[0190] In some implementations, the target adenine is located at C14-C15.

[0191] In some implementations, the target adenine is located at C15-C16.

[0192] In some implementations, the target adenine is located at C13-C15, and the guide sequence of the gRNA is 17-24 bp in length.

[0193] In some embodiments, the adenine deaminase is TadA8e, and the target edited adenine is located at C12-C16.

[0194] In some embodiments, the adenine deaminase is TadA16, and the target edited adenine is located at C12-C15.

[0195] In some embodiments, the adenine deaminase is TadA8r, and the target edited adenine is located at C13-C18.

[0196] In some embodiments, the ABE editor of the ABE system is a fusion protein, wherein the adenine deaminase is fused to a programmable DNA-binding protein via an optional adapter, and may optionally further include a uracil glycosylase inhibitor (UGI), Gam, and / or one or more nuclear localization signals (NLS). In some embodiments, the ABE editor comprises the structure NH2-[adenine deaminase]-[optional adapter sequence]-[guide RNA (gRNA)-dependent DNA-binding domain]-[optional adapter sequence]-[optional UGI domain]-COOH; in some embodiments, the UGI is fused to a nuclease-inactivated or nicking enzyme-active Cas9 via an optional adapter.

[0197] In some embodiments, the ABE editor comprises one, two, or more NLSs. The NLS can be fused to the N-terminus or C-terminus of a fusion protein, to the N-terminus or C-terminus of a programmable DNA-binding protein, adenine deaminase, or UGI protein, and can be fused to adjacent domains via one or more linkers, or fused without linkers. It should be understood that the structural units of the ABE editor can be organically linked by peptide bonds or linker peptides to form a fusion protein, or they can be provided separately, with one, two, or more of each structural unit.

[0198] In some embodiments, the adenine deaminase included in the ABE editor can be a deaminase protein or its active domain, or a polypeptide or nucleotide-binding motif capable of recruiting the deaminase protein, wherein the nucleotide-binding motif can be organically linked to gRNA. In some embodiments, the programmable DNA-binding protein is a domain with completely inactive nuclease activity, a domain with partially inactive nuclease activity (e.g., a nickase), or a domain with nuclease activity, such as a nuclease-inactive Cas9 (dCas9) domain, Cpf1 domain, Argonaute domain, or a nuclease-inactive Cas9 (nCas9) domain, or variants or combinations thereof; preferably, the Cas protein is a protein with partially or completely inactive catalytic activity, utilizing only its localization function. In some embodiments, the programmable DNA-binding protein may have an optimal protospacer adjacent motif (PAM) site, or it may not be limited to an optimal PAM site (e.g., SpRY nuclease); non-limiting examples of the optimal PAM site include NGG, NG, NAA, NGNNG, TTN, TTTV / TTTN, ATTN, or TTCN, etc. (where N represents A / T / C / G, R represents A / G, W represents A / T, and V represents A / C / G). It should be understood that the above-described structural composition and arrangement of the ABE editor are merely examples; those skilled in the art can make reasonable adjustments without departing from the technical concept of this disclosure.

[0199] In some implementations, adenine deaminase (e.g., engineered adenine deaminase, evolved adenine deaminase) can be derived from any organism, such as bacteria.

[0200] In some embodiments, adenine deaminase is a variant of a naturally occurring deaminase from an organism. In some embodiments, adenine deaminase does not occur in nature. For example, in some embodiments, adenine deaminase has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity with naturally occurring deaminases. In some embodiments, adenine deaminase is derived from bacteria such as *Escherichia coli*, *Staphylococcus aureus*, *Salmonella typhi*, *Shewanella putrefaciens*, *Haemophilus influenzae*, or *C. crescentus*. In some embodiments, adenine deaminase is TadA deaminase. In some embodiments, TadA deaminase is *Escherichia coli* TadA deaminase. In some embodiments, the TadA deaminase is a truncated E. coli TadA deaminase. For example, the truncated TadA deaminase may lack one or more N-terminal amino acids compared to the full-length TadA deaminase. In some embodiments, the truncated TadA deaminase may lack 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 6, 17, 18, 19, or 20 N-terminal amino acid residues compared to the full-length TadA deaminase. In some embodiments, the truncated TadA deaminase may lack 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 6, 17, 18, 19, or 20 C-terminal amino acid residues compared to the full-length TadA deaminase. In some embodiments, the TadA deaminase does not contain an N-terminal methionine.

[0201] In some embodiments, the adenine deaminase is selected from TadA, TadA At least one of TadA7.10, TadA8e, TadA8.20, TadA9, TadA8r, TadA16 and their variants.

[0202] In some embodiments, the adenine deaminase is selected from TadA8e, TadA8r, or TadA16.

[0203] In some embodiments, the adenine deaminase is TadA8r or a variant thereof.

[0204] In some embodiments, the fusion protein is selected from ABE16, ABE8e, ABE8.8, ABEmax, or ABE8r.

[0205] In this invention, a CRISPR-based ABE single-base editor is used to target the first adenine in the codon encoding the 97th amino acid of the LIPC gene, replacing it with guanine. Furthermore, if the adenine adjacent to the left of the first adenine in the codon encoding the 97th amino acid of the LIPC gene is side-edited, replacing it with guanine, no amino acid change occurs. If the adenine adjacent to the right of the first adenine in the codon encoding the 97th amino acid of the LIPC gene is side-edited, replacing it with guanine, the 97th amino acid of the LIPC gene-expressed protein still mutates from glutamic acid to glycine.

[0206] Adenine base editor based on TALE

[0207] In some embodiments, the ABE system is a TALE-based adenine base editor comprising a first polypeptide and a second polypeptide. The first polypeptide, from its N-terminus to its C-terminus, sequentially comprises a nuclear localization signal (NLS) sequence, a TALE recognition module, and an adenine deaminase; the second polypeptide, from its N-terminus to its C-terminus, sequentially comprises a nuclear localization signal (NLS) sequence, a TALE recognition module, and a single-strand nickase. The TALE recognition modules of the first and second polypeptides respectively bind to the two strands of the target DNA double strand, forming an editing window containing the target adenine between the two modules.

[0208] In some embodiments, the editing window of the TALE recognition module in the first and second peptides has a sequence as shown in any one of SEQ ID NO: 121 to SEQ ID NO: 140. In some embodiments, the sequence recognized by the TALE recognition module in the first peptide has at least 80% sequence identity with any one of SEQ ID NO: 111 to SEQ ID NO: 120; preferably at least 90%; more preferably at least 95%; particularly preferably at least 99% or 100%. In some embodiments, the sequence recognized by the TALE recognition module in the second peptide has corresponding sequence identity with any one of SEQ ID NO: 141 to SEQ ID NO: 206. In some embodiments, the recognition sequences corresponding to the TALE recognition modules in the first and second peptides are shown in any combination of Table 2 of this disclosure.

[0209] Preview Editing (PE) System

[0210] In some embodiments, the PE system includes a leader editor and a leader editing guide RNA (pegRNA), the leader editor comprising a nucleic acid programmable DNA-binding protein (napDNAbp) and a polymerase. In some embodiments, the napDNAbp is covalently linked to the polymerase as a fusion protein or functionally bound via RNA aptamer-mediated trans-recruitment. In some embodiments, the napDNAbp is a Cas protein (e.g., Cas9 nickase), and the polymerase is a reverse transcriptase (e.g., M-MLV RT or a variant thereof).

[0211] In some embodiments, the pegRNA comprises, from the 5' to the 3' end, a guide sequence, a backbone sequence, a reverse transcription template (RT template) sequence, and a primer binding site (PBS) sequence.

[0212] In some embodiments, the guide sequence of the pegRNA has at least 80% or at least 85% sequence identity with any of the sequences shown in SEQ ID NO: 207 to SEQ ID NO: 246; preferably at least 90% or at least 92%; more preferably at least 95%, at least 97%, or at least 98%; particularly preferably at least 99%, at least 99.5%, or 100%.

[0213] In some embodiments, the RT template sequence is selected from any of the sequences shown in SEQ ID NO: 247 to SEQ ID NO: 316; the PBS sequence is selected from any of the sequences shown in SEQ ID NO: 317 to SEQ ID NO: 396.

[0214] In some embodiments, the guide sequence, RT template sequence, and PBS sequence are combined as shown in any of the combinations shown in Table 3 of this disclosure.

[0215] In some implementations, the pilot editing system is selected from one or more of the PE1, PE2, PE3, PE3b, PEmax, and PE-short systems.

[0216] In some embodiments, the PE system includes a leader editor and a specialized guide RNA (pegRNA), wherein the polymerase (or a functional derivative thereof) and napDNAbp (or a functional derivative thereof) are collectively referred to as the leader editor. In some embodiments, the napDNAbp is a Cas protein (e.g., Cas9 nickase), which uses pegRNA to target a specific DNA sequence and generate a single-stranded nick at the target site to expose a 3'-hydroxyl group; the exposed 3'-hydroxyl terminus hybridizes with the strand containing the nick via a primer binding site (PBS) on the pegRNA, and reverse transcription or DNA synthesis is initiated using the DNA synthesis template contained in the pegRNA as a template to form an edited strand; the newly polymerized single-stranded DNA lobe then competitively replaces the corresponding endogenous sequence, thereby writing the desired genetic information into the target site.

[0217] In some embodiments, the polymerase and napDNAbp exist as a fusion protein; the polymerase is not limited to reverse transcriptase, but can be selected from almost any DNA polymerase. When the DNA synthesis template is RNA, the polymerase can be an RNA-dependent DNA polymerase (e.g., reverse transcriptase); when the DNA synthesis template is DNA, the polymerase can be a DNA-dependent DNA polymerase. In some embodiments, the DNA synthesis template is homologous to a genomic target sequence, except that it contains desired nucleotide changes (e.g., single nucleotide changes, deletions, or insertions, or combinations thereof). In some embodiments, the system can be used in combination with a fallibility-prone reverse transcriptase to introduce random or non-random nucleotide changes during the synthesis of single-stranded DNA loci.

[0218] In some implementations, exemplary pilot editing systems include PE1 system, PE2 system, PE3 system, PE3b system, PE4max system, and PE-short system.

[0219] The PE1 system refers to a PE system containing a PE1 complex (e.g., a fusion protein), which comprises the PE1 complex and PEgRNA. The PE1 complex has the following structure: SpCas9 (H840A) or a functional derivative thereof and wild-type M-MLV RT or a functional derivative thereof (M-MLV_RT(wt)). An exemplary connection method for PE1 includes: [NLS]-[Cas9(H840A)]-[connector]-[M-MLV_RT(wt)]. The PE2 system refers to a PE system containing a PE2 complex (e.g., a fusion protein), which comprises the PE2 complex and PEgRNA. The PE2 complex has the following structure: Cas9 (H840A) or a functional derivative thereof and variant M-MLV RT. Exemplary ligation methods for PE2 include: (NLS)-[(Cas9(H840A)]-[linker]-[M-MLV_RT(D200N)(T330P)(L603W)(T306K)(W313F)]. The PE3 system, building upon the PE2 system, further includes a second guide RNA, such as a conventional guide RNA or sgRNA, for generating the second nick. The second guide RNA complexes with PE2 and introduces a nick into the DNA strand containing the target sequence to induce preferential substitution of the edited strand. The PE3b system is a special case of the PE3 system, where the spacer region sequence contained in its second guide RNA contains all or part of the novel genetic information encoded by the aforementioned DNA synthesis template. That is, the guide RNA can only hybridize complementaryally with the non-target strand of the target DNA after the aforementioned edited strand has been formed, and only then can a second nick be introduced into the DNA strand containing the target sequence.

[0220] The PE4max system refers to a guided editing system that further incorporates a mismatch repair (MMR) inhibitor based on the PEmax system. It comprises the PEmax complex, pegRNA, a second guide RNA (such as sgRNA) for generating a second nick, and the MMR inhibitor. An exemplary connection configuration for PEmax includes: [NLS]-[Cas9(H840A)]-[Connector]-[M-MLV_RT(D200N)(T330P)(L603W)(T306K)(W313F)]-[NLS].

[0221] In some implementations, the PE1 leader editing system, PE2 leader editing system, PE2(WT), PE(WT), PE3 system, PE3b system, etc., use the same leader editor (PE), the napDNAbp contained in the PE is Cas9, and the polymerase in the PE complex is M-MLV RT.

[0222] In some of these schemes, PEgRNA further includes primer binding sites, adapters, or other additional structural elements on its extended arms, such as, but not limited to, aptamers, stem loops, hairpins, and RNA-protein recruitment domains (e.g., MS2 hairpins).

[0223] In some embodiments, the PE3 system further includes a second guide RNA for generating a second nick, inducing preferential substitution of the edited strand, in addition to the PE2 system. The PE3b system is a special case of the PE3 system, where the spacer sequence in its second guide RNA contains all or part of new genetic information encoded by the aforementioned DNA synthesis template, thereby introducing a second nick only after the edited strand has formed and through complementary hybridization with the non-target strand of the target DNA. In some embodiments, the napDNAbp used in the lead editor of the PE systems described above is Cas9, and the polymerase is M-MLV RT or a variant or truncated form thereof.

[0224] Guiding polynucleotides and chemical modifications

[0225] In some embodiments, the gRNA or pegRNA is chemically modified.

[0226] The modification is selected from one or more of the following: thiophosphate bond modification, 2'-O-methyl modification, 2'-F modification, 2'-ribose 3'-thiophosphate modification, deoxygenation modification, 5' phosphate modification, peptide nucleic acid modification, and locked nucleic acid modification.

[0227] In some embodiments, the three ribonucleotides at the 5' and 3' ends of the gRNA or pegRNA are modified with 2'-O-methyl groups, and the four adjacent ribonucleotides at the 5' and 3' ends are modified with phosphate thioester bonds.

[0228] In some embodiments, the two ribonucleotides at the 5' end of the gRNA are modified with locked nucleic acid.

[0229] In some embodiments, this disclosure provides a guide polynucleotide selected from gRNA as defined above, pegRNA as defined above, or a chemically modified form of any of the above.

[0230] In some embodiments, the gRNA may also be linked using modified ribonucleotides, deoxyribonucleotides, other synthetic bases, and synthetic backbones (such as peptide nucleic acids (PNA), locked nucleic acids (LNA), etc.).

[0231] In some embodiments, the gRNA is modified with locked nucleic acid (LNA). In some embodiments, one or two LNAs are introduced at the 5' end of the guide sequence of the gRNA. In some embodiments, one LNA is introduced at the 5' end of the guide sequence of the gRNA. In some embodiments, two LNAs are introduced at the 5' end of the guide sequence of the gRNA.

[0232] In some embodiments, the nucleic acids constituting the guide nucleotide sequence comprise natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyluridine, C5-propynylcytidine, C5-propynylcytidine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyluridine, C5-propynylcyt ... 5-Methylcytidine, 2-aminoadenosine, 7-deadenosine, 7-deadenosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g. methylated bases); inserted bases; modified sugars (e.g. 2'-fluororibose, ribose, 2'-deoxyribose, arabinose and hexose); and / or modified phosphate groups (e.g. thiophosphate esters and 5'-N-phosphoramide linkages).

[0233] Combination of polynucleotides, recombinant expression vectors and lipid nanoparticles

[0234] In some embodiments, this disclosure provides a polynucleotide that encodes an editor and / or a guide polynucleotide in a gene editing system as described above.

[0235] In some embodiments, the polynucleotide is DNA or mRNA, and may optionally be codon-optimized.

[0236] In some embodiments, this disclosure provides a recombinant expression vector comprising the polynucleotide; the recombinant expression vector may optionally comprise a non-coding region selected from introns, regulatory elements, promoters, enhancers, termination sequences, and 5' and 3' untranslated regions.

[0237] In some embodiments, the recombinant expression vector is a plasmid vector or a viral vector, including but not limited to adeno-associated virus (AAV) vectors, lentiviral vectors, or adenovirus vectors. In some embodiments, the polynucleotide may also be provided in the form of messenger RNA (mRNA) or circular RNA, and may optionally be codon-optimized and / or chemically modified (e.g., replacing uridine with N1-methylpseuuridine, adopting a 5' cap structure, and a 3' polyadenylate tail).

[0238] In some embodiments, the recombinant expression vector includes a promoter operatively linked to the coding sequence, the promoter including but not limited to constitutive promoters, tissue-specific promoters (e.g., liver-specific promoters) or inducible promoters.

[0239] In some embodiments, this disclosure provides a delivery system including a vector that contains the gene editing system described above, and / or contains a polynucleotide encoding the polynucleotide described above.

[0240] In some embodiments, the delivery system is selected from: AAV delivery systems, lipid nanoparticle delivery systems, and lentivirus delivery systems.

[0241] Understandably, single-base editors and their gRNAs can be delivered to host cells in vitro or in vivo via plasmid vectors, viral vectors, ribonucleoprotein complexes, viroid vectors, etc., and the delivery methods can include liposome delivery, lipid nanoparticle delivery, exosome delivery (EV), viral particles, or electroporation.

[0242] In some embodiments, this disclosure provides a lipid nanoparticle (LNP) composition comprising mRNA encoding an editor of the gene editing system as described above, the guide polynucleotide, and / or at least one of the polynucleotides.

[0243] In some embodiments, the LNP comprises one or more of ionizable lipids, neutral lipids, structural lipids, and polymer-bound lipids (e.g., PEG lipids). In some embodiments, based on the total molar amount of each lipid component, the ionizable lipids comprise about 30 mol% to about 60 mol% (e.g., about 35 mol% to about 55 mol%), the neutral lipids comprise about 0 mol% to about 20 mol% (e.g., about 5 mol% to about 15 mol%), the structural lipids comprise about 20 mol% to about 60 mol% (e.g., about 35 mol% to about 50 mol%), and the polymer-bound lipids comprise about 0.1 mol% to about 5 mol% (e.g., about 0.5 mol% to about 3 mol%).

[0244] In some embodiments, the ionizable lipids are selected from, but are not limited to, SM-102, ALC-0315, DLin-MC3-DMA (MC3), LP01, or combinations thereof; the neutral lipids include, but are not limited to, distearate phosphatidylcholine (DSPC); the structural lipids include, but are not limited to, cholesterol; and the polymer-bound lipids include, but are not limited to, PEG lipids such as DMG-PEG2000 or ALC-0159.

[0245] In some embodiments, the nitrogen-to-phosphorus ratio (N / P ratio) of the nucleic acid encapsulated by the LNP to the ionizable lipid is about 2 to about 20; preferably about 3 to about 12; more preferably about 4 to about 8; and any range between the two is also included.

[0246] In some embodiments, the average particle size of the LNP is from about 30 nm to about 200 nm; preferably from about 50 nm to about 150 nm; more preferably from about 60 nm to about 120 nm; and any range between the two (e.g., from about 70 nm to about 110 nm) is also included.

[0247] Cells, pharmaceutical compositions and formulations

[0248] In some embodiments, this disclosure provides a cell comprising the gene editing system described above, and / or obtained by editing with the gene editing system described above.

[0249] In some embodiments, the cells are hepatocytes, hepatic progenitor cells, stem cells, or cell lines.

[0250] In some embodiments, this disclosure provides a pharmaceutical composition comprising the gene editing system described above, the guide polynucleotide, the polynucleotide, the recombinant expression vector, the lipid nanoparticle composition and / or the cells, and a pharmaceutically acceptable carrier or excipient. The pharmaceutical composition may be formulated into dosage forms suitable for parenteral administration, including but not limited to injections, intravenous infusion formulations, lyophilized formulations, or pre-filled formulations.

[0251] In some embodiments, the cells are hepatocytes, hepatic progenitor cells, primary hepatic cells, stem cells (e.g., hematopoietic stem / progenitor cells or induced pluripotent stem cells), or cell lines (e.g., Huh7, HepG2, or HEK293T cells). In some embodiments, the cells are cells edited in vitro or ex vivo, or cells edited in vivo in a subject, and include progeny cells or derived cell populations that retain the corresponding genetic alterations.

[0252] Medical Uses and Treatments

[0253] In some embodiments, this disclosure relates to the use of the gene editing system described above, guide polynucleotides, polynucleotides, recombinant expression vectors, lipid nanoparticle compositions, cell and / or pharmaceutical compositions in the preparation of medicaments for treating hypercholesterolemia and / or atherosclerotic cardiovascular diseases, and a method for treating or preventing the aforementioned diseases. In some embodiments, the method includes administering a therapeutically effective amount of the aforementioned product to a subject in need.

[0254] In some embodiments, the subject is a human patient, particularly a subject with hypercholesterolemia and / or atherosclerotic cardiovascular disease or at risk of developing such disease. In some embodiments, the product is administered via an enteral route, including but not limited to intravenous, intramuscular, or subcutaneous injection; in some embodiments, the product is primarily delivered to the liver (particularly hepatocytes) of the subject. In some embodiments, the dosage, based on total nucleic acid content or active ingredient, is from about 0.01 mg / kg to about 10 mg / kg; preferably from about 0.1 mg / kg to about 5 mg / kg; more preferably from about 0.3 mg / kg to about 3 mg / kg; the specific dosage and frequency of administration may be adjusted according to the severity of the subject's condition and treatment needs.

[0255] For gene-editing-based permanent treatments, a single-dose regimen is preferred in some embodiments. In some embodiments, the treatment method also includes combining the above-described product with at least one additional lipid-lowering or anti-atherosclerotic therapeutic agent.

[0256] To further understand the present invention, the present invention will be described in detail below with reference to specific embodiments.

[0257] Example 1

[0258] 1. gRNA design

[0259] This embodiment targets the codon corresponding to amino acid 97 (E97) of the encoded protein in the LIPC gene, designing a Cas9-based adenine base editing (ABE) scheme to edit the target adenine (A) at this site into guanine (G), thereby introducing the E97G protective mutation. Based on the location of the adenine to be edited in the original interstitial region (denoted as Cx, covering C9 to C18) and the guide sequence length (15–25 bp), and combined with the recognition characteristics of different Cas proteins (including SpRY Cas9, SpCas9 (WT), SpCas9-NG, SpG Cas9, and SpCas9-VQR) for PAM, a series of gRNA guide sequences were systematically designed. The designed guide sequences and their corresponding editing site locations, lengths, and available Cas proteins are shown in Table 1.

[0260] Table 1. ABE Scheme Based on Cas9

[0261] Understandably, gRNA can be selected from bimolecular guide RNA (dgRNA, also known as crRNA and trRNA), single-molecule guide RNA (sgRNA), or multimolecular guide RNA.

[0262] This embodiment uses a single gRNA molecule, which contains the following structure: 5'-[guide sequence]- guuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu[gRNA backbone sequence](SEQ ID NO:400)-3'. If the guide sequence of this gRNA corresponds to the target sequence numbered 1 above, then the complete gRNA sequence is tgctagaaaactggaguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu (SEQ ID NO:401).

[0263] 2. gRNA synthesis

[0264] 2.1 Construction of gRNA plasmids

[0265] The DNA sequences corresponding to the gRNA guide sequences in Table 1 above were synthesized using conventional methods. The sense and antisense strands were added to the 5' end of the sense strand, the aaac strand to the 5' end of the antisense strand, and the C strand to the 3' end of the antisense strand.

[0266] Take 2 µl of each of the sense strand (Oligo-F) and antisense strand (Oligo-R) of the DNA sequence corresponding to the above gRNA guide sequence, add 2 µl of NEB 10x cuttersmart buffer, and 14 µl of H2O. Incubate in a PCR instrument at 95 °C for 5 minutes, then immediately remove and incubate on ice for 5 minutes to anneal and form a double-stranded guide sequence DNA with sticky ends.

[0267] The double-stranded guide sequence DNA with sticky ends was ligated to the BpiI digestion product (linearized vector) of a plasmid vector containing a gRNA backbone sequence (e.g., PUC19-U6 promoter-BpiI-BpiI-gRNA backbone, the PUC19-U6 background plasmid is derived from ADDGENE #121958, and the gRNA backbone sequence is: gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc) (SEQ ID NO:402) using T4 ligase. The ligation product was transformed, and single colonies were selected for PCR testing and Sanger sequencing verification to obtain positive clones, i.e., gRNA plasmids.

[0268] 2.2 Synthesis and Chemical Modification of gRNA

[0269] Based on the gRNA guide sequence list in Table 1 above, gRNAs modified with methyl and phosphate thioester bonds were synthesized and modified chemically for later use.

[0270] For example, the synthetic sequence and modification of a single-molecule gRNA1 are: 5'- mT mG mC TAGAAAACTGGA -GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGGCU mU mU mU-3' (SEQ ID NO:403) (underlined sequence, m indicates 2'-O-methyl modification) (Indicates thiophosphate bond modification).

[0271] Example 2

[0272] 1. Design of TALE binding sequences

[0273] Compared to the CRISPR-Cas system, transcription activator-like effector (TALE) proteins only have the activity of binding to DNA double strands but cannot unwind them. Therefore, simply binding single-stranded DNA deaminases to TALEs cannot achieve efficient base editing of DNA. To achieve efficient editing, scientists have successfully created a TALE version of a single-base editor by integrating nickases (such as nCas9, BspD6I(C), and FokI proteins) and deaminases on top of the targeted capabilities provided by the TALE system.

[0274] This embodiment designs a TALE-based adenine base editing (ABE) scheme. The scheme employs a two-peptide structure comprising a first peptide and a second peptide: the first peptide, from its N-terminus to its C-terminus, sequentially contains an NLS, a TALE recognition module (TALE Left), and an adenine deaminase; the second peptide, from its N-terminus to its C-terminus, sequentially contains an NLS, a TALE recognition module (TALE Right), and a single-strand cleavage enzyme. The two TALE recognition modules bind to the two strands of the target DNA double strand, forming an editing window containing the target adenine between the two modules. The designed combinations of the TALE Left, editing window, and TALE Right recognition sequences are shown in Table 2.

[0275] Table 2 ABE Scheme Based on TALE

[0276] 2. TALE-ABE Synthesis and mRNA Preparation

[0277] After the TALE sequence was designed, it was synthesized and assembled into eukaryotic expression vectors and IVT vectors by a vector construction company. The synthesized eukaryotic expression vectors can be directly used for cell line testing. The IVT vector was linearized by HindIII single enzyme digestion to obtain a linearized vector. After purification, 5 μg of the linearized vector was used as a template for in vitro IVT reaction, followed by in vitro transcription at 37℃ for 4 h to prepare mRNA. After the reaction, 2 μl of DNase I was added, and the template strand was digested at 37℃ for 15 min. Half a volume of lithium chloride was added, mixed well, and incubated at -20℃ overnight. The next day, the RNA was precipitated by centrifugation at 13000g for 10 min at 4℃, washed twice with 70% ethanol, air-dried, and dissolved in an appropriate amount of sterile enzyme-free water for later use.

[0278] Example 3

[0279] 1. Design of pegRNA

[0280] This embodiment designs a prime editing (PE) scheme to introduce the E97G variant into the LIPC gene. The scheme employs a prime editor containing nap DNAbp (e.g., the Cas9 nickase nSpRY-H840A) and reverse transcriptase, and a pegRNA containing a spacer sequence, a reverse transcription template (RT template) sequence, and a primer binding site (PBS) sequence. Through the design of combinations of spacer, RT template, and PBS sequences and lengths, the prime editor creates a nick at the target site and writes the target base change using the RT template. The designed spacer, RT template, and PBS combinations are shown in Table 3.

[0281] Table 3 Preview Editing Scheme

[0282] This embodiment uses a single-molecule pegRNA, which contains the following structure: 5'-[spacer sequence]- guuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc [pegRNA backbone sequence] (SEQ ID NO: 404)-[RT sequence]- [PBS sequence]-uuuu-3', or 5'-[spacer sequence]-guuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc[pegRNA backbone sequence]-[RT sequence]-[PBS sequence]-caggagcccccccccugaacccaggauaacccucaaagucggggggc [hairpin structure] (SEQ ID NO: 405)- uuuu-3'.

[0283] If the guide sequence of this pegRNA corresponds to the target sequence numbered 1 above, then the complete gRNA sequence is: 5'-[tccctctgtcccctcctcag]-guuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc-[cctagcacgccgtccacctg]-[aggaggggacag]-uuuu-3' (SEQ ID NO: 406, named pegRNA-1), or: 5'-[tccctctgtcccctcctcag]-guuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggug c-[cctagcacgccgtccacctg]-[aggaggggacag]-[caggagcccccccccugaacccaggauaacccucaaagucggggggc]-uuuu-3' (SEQ ID NO: 407).

[0284] 2. Preparation of pegRNA

[0285] 2.1 Construction of pegRNA / epegRNA plasmids

[0286] The complete pegRNA sequence in Table 3 above was synthesized using conventional methods, and primers were designed to amplify the full-length pegRNA through gene fusion. The purified PCR fragment was recombined with the BpiI digestion product (linearized vector) of the pegRNA backbone sequence plasmid vector. The ligation product was transformed, and single colonies were selected for PCR testing and Sanger sequencing verification. Positive clones, i.e., pegRNA plasmids, were obtained through screening.

[0287] 2.2 PEGRNA / EpegRNA Synthesis and Chemical Modification

[0288] Based on the pegRNA guide sequence list in Table 3 above, pegRNAs modified with methyl and thiophosphate bonds were synthesized and modified by chemical means for later use.

[0289] For example, the synthetic sequence and modification of a single-molecule pegRNA1 are as follows: 5'-mT mC mC CTCTGTCCCCTCCTCAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGGCCCTAGCACGCCGTCCACCTGAGGAGGGGACAGU mU mU mU-3' (SEQ ID NO: 408).

[0290] For example, the synthetic sequence and modification of a single-molecule epigRNA1 are as follows: 5'-5'-mT mC mC CTCTGTCCCCTCCTCAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCCCTAGCACGCCGTCCACCTGAGGAGGGGACAGCAGGAGCCCCCCCCCUGAACCCAGGAUAACCCUCAAAGUCGGGGGGCU mU mU mU-3' (SEQ ID NO: 409) (m indicates 2'-O-methyl modification, (Indicates thiophosphate bond modification).

[0291] Example 4

[0292] Preparation of an adenine base editor (ABE) based on Cas9.

[0293] This embodiment describes the preparation of an adenine base editor (ABE) for editing the target adenine (A) in the LIPC gene corresponding to the 97th amino acid (E97) codon of the encoded protein to guanine (G). The ABE is a fusion protein containing an adenine deaminase domain and a Cas9 nickase (nSpRYCas9, amino acid sequence shown in Table 4). Guided by gRNA, it deaminates the target adenine within the editing window, achieving the conversion from A·T to G·C through base repair.

[0294] In this embodiment, ABE composed of three different adenine deaminases was used, denoted as ABE8r, ABE8e and ABE16, respectively. The adenine deaminases used were TadA8r, TadA8e and TadA16, respectively, and their amino acid sequences are shown in Table 4.

[0295] Table 4. Sequence information of ABE base editor

[0296] Example 5

[0297] ABE base editor and gRNA were delivered to huh7 host cells.

[0298] 1. Cell Culture

[0299] Huh7 cells (human hepatocellular carcinoma cell line, endogenously expressing LIPC) were cultured in DMEM containing 10% FBS in a 37°C, 5% CO2 incubator. Cells in logarithmic growth phase were harvested at approximately 2 × 10^6 cells / cells. 5 The cells were seeded into 24-well plates and incubated for 24 hours before being used for transfection.

[0300] 2. Liposome transfection

[0301] Take OPTI-MEM, add the ABE base editor plasmid obtained in Example 2 and the gRNA plasmid obtained in Example 1, and gently mix to obtain complex A; take OPTI-MEM and Lipofectamine 3000 (or Lipofectamine 2000) transfection reagent and gently mix to obtain complex B, and let stand at room temperature for 5 minutes; gently mix complex A and B, let stand at room temperature for 15-20 minutes to allow the complex to form, then add to a 24-well plate and continue to incubate for 72 hours.

[0302] Alternatively, the GeticoFect mRNA transfection reagent can be used to directly mix ABE mRNA and synthesized gRNA, and then transfect the mixture with the GeticoFect mRNA transfection reagent.

[0303] 3. Plasmid electroporation

[0304] Electroporation can also be used for delivery. Collect and count huh7 cells, taking approximately 0.5 × 10^6 cells, centrifuge to remove the supernatant, resuspend in approximately 20 μL of electroporation buffer (a mixture of ABE base editor plasmid solution / gRNA plasmid solution / electroporation buffer), transfer to an electroporation cuvette, and select the corresponding electroporation program for electroporation. After electroporation, add DMEM medium containing 10% FBS and continue culturing.

[0305] 4. Electroporation of RNA systems

[0306] ABE base editor mRNA and chemically synthesized gRNA were delivered into huh7 cells via electroporation. Approximately 0.5 × 10^6 cells were collected, centrifuged to remove the supernatant, resuspended in approximately 20 μL of electroporation mixture (a mixture of ABE base editor mRNA solution / gRNA solution / electroporation mixture), and electroporated again. The cells were then restored to culture as described above.

[0307] 5. RNP electro-rotator

[0308] ABE base editor protein and chemically synthesized gRNA were incubated in vitro and packaged into ribonucleoprotein (RNP), which was then delivered into huh7 cells via electroporation and cultured as before.

[0309] 6. Delivery of lipid nanoparticles (LNPs)

[0310] Encapsulating ABE base editor and gRNA plasmid DNA, mRNA, or ribonucleoprotein complexes in lipid nanoparticles can be used for in vitro delivery of ABE base editor-gRNA into cells, as well as for in vivo delivery.

[0311] 7. Sequencing after transfection

[0312] After culturing transfected cells for 72 hours, the cells were recovered, genomic DNA was extracted, and the target fragment covering the E97 codon (the 97th amino acid of the protein encoded by the LIPC gene) and the adjacent region was amplified by PCR (PCR primers can be routinely designed by those skilled in the art based on the LIPC genome sequence). The PCR product was sequenced using the Sanger method.

[0313] 8. Results Analysis

[0314] The sequencing results were analyzed using the EditR website (https: / / moriaritylab.shinyapps.io / editr_v10 / ) to determine the base editing efficiency from A to G. The E97G editing efficiency was characterized by the A→G conversion ratio of the target adenine (corresponding to codon E97) site within the editing window.

[0315] Example 6

[0316] Editing of the LIPC gene E97G in huh7 cells using the ABE8e base editor.

[0317] 1. Method

[0318] This embodiment refers to the liposome transfection method in Example 5, using GeticoFect mRNA transfection reagent. ABE mRNA and synthesized gRNA are directly mixed and transfected with GeticoFect mRNA transfection reagent. The target adenine is located at C10, C11, C12, C13, C14, C15, C16, C17, and C18, and the guide sequence length of gRNA is 20 bp (corresponding to serial numbers 17, 28, 39, 50, 61, 72, 83, 94, and 105 respectively, i.e., SEQ ID NO: 17, 28, 39, 50, 61, 72, 83, 94, and 105). These gRNAs are co-transfected with ABE8e base editor. After 72 hours of transfection and culture, the cells are recovered, genomic DNA is extracted, the target fragment is amplified by PCR, the PCR product is sequenced using the Sanger method, and the A→G editing efficiency at the E97 site is analyzed by EditR.

[0319] 2. Results

[0320] Sequencing results were analyzed using the EditR website to determine the A→G editing efficiency at the E97 site, as shown in Table 5. Figure 1 As shown.

[0321] Table 5. Efficiency of ABE8e base editor-mediated E97G editing of LIPC gene

[0322] The results showed that gRNAs with serial numbers 17, 28, 39, 50, 61, 72, 83, 94, and 105 (SEQ ID NO: 17, 28, 39, 50, 61, 72, 83, 94, and 105, all 20 bp in length) guided by the ABE8e base editor could achieve A→G editing of the target adenine in the E97 codon of the LIPC gene in huh7 cells, introducing the E97G protective mutation. Among them, the gRNAs targeting adenine at C12-C16 showed higher editing efficiency, all exceeding 20%.

[0323] Example 7

[0324] Editing of the LIPC gene E97G in huh7 cells using the ABE16 base editor.

[0325] 1. Method

[0326] This embodiment refers to the liposome transfection method in Example 5, using GeticoFect mRNA transfection reagent. ABE mRNA and synthesized gRNA are directly mixed and transfected with GeticoFect mRNA transfection reagent. The target adenine is located at C10, C11, C12, C13, C14, C15, C16, C17, and C18, and the guide sequence length of gRNA is 20 bp (corresponding to serial numbers 17, 28, 39, 50, 61, 72, 83, 94, and 105 respectively, i.e., SEQ ID NO: 17, 28, 39, 50, 61, 72, 83, 94, and 105). These gRNAs are co-transfected with ABE16 base editor. After 72 hours of transfection and culture, the cells are recovered, genomic DNA is extracted, the target fragment is amplified by PCR, the PCR product is sequenced using the Sanger method, and the A→G editing efficiency at the E97 site is analyzed by EditR.

[0327] 2. Results

[0328] Sequencing results were analyzed using the EditR website to determine the A→G editing efficiency at the E97 site, as shown in Table 6. Figure 2 As shown.

[0329] Table 6. Efficiency of ABE16 base editor-mediated E97G editing of LIPC gene

[0330] The results showed that gRNAs with serial numbers 17, 28, 39, 50, 61, 72, 83, 94, and 105 (SEQ ID NO: 17, 28, 39, 50, 61, 72, 83, 94, and 105, all 20 bp in length) guided by the ABE16 base editor could achieve A→G editing of the target adenine in the E97 codon of the LIPC gene in huh7 cells, introducing the E97G protective mutation. Among them, the gRNAs targeting adenine at C12-C15 showed higher editing efficiency, all exceeding 20%.

[0331] Example 8

[0332] Editing of the LIPC gene E97G in huh7 cells using the ABE8r base editor.

[0333] 1. Method

[0334] This embodiment refers to the liposome transfection method in Example 3, using GeticoFect mRNA transfection reagent. ABE mRNA and synthesized gRNA are directly mixed and transfected with GeticoFect mRNA transfection reagent. The target adenine is located at C10, C11, C12, C13, C14, C15, C16, C17, and C18, and the guide sequence length of gRNA is 20 bp (corresponding to serial numbers 17, 28, 39, 50, 61, 72, 83, 94, and 105 respectively, i.e., SEQ ID NO: 17, 28, 39, 50, 61, 72, 83, 94, and 105). These gRNAs are co-transfected with ABE8r base editor. After 72 hours of transfection and culture, the cells are recovered, genomic DNA is extracted, the target fragment is amplified by PCR, the PCR product is sequenced using the Sanger method, and the A→G editing efficiency at the E97 site is analyzed by EditR.

[0335] 2. Results

[0336] Sequencing results were analyzed using the EditR website to determine the A→G editing efficiency at the E97 site, as shown in Table 7. Figure 3 As shown.

[0337] Table 7. Efficiency of ABE8r base editor-mediated E97G editing of LIPC gene

[0338] The results showed that gRNAs with serial numbers 17, 28, 39, 50, 61, 72, 83, 94, and 105 (SEQ ID NO: 17, 28, 39, 50, 61, 72, 83, 94, and 105, all 20 bp in length) guided by the ABE8r base editor could achieve A→G editing of the target adenine in the E97 codon of the LIPC gene in huh7 cells, introducing the E97G protective mutation. Among them, the gRNAs targeting adenine at C13-C18 showed higher editing efficiency, all exceeding 20%.

[0339] Example 9

[0340] In this embodiment, a locked nucleic acid (LNA) modification is introduced into the gRNA guide sequence. LNA is a nucleotide analog that is locked between the 2′-O and 4′-C of the ribose ring by a methylene bridge. The LNA modification is placed at the 5′ end of the guide sequence (i.e., the distal end of PAM, outside the editing window).

[0341] 1. Method

[0342] Using gRNA (serial number 61, SEQ ID NO: 61, guide sequence 5′-TGCTAGAAAACTGGATCTGG-3′, where the target adenine is the 7th position from the 5′ end) with the target adenine located at C14 as the same site, unmodified gRNA and locked nucleotide modified gRNA were prepared respectively. The representative LNA modified gRNA has a guide sequence of 5′-+T+GCTAGAAAACTGGATCTGG-3′ (where +N indicates that the nucleotide at this position is locked nucleotide / LNA modified), that is, two LNAs are introduced near the end of the guide sequence at the 5′ end (far end of PAM, outside the editing window), while the target adenine (7th position) and its adjacent nucleotides within the editing window remain unmodified with LNA ribonucleotides; the remaining gRNA backbone sequence and the terminal 2′-O-methyl and phosphate thioester modifications are the same as in Example 1. Referring to the liposome transfection method in Examples 4-6, the above-mentioned unmodified or LNA-modified gRNA was co-transfected with the ABE8r, ABE8e, and ABE16 base editors prepared in Example 2 into huh7 cells. After 72 hours of transfection and culture, genomic DNA was extracted, the target fragment was amplified by PCR, and sequenced using the Sanger method. The A→G editing efficiency at the E97 site was analyzed using EditR.

[0343] 2. Results

[0344] Sequencing results were analyzed using the EditR website to determine the A→G editing efficiency at the E97 site, as shown in Table 8. Figure 4 As shown.

[0345] Table 8. Effects of locked nucleotide (LNA) modification on the efficiency of LIPC gene E97G editing mediated by three ABE base editors (C14 at the same site, 20 bp in length).

[0346] The results showed that at the same site (C14, sequence number 61, length 20 bp), modification of the gRNA at the 5′ end (far end of PAM) with locked nucleotides (LNA) significantly improved the editing efficiency of the LIPC gene E97G mediated by the three base editors ABE8r, ABE8e, and ABE16 compared to the gRNA without LNA modification, and this was statistically significant (P < 0.01). Therefore, introducing locked nucleotide modification at the far end of PAM can stabilize the R loop of Cas9, prolong the editor's residence on the target, and improve the editing efficiency of the LIPC gene E97G.

[0347] This embodiment also attempted to modify the target adenine and its adjacent nucleotides located within the editing window in gRNA using LNA. After testing, it was found that this could not improve the efficiency of LIPC gene E97G editing mediated by the three base editors ABE8r, ABE8e, and ABE16.

[0348] Example 10

[0349] This embodiment tests the effect of different gRNA lengths at the same site on the E97G editing efficiency of the LIPC gene.

[0350] 1. Method

[0351] Referring to the liposome transfection method in Example 5, GeticoFect mRNA transfection reagent was used to co-transfect huh7 cells with gRNAs targeting adenine C14 and guide sequence lengths of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, and 25 bp (corresponding to serial numbers 56 to 66, i.e., SEQ ID NO: 56 to 66) with an ABE8e base editor. After 72 hours of transfection and culture, genomic DNA was extracted, the target fragment was amplified by PCR, and sequenced using the Sanger method. The A→G editing efficiency at the E97 site was analyzed using EditR.

[0352] 2. Results

[0353] The sequencing results were analyzed using the EditR website, and the A→G editing efficiency of the E97 site is shown in Table 9.

[0354] Table 9. Editing efficiency of ABE8e repair of the E97 site of the LIPC gene mediated by gRNAs with different guide sequence lengths (C14 at the same site).

[0355] The results show that, under the condition that the target adenine is located at C14, gRNAs with guide sequence lengths in the range of 15-25 bp can mediate A→G editing of the target adenine in codon E97 of the LIPC gene by the ABE8e base editor, and the editing efficiency is over 20% when the gRNA guide sequence length is in the range of 16-25 bp.

[0356] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A gene editing system targeting LIPC, characterized in that, The gene editing system targets the LIPC gene, causing the 97th amino acid of the LIPC gene expression protein to be mutated from glutamic acid to glycine.

2. The gene editing system according to claim 1, characterized in that, The gene editing system targets adenine, the first codon of the LIPC gene encoding the 97th amino acid, and replaces adenine with guanine. The gene editing system is selected from the adenine base editing (ABE) system or the prime editing (PE) system.

3. The gene editing system according to claim 2, characterized in that, The gene editing system targets the nucleotide sequence at positions 58541752-58541851 of human chromosome 15 in the NCBI reference genome GRCh38, or the complementary sequence of the nucleotide sequence, or the nucleotide sequence with homology of not less than 80%, 90%, 95%, 98% or 99% of the nucleotide sequence, including but not limited to splice variants, mutants or conserved substitution-derived sequences of the natural sequence. Preferably, the gene editing system targets a nucleotide sequence consisting of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides in the nucleotide sequence.

4. The gene editing system according to claim 2 or 3, characterized in that, The adenine base editing (ABE) system includes a single-base editor, which includes a programmable DNA-binding protein and an adenine deaminase. The programmable DNA-binding protein is selected from any one of the following or a variant thereof: Cas protein, zinc finger nuclease (ZFN), transcription activator-like effector (TALE), meganuclease, Argonaute, HYER, IscB, IsrB, TnpB, or Fanzor; Preferably, the programmable DNA-binding protein is a nicking enzyme with single-strand nicking enzyme activity, or an inactive protein without nucleic acid cleavage activity; More preferably, the adenine deaminase is selected from TadA, TadA At least one of TadA7.10, TadA8e, TadA8.20, TadA9, TadA8r, TadA16 and their variants.

5. The gene editing system according to claim 4, characterized in that, The programmable DNA-binding protein is a guide RNA-dependent DNA-binding domain selected from Cas protein, Argonaute, IscB, IsrB, TnpB, or Fanzor; the ABE system also includes guide RNA (gRNA). The guide sequence of the gRNA has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% sequence identity with any of the sequences shown in SEQ ID NO: 1-SEQ ID NO: 110, or the guide sequence of the gRNA is selected from SEQ ID NO: 1-SEQ ID NO: 110 and / or mismatched sequences with SEQ ID NO: 1-SEQ ID NO: 110 containing 1-5 base mismatches.

6. The gene editing system according to claim 5, characterized in that, The gRNA-dependent programmable DNA-binding protein is selected from Cas proteins; The Cas protein includes at least one or a combination of the following: Cas9, CasX, CasY, Cpf1 (Cas12a), C2c1 (Cas12b), Cas12b2, Cas12h, Cas12i, Cas12g, C2c3, C2c5, C2c8, C2c9, fragments thereof, and mutants thereof or fragments thereof. Preferably, the Cas protein is selected from the nicking enzyme form of SpRY Cas9, SpCas9 (WT), SpCas9-NG, or SpG Cas9 (nCas9).

7. The gene editing system according to claim 6, characterized in that, The target adenine for editing is located at C9-C18; the guide sequence of the gRNA is 16-25 bp in length. Preferably, the target adenine for editing is located at C13-C15; the guide sequence of the gRNA is 17-24 bp in length.

8. The gene editing system according to claim 6, characterized in that, The adenine deaminase is TadA8e, and the target edited adenine is located at C12-C16; and / or The adenine deaminase is TadA16, and the target edited adenine is located at C12-C15; and / or The adenine deaminase is TadA8r, and the target edited adenine is located at C13-C18.

9. The gene editing system according to claim 4, characterized in that, The programmable DNA-binding protein is a guide RNA-independent DNA-binding domain selected from zinc finger nucleases (ZFN), transcription activator-like effectors (TALE), or meganucleases. The guide RNA-independent DNA binding domain is modified through protein engineering or directed evolution to recognize the target nucleotide sequence containing the first adenine in the codon encoding the 97th amino acid of the LIPC gene. Preferably, the ABE system is a TALE-based adenine base editor, comprising a first polypeptide and a second polypeptide; The first polypeptide contains, from N-terminus to C-terminus, a nuclear localization signal (NLS) sequence, a TALE recognition module, and adenine deaminase. The second polypeptide contains, from the N-terminus to the C-terminus, a nuclear localization signal (NLS) sequence, a TALE recognition module, and a single-chain cleavage enzyme. The TALE recognition module of the first polypeptide and the TALE recognition module of the second polypeptide respectively bind to the two strands of the target DNA double strand, forming an editing window containing the target adenine between the two modules. Optionally, the editing window of the TALE recognition module in the first and second polypeptides has a sequence as shown in any one of SEQ ID NO:121 to SEQ ID NO:140; And / or, the sequence identified by the TALE recognition module in the first polypeptide has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% sequence identity with any of the sequences shown in SEQ ID NO: 111 to SEQ ID NO: 120; And / or, the sequence identified by the TALE recognition module in the second polypeptide has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% sequence identity with any of the sequences shown in SEQ ID NO: 141 to SEQ ID NO: 206; For example, the recognition sequences corresponding to the TALE recognition module in the first and second polypeptides are shown in any combination of Table 2.

10. The gene editing system according to claim 3, characterized in that, The pilot editing (PE) system includes a pilot editor and a pilot editing guide RNA (pegRNA), wherein the pilot editor includes a nucleic acid programmable DNA-binding protein (napDNAbp) and a polymerase; The napDNAbp is covalently linked to the polymerase in the form of a fusion protein, or functionally bound via RNA aptamer-mediated trans-recruitment. The pegRNA contains, from the 5' to the 3' end, a guide sequence, a backbone sequence, a reverse transcription template (RT template) sequence, and a primer binding site (PBS) sequence. Preferably, the guide sequence of the pegRNA has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% sequence identity with any of the sequences shown in SEQ ID NO: 207 to SEQ ID NO: 246; the RT template sequence is selected from any of the sequences shown in SEQ ID NO: 247 to SEQ ID NO: 316; the PBS sequence is selected from any of the sequences shown in SEQ ID NO: 317 to SEQ ID NO:

396. For example, the guide sequence, RT template sequence, and PBS sequence of the pegRNA are shown in any combination as shown in Table 3.

11. The gene editing system according to any one of claims 5 to 8, or 10, characterized in that, The gRNA or pegRNA is chemically modified; The modification is selected from one or more of the following: thiophosphate bond modification, 2'-O-methyl modification, 2'-F modification, 2'-ribose 3'-thiophosphate modification, deoxy modification, 5' phosphate modification, peptide nucleic acid modification, and locked nucleic acid modification; Preferably, the three ribonucleotides at the 5' and 3' ends of the gRNA or pegRNA are modified with 2'-O-methyl, and the four adjacent ribonucleotides at the 5' and 3' ends are modified with phosphate thioester bonds; and / or the two ribonucleotides at the 5' end of the gRNA are modified with locked nucleic acid.

12. A guiding polynucleotide, characterized in that, The guiding polynucleotide is selected from: (a) gRNA of the gene editing system as described in any one of claims 5 to 8; (b) the pegRNA of the gene editing system as described in claim 10; or (c) or (a) of the form of chemical modification, wherein the modification is selected from one or more of the following: thiophosphate modification, 2'-O-methyl modification, 2'-F modification, 2'-ribose 3'-thiophosphate modification, deoxy modification, 5' phosphate modification, peptide nucleic acid modification and locked nucleic acid modification.

13. A polynucleotide, characterized in that, The polynucleotide encodes an editor in the gene editing system as described in any one of claims 1-13 and / or a guide polynucleotide as described in claim 14.

14. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the gene editing system as described in any one of claims 1-11, the guide polynucleotide as described in claim 12, the polynucleotide as described in claim 13, and a pharmaceutically acceptable carrier.

15. The use of the gene editing system of any one of claims 1-11, the guide polynucleotide of claim 12, the polynucleotide of claim 13, and / or the pharmaceutical composition of claim 14 in the preparation of a medicament for treating hypercholesterolemia and / or atherosclerotic cardiovascular disease.

Images