Polydeoxyribonucleotides, nucleic acid tetrahedra, and methods of making and using the same

Abstract

The application provides a kind of polydeoxyribonucleotide and its use, the polydeoxyribonucleotide includes the sequence as shown in any one of SEQ ID NO:1-12 or consists of the sequence as shown in any one of SEQ ID NO:1-12, the polydeoxyribonucleotide is obtained by programmed code screening PDRN short sequence that retains core anti-inflammatory, antioxidant activity, the PDRN short sequence can be self-assembled to form nucleic acid tetrahedron, with the high cell penetration of nucleic acid tetrahedron, anti-degradation and PDRN short sequence anti-inflammatory, antioxidant activity, and preparation method is simple, high repeatability, suitable for industrial production.

Description

Technical Field

[0001] This application relates to the fields of biotechnology and biomaterials technology, specifically to a nucleic acid tetrahedron constructed from a specific PDRN short sequence obtained through programmed screening, and its preparation method, as well as the application of this nucleic acid tetrahedron in the preparation of anti-inflammatory, antioxidant, and skin-repairing cosmetics and pharmaceutical products. Background Technology

[0002] Polydeoxyribonucleotides (PDRNs) are widely used in the fields of skin medicine and cosmetics due to their biological activities that promote cell proliferation, tissue repair, and angiogenesis. However, traditionally extracted PDRNs suffer from problems such as random sequences, unstable activity, and large batch-to-batch variations. Chinese patent application CN 120859873 A has developed PDRNs with defined sequences, which solves the above defects. Moreover, this type of PDRN with specific sequences can significantly promote VEGF expression and has excellent skin repair effects.

[0003] Nucleic acid tetrahedrons (TDNs), as three-dimensional DNA nanostructures, possess structural stability, good biocompatibility, and excellent cell penetration and transdermal properties, making them ideal carriers for functional nucleic acids. By combining PDRN sequences with nucleic acid tetrahedrons, the structural advantages of TDNs can be leveraged to enhance the cellular uptake efficiency and anti-degradation ability of PDRN, thereby achieving highly efficient exertion of PDRN bioactivity. Therefore, nucleic acid tetrahedrons derived from PDRN sequences have become a research hotspot for skin bioactive ingredients.

[0004] Existing technologies include research on nucleic acid tetrahedrons derived from salmon PDRN sequences. This type of technology constructs nucleic acid tetrahedrons by designing multiple sets of PDRN-derived sequences and screening out sequences that have the effect of inhibiting melanin production. However, it only focuses on whitening effects, and the sequence screening relies on artificial design and routine experimental verification, which has problems such as low screening efficiency and poor sequence targeting.

[0005] Furthermore, existing PDRN sequence screening methods are all artificially designed and validated in vitro, lacking standardized and procedural screening methods. This makes it difficult to quickly and accurately screen short sequences that retain core biological activities from known specific PDRN sequences, resulting in low efficiency in constructing nucleic acid tetrahedra and difficulty in guaranteeing sequence functionality. Moreover, existing PDRN-based nucleic acid tetrahedra have not been developed for anti-inflammatory and antioxidant functions, failing to meet the demand for multifunctional active ingredients in the skin care field, and lacking sufficient technical extensibility with existing PDRN sequences.

[0006] In summary, there is an urgent need for a nucleic acid tetrahedron constructed from a known specific PDRN sequence (SEQ ID NO:13-21) through programmed screening to obtain short sequences with core functions. This would address the technical shortcomings of existing technologies, such as low sequence screening efficiency, insufficient integration with existing specific PDRN technologies, and limited functionality, thereby achieving synergistic effects of anti-inflammatory, antioxidant, and skin repair. Summary of the Invention

[0007] To address the technical problems existing in the prior art, this application provides a nucleic acid tetrahedron constructed by obtaining core functional short sequences through programmed screening based on a known specific PDRN sequence (SEQ ID NO: 13-21). This solves the technical defects of low sequence screening efficiency, insufficient connection with existing specific PDRN technology, and single function in the prior art, and achieves synergistic effects of anti-inflammatory, antioxidant, and skin repair.

[0008] The specific technical solution of this application is as follows: 1. A polydeoxyribonucleotide comprising or consisting of any of the sequences shown in SEQ ID NO:1-12.

[0009] 2. A method for screening polydeoxyribonucleotides, comprising: Use a sliding window to scan any original polydeoxyribonucleotide to extract a fragment of a given size; The given-size fragment is filtered to obtain fragment one with a given GC content; Calculate the matching threshold between the fragment with a given GC content and the reverse complementary chain of the fragment to obtain the fragment with the given matching threshold; Calculate the pairwise complementary matrix of the segments with the given matching threshold to obtain segment two with the given GC content; Calculate the Tm value of fragment two with a given GC content to obtain fragments with a given Tm value, resulting in fragment two with a given GC content, fragments with a given Tm value, fragments of a given size, and fragments with dispersed start positions, all of which are polydeoxyribonucleotides.

[0010] 3. The method according to item 2, which is used to screen for polydeoxyribonucleotides suitable for forming nucleic acid tetrahedra.

[0011] 4. The method according to item 2 or 3, wherein in the filtration process, fragments of consecutive identical bases having a given value are filtered out, optionally, the given value is four or more; Optionally, in calculating the pairwise complementary matrix of the segments that meet the given matching threshold, segments that are greater than the given matching threshold are filtered out. Optionally, the Nearest-Neighbor method is used to calculate the Tm value; Optionally, the given size segment refers to a segment of size 20-25 nt; and / or The fragment with the given GC content refers to fragment one with a GC content of 40-60%; and / or The given matching threshold segment refers to a segment with ≤3 matches; and / or The second fragment with a given GC content refers to a second fragment with a GC content of 40-60%; and / or The segment with a given Tm value refers to a segment within the range of Tm ± 2℃; Optionally, any of the polydeoxyribonucleotides comprises or consists of any of the sequences shown in SEQ ID NO:1-12.

[0012] 5. A system for screening polydeoxyribonucleic acid (PDA), wherein the system includes a memory, a processor, and a program stored in the memory and executable on the processor for screening PDA, wherein the PDA screening program, when executed by the processor, implements the steps of the method described in any one of items 2-4.

[0013] 6. A polydeoxyribonucleotide-nucleic acid tetrahedron, wherein the sequence of the polydeoxyribonucleotide comprises the sequence described in claim 1; Preferably, the nucleic acid tetrahedron is formed by the self-assembly of four single-stranded polydeoxyribonucleotides; Optionally, the sequences of the four single-stranded polydeoxyribonucleotides include sequences as shown in SEQ ID NO:1-4, SEQ ID NO:5-8, or SEQ ID NO:9-12; or consist of sequences as shown in SEQ ID NO:1-4, SEQ ID NO:5-8, or SEQ ID NO:9-12.

[0014] 7. Use of the polydeoxyribonucleotide described in item 1 or the polydeoxyribonucleotide-nucleic acid tetrahedron described in item 6 in the preparation of anti-inflammatory and / or antioxidant products.

[0015] 8. Use of the polydeoxyribonucleotide described in item 1 or the polydeoxyribonucleotide-nucleic acid tetrahedron described in item 6 in the preparation of articles that promote transdermal absorption.

[0016] 9. The use according to item 7 or 8, wherein the article comprises cosmetic or pharmaceutical products.

[0017] 10. Use of the polydeoxyribonucleotides described in item 1 in the formation of nucleic acid tetrahedra.

[0018] Beneficial effects The polydeoxyribonucleic acid (PDRN) described in this application is obtained by screening short PDRN sequences that retain core anti-inflammatory and antioxidant activities through programmed code. These sequences are then combined with a nucleic acid tetrahedral backbone to construct a novel nucleic acid tetrahedron, which combines the high cell penetration and anti-degradation properties of the nucleic acid tetrahedron with the anti-inflammatory and antioxidant activities of the short PDRN sequence. Furthermore, the preparation method is simple, highly reproducible, and suitable for industrial production. At the same time, this application represents a deep extension and innovation of known specific PDRN technologies, providing a novel, highly efficient, and multifunctional bioactive ingredient for the field of skin care. Attached Figure Description

[0019] Figure 1 This is a schematic diagram of a PDRN-nucleic acid tetrahedral structure according to a specific embodiment of this application.

[0020] Figure 2 This is a schematic diagram of PDRN-nucleic acid tetrahedral self-assembly gel electrophoresis according to a specific embodiment of this application.

[0021] Figure 3 This is a schematic diagram of the secretion level of the inflammatory factor IL-8 in a PDRN-nucleic acid tetrahedron according to a specific embodiment of this application.

[0022] Figure 4 This is a schematic diagram of the antioxidant properties of a PDRN-nucleic acid tetrahedron according to a specific embodiment of this application.

[0023] Figure 5 This is a schematic diagram illustrating PDRN cell uptake verification according to a specific embodiment of this application. Detailed Implementation

[0024] The present application will now be described in detail with reference to the described embodiments. Although specific embodiments of the present application are shown, it should be understood that the present application can be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this application will be thorough and complete, and will fully convey the scope of the present application to those skilled in the art.

[0025] It should be noted that certain terms are used in the specification and claims to refer to specific components. Those skilled in the art will understand that different terms may be used to refer to the same component. This specification and claims do not distinguish components based on differences in terminology, but rather on differences in function. The terms "comprising" or "including" used throughout the specification and claims are open-ended and should be interpreted as "comprising but not limited to." The following descriptions in the specification are preferred embodiments for carrying out this application; however, these descriptions are for the purpose of understanding the general principles of the specification and are not intended to limit the scope of this application. The scope of protection of this application shall be determined by the appended claims.

[0026] This application provides a polydeoxyribonucleotide comprising or consisting of any of the sequences shown in SEQ ID NO:1-12.

[0027] The sequence of SEQ ID NO:1 is as follows: ACGAGACATTCTGTAGGAACGAACTGGACTTGGCATGAAAGGAAGGTTTGATGAAAGGGTTGC The sequence of SEQ ID NO:2 is as follows: ACGTTCCTACAGAATGTCTCGAGCCGCCTGACATTTTAGCCTAAGTTGGGCATAATTACCGCA The sequence of SEQ ID NO:3 is as follows: ACTGTTTTGTGATTTGGTGACACCTTTCATGCCAAGTCCAGTATGCGGTAATTATGCCCAACT The sequence of SEQ ID NO:4 is as follows: AGTCACCAAATCACAAAACAGAAGGCTAAAATGTCAGGCGGCAGCAACCCTTTCATCAAACCT The sequence of SEQ ID NO:5 is as follows: AAATGTGACTGAGGTCTGACCAAAACTGGACAAGGTGTGCACACCTGTGGTAGTATGATGAGC The sequence of SEQ ID NO:6 is as follows: AGGTCAGACCTCAGTCACATTATGAAGTGTGGATCCTAACCCACAAACAATGGCAAGAGCGTC The sequence of SEQ ID NO:7 is as follows: ATGAAGCGGAAGGCAAGAACAAGTGCACACCTTGTCCAGTTTAGACGCTTCTTGCCATTGTTTG The sequence of SEQ ID NO:8 is as follows: ATTGTTCTTGCCTTCCGCTTCAAGGGTTAGGATCCACACTTCAAGCTCATCATACTACCACAGG The sequence of SEQ ID NO:9 is as follows: AACACGGTGATATATCCTGGGAATCCTGGGTTACGACAATGGATGTTGGCGAATGGAAAGCTG The sequence of SEQ ID NO:10 is as follows: ACCCAGGATATATCACCGTGTATCCCTCCTCTACTAGATGAGAGAGCCTTATGGGTACAATCC The sequence of SEQ ID NO:11 is as follows: AGCAGACCTACGCACTTACTTACCATTGTCGTAACCCAGGATAGGATTGTACCCATAAGGCTC The sequence of SEQ ID NO:12 is as follows: AAAGTAAGTGCGTAGGTCTGCACTCATCTAGTAGAGGAGGGAACAGCTTTCCATTCGCCAACA In some embodiments, the four polydeoxyribonucleotides self-assemble to form a nucleic acid tetrahedron, wherein the sequences of the four single-stranded polydeoxyribonucleotides include sequences as shown in SEQ ID NO:1-4, sequences as shown in SEQ ID NO:5-8, or sequences as shown in SEQ ID NO:9-12; the nucleic acid tetrahedron possesses the high cell penetration and anti-degradation properties of nucleic acid tetrahedrons, as well as the anti-inflammatory and antioxidant activities of short PDRN sequences.

[0028] This application provides a method for screening polydeoxyribonucleotides, comprising: Use a sliding window to scan any original polydeoxyribonucleotide to extract a fragment of a given size; The given-size fragment is filtered to obtain fragment one with a given GC content; Calculate the matching threshold between the fragment with a given GC content and the reverse complementary chain of the fragment to obtain the fragment with the given matching threshold; Calculate the pairwise complementary matrix of the segments with the given matching threshold to obtain segment two with the given GC content; Calculate the Tm value of fragment two with a given GC content to obtain fragments with a given Tm value, resulting in fragment two with a given GC content, fragments with a given Tm value, fragments of a given size, and fragments with dispersed start positions, all of which are polydeoxyribonucleotides.

[0029] In some embodiments, the above method is used to screen for polydeoxyribonucleotides suitable for forming nucleic acid tetrahedra, which self-assemble to form nucleic acid tetrahedra.

[0030] In some implementations, a sliding window is used to scan any original polydeoxyribonucleotide to extract a fragment of a given size, which is 20-25 nt, for example, the given size can be 20 nt, 21 nt, 22 nt, 23 nt, 23 nt, or 2 nt.

[0031] When scanning any original polydeoxyribonucleotide, sequences containing illegal bases are filtered out.

[0032] In the filtration process, fragments with consecutive identical bases having a given value are filtered out, optionally, the given value is four or more.

[0033] In some implementations, segments with a value greater than the given matching threshold are filtered out from the pairwise complementary matrix of the segments for which the given matching threshold is calculated; optionally, the segments with the given matching threshold refer to segments with a matching number ≤ 3, and selecting segments with a matching number ≤ 3 can avoid hairpin structures.

[0034] In some implementations, the Nearest-Neighbor method is used to calculate the Tm value, and it is corrected using salt concentration.

[0035] In some implementations, the fragment with a given GC content refers to a fragment with a GC content of 40-60%; and / or The second fragment with a given GC content refers to a second fragment with a GC content of 40-60%; and / or The segment with a given Tm value refers to a segment within the range of Tm ± 2℃.

[0036] For example, a segment with a given GC content refers to a segment with a GC content of 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, or any range thereof. The second segment with a given GC content refers to a segment with a GC content of 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, or any range thereof.

[0037] In some embodiments, any polydeoxyribonucleotide comprises or consists of any of the sequences shown in SEQ ID NO:1-12.

[0038] This application uses the above-mentioned method to achieve fully automated and standardized screening, replacing manual design. The screening target is sequences with a length of 20–25 nt, composed of A / T / C / G, GC content of 40%–60%, no four or more consecutive identical bases, self-complementary maximum consecutive matching bases ≤3, pairwise cross-complementary maximum consecutive matching bases ≤3, and Tm value within the mean ±2℃ range. The obtained sequences can be used for tetrahedral construction.

[0039] This application provides a system for screening polydeoxyribonucleic acid (PDA), wherein the system includes a memory, a processor, and a program stored in the memory and executable on the processor for screening PDAs, wherein the PDA screening program, when executed by the processor, performs the steps of any of the methods described above.

[0040] This application provides a polydeoxyribonucleic acid tetrahedron, wherein the nucleic acid tetrahedron is self-assembled from four single-stranded polydeoxyribonucleic acids, and the sequences of the four single-stranded polydeoxyribonucleic acids include the sequences shown in SEQ ID NO:1-4, SEQ ID NO:5-8, or SEQ ID NO:9-12; or are composed of the sequences shown in SEQ ID NO:1-4, SEQ ID NO:5-8, or SEQ ID NO:9-12.

[0041] The nucleic acid tetrahedron can be prepared by self-assembly using methods commonly used in the art. For example, the method includes mixing and reacting four single-stranded polydeoxyribonucleotides in a buffer system; terminating the reaction after the single-stranded polydeoxyribonucleotides form nucleic acid tetrahedrons; the sequences of the four single-stranded polydeoxyribonucleotides include the sequences shown in SEQ ID NO:1-4, SEQ ID NO:5-8, or SEQ ID NO:9-12; or are composed of the sequences shown in SEQ ID NO:1-4, SEQ ID NO:5-8, or SEQ ID NO:9-12.

[0042] In some embodiments, the four single-stranded polydeoxyribonucleotides are mixed in equimolar concentrations.

[0043] In some embodiments, the reaction temperature is 90~98°C, for example, the reaction temperature is 90°C, 91°C, 92°C, 93°C, 94°C, 95°C, 96°C, 97°C, 98°C, etc., or any range between them; the reaction time is 3 min or more, preferably 3~30 min or more, for example, the reaction time is 3 min, 4 min, 5 min, 6 min, 7 min, 8 min, 9 min, 10 min, 15 min, 20 min, 25 min, 30 min, etc., or any range between them.

[0044] In some embodiments, the temperature for terminating the reaction is 1~10℃, for example, the temperature for terminating the reaction is 1℃, 2℃, 3℃, 4℃, 5℃, 6℃, 7℃, 8℃, 9℃, 10℃, etc., or any range thereof; the holding time is 10 min or more, preferably 10~60 min, for example, the holding time is 10 min, 11 min, 12 min, 13 min, 14 min, 15 min, 16 min, 17 min, 18 min, 19 min, 20 min, 21 min, 22 min, 23 min, 24 min, 25 min, 26 min, 27 min, 28 min, 29 min, 30 min, 31 min, 32 min, 33 min, 34 min, 35 min, 36 min, 37 min, 38 min, 39 min, 40 min, 45 min, 50 min, 55 min, 60 min, etc., or any range thereof.

[0045] In some embodiments, the pH value of the buffer system is 6.5 to 8.5, for example, the pH value of the buffer system is 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, or any range thereof.

[0046] This application provides the use of the polydeoxyribonucleotides described above or any of the polydeoxyribonucleotide-nucleic acid tetrahedra described above in the preparation of anti-inflammatory and / or antioxidant products.

[0047] The polydeoxyribonucleotides described in this application or the polydeoxyribonucleotide-nucleic acid tetrahedrons described above can significantly inhibit the secretion level of the inflammatory factor IL-8 and significantly reduce the intracellular ROS level, and therefore can be used to prepare anti-inflammatory and / or antioxidant products.

[0048] This application provides the use of the aforementioned polydeoxyribonucleotide or any of the above-described polydeoxyribonucleotide-nucleic acid tetrahedron in the preparation of articles that promote transdermal absorption.

[0049] This application utilizes the aforementioned polydeoxyribonucleotides to construct nucleic acid tetrahedra or the aforementioned polydeoxyribonucleotide-nucleic acid tetrahedra to achieve cellular uptake, that is, the tetrahedra can effectively penetrate the cell membrane and enter the cell to achieve intracellular delivery. Therefore, the aforementioned polydeoxyribonucleotides or the aforementioned polydeoxyribonucleotide-nucleic acid tetrahedra can be used to prepare products that promote transdermal absorption.

[0050] In some embodiments, the article comprises cosmetic or pharmaceutical products.

[0051] This application provides the use of the aforementioned polydeoxyribonucleotides in the formation of nucleic acid tetrahedra.

[0052] The polydeoxyribonucleotides described in this application can self-assemble into nucleic acid tetrahedra. These nucleic acid tetrahedra combine the high cell penetration and anti-degradation properties of nucleic acid tetrahedra with the anti-inflammatory and antioxidant activities of short PDRN sequences. Furthermore, the preparation method is simple, highly reproducible, and suitable for industrial production.

[0053] Example This application provides a general and / or specific description of the materials and test methods used in the experiments. In the following examples, unless otherwise specified, % represents wt%, i.e., weight percentage. Reagents or instruments used, unless otherwise specified, are all commercially available conventional reagent products.

[0054] Example 1: Screening Short Sequences The first round of rigorous assembly screening was conducted based on the nine PDRN candidate parent sequences recorded in CN 120859873 A. The specific operation method is as follows, and the nine sequences are as follows: tatgcaccctaacccaaaggccatatcaaatgaatggtatgattttgtcaggtgtgctaaaaatcaacatgtaccttgtcgcctttccctgaagctgctgtgccattgaaagtgaattcaaggttcaacatta (SEQ ID NO: 13) gttaccccttatcgaatctgctttcggcctactatcccagctgagttggttaatgaaccaaaatcatattttactgactgttgctgttgagtttcttgtatctttatcagcaacaatttgggggaggacattc (SEQ ID NO: 14) gcatggatgaattctgtgttactttgtctgttgtgaatgcagtcagacaccatgcaataacattttcacttctactactctaaaggatgagtgcttccccagtgccttatctccttcacatcaaagtgaatgcaatg (SEQ ID NO: 15) tgacttttatcaccatcttcatctggacacttgtcttctacatcaagggtaaaacaaacaaagaagagttatgtgtttgtataatgaaaagtaatacatttgagtgaaccgaatgattgttttattcatttctggtgatgtacaattattagtgtttctatgtttcagaatcaagaggacagatcactgcgactcagactcctacaatgaaagctgttctctcaggacagccagtctctctgaactgtagaaccag tagtaatgtatatggtaattgttacaatggtcagtcatggaaccatcagtgtctatcctggtaccaacagaaaccaggagaaaaacccaaactaataatgcttccagggaacacactccattctgggac tccatctagattcagtggcagtggatctgggagtgacttcactctgaccatcagtggagtccaggctgaagatgcaggagattactactgtcagagtttacactaccccaacagtgtctgggtgt(SEQ ID NO:16) gtcattacatcactgatgaggtcacttcctgttcctcctctccagtcagttcagatgagatgagatgtcagttggttgtcaatgatcactaagtcaacatgatcacaactcttatcattatcactgtcccactattctggattacaggtaatttaaacttcagatatttagtagttccctacattacctattaaacatgaaaatgtaacaatttgcctaaatgtgtacaaataattactaattatatgttttattcaaacttaagaaatggtggtacaatcctttgttatgtcctctgtctccgcccaggtgtctctctcagtaaatcagcgtaccagtctccctctacgtctctggtgatgcctaatgcctctgtcacactcaactgcagtcataaaatccccagctatgacacagtcctctggtacaagcgttctgtggaagacacggctctaaacctcatagcttatatatactataaaaccccaacagttgaaccctcatataaaggtcactttgatgtgagaggagatggagagaacgatgctttccttcatatcctcaaaccgagacaagctgaagacagtggggagtatttctgtgctgccagtctacacagtggtacagagacctagtccactctacaaaaacctccatctgacactacatcaaaacacctgcatta(SEQ ID NO:17) (SEQ ID NO:18)

[0055] Sliding window scanning: After preprocessing the above sequences according to conventional methods in the art, fragments are extracted using a 20-25nt window, and sequences containing illegal bases are filtered out to obtain the initial candidate domains; GC+ repetitive sequence filtering: Retain sequences with 40%-60% GC content and filter fragments containing 4 or more consecutive identical bases. Self-complementary filtering: Calculate the maximum number of matches between the segment and its own reverse complementary chain, and retain segments with ≤3 matches to avoid hairpin structures; Cross-complementary filtering: Calculate the pairwise cross-complementary matrix for segments with ≤3 matching numbers, filter sequences with >3 matching numbers, and retain segments with GC close to 50% in case of conflict to avoid dimers; Tm value homogenization screening: Tm values ​​(salt concentration correction) were calculated using the Nearest-Neighbor method. Fragments within the Tm value ±2℃ range were retained to ensure that synchronous self-assembly yielded fragments with approximately 50% GC, near-average Tm, a length of approximately 22 nt, and dispersion at the start position. Qualified sequences were output and saved as files, and selection suggestions were provided. The screening results showed that only 3 parent sequences could be accurately selected to form short fragments that could efficiently fold and stably form complete nucleic acid tetrahedral three-dimensional spatial structures, as detailed below: PT-S1-1=ACGAGACATTCTGTAGGAACGAACTGGACTTGGCATGAAAGGAAGGTTTGATGAAAGGGTTGC (SEQ ID NO: 1) PT-S2-1=ACGTTCCTACAGAATGTCTCGAGCCGCCTGACATTTTAGCCTAAGTTGGGCATAATTACCGCA (SEQ ID NO: 2) PT-S3-1=ACTGTTTTGTGATTTGGTGACACCTTTCATGCCAAGTCCAGTATGCGGTAATTATGCCCAACT (SEQ ID NO: 3) PT-S4-1=AGTCACCAAATCACAAAACAGAAGGCTAAAATGTCAGGCGGCAGCAACCCTTTCATCAAACCT (SEQ ID NO:4) PT-S1-2=AAATGTGACTGAGGTCTGACCAAAACTGGACAAGGTGTGCACACCTGTGGTAGTATGATGAGC (SEQ ID NO: 5) PT-S2-2=AGGTCAGACCTCAGTCACATTATGAAGTGTGGATCCTAACCCACAAACAATGGCAAGAGCGTC (SEQ ID NO: 6) PT-S3-2=ATGAAGCGGAAGGCAAGAACAAGTGCACACCTTGTCCAGTTTAGACGCTCTTGCCATTGTTTG (SEQ ID NO:7) PT-S4-2=ATGTTCTTGCCTTCCGCTTCAAGGGTTAGGATCCACACTTCAAGCTCATCATACTACCACAGG (SEQ ID NO:8) PT-S1-3=AACACGGTGATATATCCTGGGAATCCTGGGTTACGACAATGGATGTTGGCGAATGGAAAGCTG (SEQ ID NO:9) PT-S2-3=ACCCAGGATATATCACCGTGTATCCCTCCTCTACTAGATGAGAGAGCCTTATGGGTACAATCC (SEQ ID NO: 10) PT-S3-3=AGCAGACCTACGCACTTACTTACCATTGTCGTAACCCAGGATAGGATTGTACCCATAAGGCTC (SEQ ID NO: 11) PT-S4-3=AAAGTAAGTGCGTAGGTCTGCACTCATCTAGTAGAGGAGGGAACAGCTTTCCATTCGCCAACA (SEQ ID NO: 12) Comparative Example 1 To establish a parallel control system, the restrictions were appropriately relaxed for the remaining 6 patent parent sequences that did not achieve the desired assembly effect in the first round of screening. The specific procedures are as follows: Sliding window scanning: After preprocessing the original sequence, fragments are extracted in a 10-22nt window, and sequences containing illegal bases are filtered out to obtain the initial candidate domains; GC+ repetitive sequence filtering: Retain sequences with 40%-60% GC content and filter fragments containing 5 or more consecutive identical bases; Self-complementary filtering: Calculate the maximum number of matches between the segment and its own reverse complementary chain, and retain segments with ≤4 matches to avoid hairpin structures; Cross-complementary filtering: Calculate the pairwise cross-complementary matrix for segments with ≤4 matching numbers, filter sequences with >5 matching numbers, and retain sequences with GC close to 50% in case of conflict to avoid dimers; Tm value homogenization screening: Tm values ​​(salt concentration correction) are calculated using the Nearest-Neighbor method. Sequences within the Tm value ±5℃ range are retained to ensure synchronous self-assembly. Fragments with GC close to 50%, Tm close to the mean, length close to 22nt, and dispersed start positions are obtained. Qualified sequences are output and saved as files, and selection suggestions are given.

[0056] After screening, a low-standard control-type PDRN-TDN nucleic acid tetrahedron that can be stably folded and has a complete three-dimensional configuration was successfully obtained. The corresponding four single-stranded DNA sequences are as follows: PT-S1-LS=AACTACCCCAACAACATCTGGACACTAGCTCCTAAACTC (low standard PDRN-TDN) (SEQID NO:22) PT-S2-LS=ATGTTGGGGTAGTACAATCCCATCCTATCTACACAACAG (SEQ ID NO: 23) PT-S3-LS=AATGCTAAAACCCAAGTGTCCAGATGACTGTTGTGTAGA (SEQ ID NO: 24) PT-S4-LS=AGGGTTTTTAGCATAAGGATGGGATTGAGAGTTTAGGAGC (SEQ ID NO: 25) Example 2: Construction of PDRN-TDN nucleic acid tetrahedrons (1) The single-stranded DNA obtained above was artificially synthesized by Qingke Biotechnology Co., Ltd., and all of them were purified by HPLC with a purity of ≥98% to ensure self-assembly efficiency.

[0057] (2) Preparation of nucleic acid tetrahedrons by self-assembly Prepare nucleic acid assembly buffer: 10mM Tris-HCl, 5mM MgCl2, pH=7.4, sterilize at high temperature before use; Single-strand mixing: Add four single-stranded molecules S1-S4 to nucleic acid assembly buffer at an equimolar ratio (100 μM each), and mix by pipetting; Programmed annealing: Heat at 95℃ for 5 min, rapidly cool to 4℃, hold at 4℃ for 20 min, and allow to cool naturally to room temperature to obtain nucleic acid tetrahedra, which are as follows... Figure 1 As shown, the obtained nucleic acid tetrahedra were subjected to agarose gel electrophoresis according to conventional methods in the art, and the results are as follows. Figure 2 As shown.

[0058] from Figure 2 It can be seen that the nucleic acid tetrahedron exhibits a single hysteresis band, without any extraneous bands, with a self-assembly efficiency of ≥95% and a stable structure.

[0059] The sequences obtained from Comparative Example 1 were assembled using the method described above to obtain PDRN-TDN-LS.

[0060] Experiment Example 1: In vitro activity test and cell delivery effect of nucleic acid tetrahedra (1) Anti-inflammatory activity detection (secretion of inflammatory factor IL-8) Experimental reagents: Human dermal fibroblasts (HFF) (purchased from Shanghai Fuheng Biotechnology Co., Ltd.), TNF-α inflammatory inducer, samples from Example 2, pre-coated Human IL-8 ELISA kit from Dayou Biotechnology, and complete cell culture medium (Bloomage Biotechnology). TM DMEM medium and phosphate (PBS) buffer (HyClone).

[0061] Experimental procedure: Cell seeding and culture: HFF cells in logarithmic growth phase were resuspended in DMEM complete medium containing 10% fetal bovine serum and 1% penicillin antibiotics, and the cell density was adjusted to 1×10^5 cells / well. The cells were seeded into 6-well cell culture plates and cultured overnight at 37°C in a 5% CO2 cell culture incubator to allow the cells to adhere completely and fuse.

[0062] Sample pretreatment and cell grouping were performed as follows: control group (TNF-α induction only), three PDRN-TDN treatment groups, and one PDRN-TDN-LS treatment group. The old culture medium was discarded. The three PDRN-TDN treatment groups were pretreated with serum-free culture medium containing 250 nM of different PDRN-TDN samples for 2 h; the PDRN-TDN-LS treatment groups were pretreated with serum-free culture medium containing 250 nM of PDRN-TDN-LS samples for 2 h; the control group received only an equal volume of serum-free basal culture medium.

[0063] Two hours later, 10 ng / mL of TNF-α was added to all wells to stimulate inflammation, and the mixture was incubated overnight in an incubator to establish an in vitro skin inflammation model.

[0064] Cell supernatant collection: After stimulation, carefully aspirate the cell culture supernatant from each well, centrifuge at 2000 rpm for 10 min to remove cell debris, and collect the supernatant for IL-8 content detection (using the pre-coated IL-8 ELISA kit from Dayou Biotechnology).

[0065] Equilibrate the kit to room temperature (25°C) beforehand, and then remove the pre-coated 96-well plate.

[0066] Following the standard operating procedure of the kit, set up standard wells, blank wells, and sample wells; add 100 μL of serially diluted IL-8 standard to the standard wells, add 100 μL of cell supernatant to the sample wells, and add standard diluent to the blank wells.

[0067] Add 50 μL of biotinylated antibody working solution to each well, seal the plate, and incubate at room temperature for 60 min. Washing the plate: Discard the liquid in the wells, add washing solution to each well, soak for 1 minute and then discard. Repeat the washing process 3 times and pat dry any remaining liquid.

[0068] Add 100 μL of secondary antibody working solution to each well and incubate at room temperature for 60 min.

[0069] The plate was washed 5 times, and 100 μL of TMB substrate was added to each well for color development at room temperature in the dark.

[0070] Add 100 μL of stop solution to each well to terminate the reaction, and immediately read the OD value of each well at a wavelength of 450 nm using an ELISA reader.

[0071] Data statistical analysis: A standard curve was plotted based on the concentration of the standard and its corresponding OD value. The actual IL-8 secretion concentration in each sample well was calculated. Compared with the model group, the inhibition rate of each sample against the IL-8 inflammatory factor was calculated, and statistical difference analysis was performed. The results are as follows: Figure 3 As shown, in a TNF-α-induced human dermal fibroblast inflammation model, compared with the control group, all three PDRN-TDNs (PDRN-TDN1, PDRN-TDN2, and PDRN-TDN3) significantly inhibited the secretion level of the inflammatory factor IL-8 (p<0.001), while PDRN-TDN-LS, after lowering the selection criteria, only slightly downregulated IL-8 secretion, and its anti-inflammatory and inhibitory effects were significantly weaker.

[0072] (2) Antioxidant activity (ROS scavenging ability) Experimental reagents: HFF cells, H2O2 oxidative stress inducer, sample from Example 2, ROS Assay Kit from Tongren Chemical, serum-free culture medium, PBS.

[0073] Experimental procedure: Cell plating: HFF cells were seeded at 4×10^4 cells / well in black 96-well plates and incubated overnight at 37°C in a 5% CO2 incubator.

[0074] Sample groups: control group (oxidative damage only), 3 PDRN-TDN administration groups, and 1 PDRN-TDN-LS administration group. The old culture medium was discarded. The 3 PDRN-TDN administration groups were pretreated with serum-free culture medium containing 250 nM of different PDRN-TDN samples for 2 h; the 1 PDRN-TDN-LS administration group was pretreated with serum-free culture medium containing PDRN-TDN-LS samples for 2 h; the control group received only an equal volume of serum-free basal culture medium.

[0075] ROS fluorescent probe loading (Tongren Chemical Kit): Dilute the DCFH-DA fluorescent probe to working concentration with serum-free medium according to the kit instructions; discard the liquid in the wells, add 100 μL of probe working solution to each well, and incubate at 37°C in the dark for 30 min to allow the probe to fully enter the cells. After incubation, wash the cells twice with pre-warmed PBS to remove any unentered probes.

[0076] Add H2O2 to all wells to the final concentration, place in an incubator and continue stimulation for 30 min to induce cells to produce a large amount of endogenous ROS.

[0077] Fluorescence detection: Immediately after ROS level modeling, a multi-functional microplate reader was used with an excitation wavelength of 485 nm and an emission wavelength of 535 nm to detect the intracellular fluorescence intensity of cells in each well, evaluating the ROS scavenging and antioxidant capacity of PDRN-TDN. The results are as follows: Figure 4 As shown.

[0078] from Figure 4 It can be seen that in the H2O2-induced oxidative stress model of human dermal fibroblasts, all three PDRN-TDNs significantly reduced intracellular ROS levels compared with the control group. Although PDRN-TDN-LS with lowered screening criteria showed a certain downward trend in intracellular ROS levels, the difference did not reach statistical significance.

[0079] (3) Validation of PDRN cell uptake Sample preparation: Fluorescently labeled (cy5 labeled) PDRN-TDN1 nucleic acid tetrahedrons and free monomers with the same base sequence and the same fluorescent label (cy5 labeled) PT-S1-1 were prepared according to conventional methods in the art, ensuring that the molar concentration of PDRN in the two groups was completely consistent.

[0080] Cell plating and culture: HFF cells were seeded at an appropriate density into cell culture dishes and cultured overnight in a 37°C, 5% CO2 cell culture incubator. When the cells adhered to the wall and the confluence reached 70%~80%, the experiment was carried out.

[0081] Grouping and treatment: The PDRN-TDN group was replaced with serum-free culture medium containing 250 nM PDRN-TDN1 sample, and the PDRN free group was replaced with serum-free culture medium containing 250 nM free PDRN monomer PT-S1-1. Both groups of cells were returned to the incubator and incubated for 8 hours under the same conditions.

[0082] Staining: After incubation, the supernatant was aspirated, and the cells were gently washed three times with pre-cooled PBS buffer to remove unbound extracellular residues. Then, 4% paraformaldehyde was added to fix the cells at room temperature for 15 min. After fixation, the cells were washed again with PBS, and finally, DAPI staining solution (blue fluorescence, specifically labeling cell nuclei) was added. The cells were incubated at room temperature in the dark for 1 min to complete the localization and counterstaining of cell nuclei.

[0083] Fluorescence microscopy: Excess DAPI staining solution was discarded, and residue was washed away with PBS. Observation and photography were performed using a microscope. The blue channel was used to observe the nuclear localization signal of DAPI, and the red fluorescence channel was used to observe the red fluorescence signal of PDRN-labeled cells. Images of DAPI alone, PDRN alone, and DAPI / PDRN superimposed co-localization were acquired. The results are as follows: Figure 5 As shown.

[0084] from Figure 5 It can be seen that the red fluorescence signal of the PDRN-TDN1 group is clearly visible inside the cell, and is distributed within the cell outline along with the DAPI-labeled nuclear signal, confirming that the PDRN-TDN1 constructed as a nucleic acid tetrahedron can effectively penetrate the cell membrane and enter the cell to achieve intracellular delivery; while the free monomer PT-S1-1 group has almost no obvious red fluorescence signal, indicating that the free PT-S1-1 chain that is not assembled into a nucleic acid tetrahedron structure is difficult to enter the cell and cannot achieve effective cellular uptake.

[0085] The above description is merely a preferred embodiment of this application and is not intended to limit the application in any other way. Any person skilled in the art may make changes or modifications to the disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of this application without departing from the scope of the technical solution of this application shall still fall within the protection scope of this application.

Claims

1. A polydeoxyribonucleotide comprising or consisting of any of the sequences shown in SEQ ID NO:1-12.

2. A method for screening polydeoxyribonucleotides, comprising: Use a sliding window to scan any original polydeoxyribonucleotide to extract a fragment of a given size; The given-size fragment is filtered to obtain fragment one with a given GC content; Calculate the matching threshold between the fragment with a given GC content and the reverse complementary chain of the fragment to obtain the fragment with the given matching threshold; Calculate the pairwise complementary matrix of the segments with the given matching threshold to obtain segment two with the given GC content; Calculate the Tm value of fragment two with a given GC content to obtain fragments with a given Tm value, resulting in fragment two with a given GC content, fragments with a given Tm value, fragments of a given size, and fragments with dispersed start positions, all of which are polydeoxyribonucleotides.

3. The method according to claim 2, which is used for screening polydeoxyribonucleotides suitable for forming nucleic acid tetrahedra.

4. The method according to claim 2 or 3, wherein in the filtration process, fragments of consecutive identical bases having a given value are filtered out, optionally, the given value is four or more; Optionally, in calculating the pairwise complementary matrix of the segments that meet the given matching threshold, segments that are greater than the given matching threshold are filtered out. Optionally, the Nearest-Neighbor method is used to calculate the Tm value; Optionally, the given size segment refers to a segment of size 20-25 nt; and / or The fragment with the given GC content refers to fragment one with a GC content of 40-60%; and / or The given matching threshold segment refers to a segment with ≤3 matches; and / or The second fragment with a given GC content refers to a second fragment with a GC content of 40-60%; and / or The segment with a given Tm value refers to a segment within the range of Tm ± 2℃; Optionally, any of the polydeoxyribonucleotides comprises or consists of any of the sequences shown in SEQ ID NO:1-12.

5. A system for screening polydeoxyribonucleic acid (PDA), wherein the system comprises a memory, a processor, and a program stored in the memory and executable on the processor for screening PDA, wherein the PDA screening program, when executed by the processor, performs the steps of the method of any one of claims 2-4.

6. A polydeoxyribonucleotide-nucleic acid tetrahedron, wherein the sequence of the polydeoxyribonucleotide comprises the sequence of claim 1; Preferably, the nucleic acid tetrahedron is formed by the self-assembly of four single-stranded polydeoxyribonucleotides; Optionally, the sequences of the four single-stranded polydeoxyribonucleotides include sequences as shown in SEQ ID NO:1-4, SEQ ID NO:5-8, or SEQ ID NO:9-12; or consist of sequences as shown in SEQ ID NO:1-4, SEQ ID NO:5-8, or SEQ ID NO:9-12.

7. Use of the polydeoxyribonucleotide of claim 1 or the polydeoxyribonucleotide-nucleic acid tetrahedron of claim 6 in the preparation of anti-inflammatory and / or antioxidant products.

8. Use of the polydeoxyribonucleotide of claim 1 or the polydeoxyribonucleotide-nucleic acid tetrahedron of claim 6 in the preparation of articles that promote transdermal absorption.

9. The use according to claim 7 or 8, wherein the article comprises a cosmetic or pharmaceutical product.

10. Use of the polydeoxyribonucleotide of claim 1 in the formation of nucleic acid tetrahedra.

Images