5'utr elements, expression vectors and uses thereof

CN122811175APending Publication Date: 2026-09-25YUNZHOU BIOSCIENCES (GUANGZHOU) INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610973306.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-05-06
Publication Date
2026-09-25

AI Technical Summary

Technical Problem

本发明通过提供5' UTR序列,解决体外合成mRNA(信使核糖核酸)时,mRNA表达载体5' UTR(5' 非翻译区)序列无法同时具有既能使mRNA表达效率高,又能使其加帽效率高的功能的问题

Benefits of technology

[0068](1)、本发明中的5' UTR序列的加帽效率在体外合成的mRNA中很高。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present application relates to the field of in vitro transcription, in particular to 5' UTR elements, expression vectors and application thereof. The present application provides 5' UTR elements, which have: a nucleotide sequence as shown in SEQ ID NO: 11 and / or SEQ ID NO: 12; or a nucleotide sequence obtained by substitution, deletion or addition of one or more bases to the nucleotide sequence as shown, and a nucleotide sequence functionally identical or similar to the nucleotide sequence as shown; or a nucleotide sequence having at least 80% identity with the nucleotide sequence as shown. The present application provides 5' UTR sequences, which solve the problem that the 5' UTR sequence of prokaryotes cannot simultaneously have the functions of high mRNA expression efficiency and high capping efficiency when synthesizing mRNA in vitro.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application claims a divisional application of Chinese Patent Application No. 202410554063.5, filed on May 6, 2024, entitled “5' UTR Element, Expression Carrier and Application Thereof”, the entire contents of which are incorporated herein by reference. Technical Field

[0002] This invention relates to the field of in vitro transcription, and more particularly to 5' UTR elements, expression vectors, and their applications. Background Technology

[0003] The 5' UTR is the region of mature mRNA located upstream of the coding region and downstream of the 5' cap, which is not translated into protein. The 5' UTR begins at the transcription start site and ends one nucleotide before the start codon, and may contain elements that control gene expression through regulatory mechanisms. The 5' UTR regulates mRNA stability, ribosome recognition, and mRNA secondary structure through interactions with RNA-binding proteins, largely determining protein expression and translation efficiency.

[0004] In eukaryotic cells, m7G is a widely distributed 5' cap structure in mRNA. It is linked to the first nucleotide at the 5' end of the mRNA via a triphosphate bond, called cap 0 (m7GpppN, also known as Cap 0). The Cap 0 structure is crucial for mRNA translation. Additional methylation at the 2'O position of the mRNA initiation nucleotide is called cap 1 (m7GpppNm, also known as Cap 1) modification. Cap 1 modification can reduce the immune response induced by in vivo application of mRNA. The mRNA 5' cap regulates the cleavage of precursor mRNA, protects mRNA from nuclease degradation, and determines the initiation of protein translation. Therefore, in in vitro synthesized mRNA, a higher proportion of Cap 1 is better.

[0005] In vitro mRNA synthesis is a process that mimics the in vivo synthesis of mRNA using enzymes, templates, NTPs, and reaction buffers. The general procedure is as follows: template preparation and purification, in vitro transcription of mRNA, capping reaction, removal of template DNA, and mRNA purification. The capping reaction is significantly affected by the thermodynamic free energy of the 5' UTR. Simple investigations show that the lower the thermodynamic free energy of the 5' UTR, the more difficult the capping reaction is to proceed. This suggests that a higher thermodynamic free energy of the 5' UTR results in a higher capping rate. Under the same conditions, mRNA with higher capping efficiency also has higher expression efficiency. Therefore, for in vitro transcribed mRNA, the 5' UTR directly affects the expression efficiency of mRNA and indirectly affects the stability and expression efficiency of mRNA by influencing the capping efficiency. Summary of the Invention

[0006] In view of this, the present invention provides a 5' UTR element, an expression vector, and its applications. The present invention addresses the problem that, during in vitro synthesis of mRNA (messenger ribonucleic acid), the 5' UTR (5' untranslated region) sequence of the mRNA expression vector cannot simultaneously achieve both high mRNA expression efficiency and high capping efficiency.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0008] This invention provides a 5' UTR element, the 5' UTR element having:

[0009] (1) A nucleotide sequence as shown in SEQ ID NO:11 and / or SEQ ID NO:12; or

[0010] (2) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (1), and which has the same or similar function as the nucleotide sequence shown in (1); or

[0011] (3) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2).

[0012] In some embodiments of the present invention, the sequence of SEQ ID NO:1 is: ACTCTTCTGCTCGCCACAGTCTGGAGACGAACGCACC. (A1)

[0013] In some embodiments of the present invention, the sequence of SEQ ID NO:2 is: ATTGGATTGTGACGAAGAGATTGAGAGAACTGACC. (A2)

[0014] In some embodiments of the present invention, the sequence of SEQ ID NO:3 is: ATAGGATTGTGACGAAGAGATTGAGAGAACTGACC. (A3)

[0015] In some embodiments of the present invention, the sequence of SEQ ID NO:4 is: AATATTAAGGTAAAAAGAGAGTGAGAGAGAACGCACC. (A5)

[0016] In some embodiments of the present invention, the sequence of SEQ ID NO:5 is: AATATTAAGGTAAAAAGAGAGAGGTGAATTAGAGAGTAGCCACC. (A7)

[0017] In some embodiments of the present invention, the sequence of SEQ ID NO:6 is: AATATTATTGTAAAAAGAGAGTGAGAGAGAAGGGACC. (A9)

[0018] In some embodiments of the present invention, the sequence of SEQ ID NO:7 is: AATATTTAGGGTAAAAAGAGAGTGAGAGAGAAGGGACC. (A10)

[0019] In some embodiments of the present invention, the sequence of SEQ ID NO:8 is: AATATTAGAGTAAAAAGAGAGTGAGAGAGAAGGGACC. (A11)

[0020] In some embodiments of the present invention, the sequence of SEQ ID NO:9 is: ACATTTGCTTCTGACACAACTGTGTTCACTTCACGCATCAAACAGACACC. (B1)

[0021] In some embodiments of the present invention, the sequence of SEQ ID NO:10 is: ACATTTGCTTCTGACACAACTGTGTTCACTTCACGCATCAAACGGACACC. (B2)

[0022] In some embodiments of the present invention, the sequence of SEQ ID NO:11 is: ACATTTGCTTCTGACACAACTACATCAACTTCACTAATCATACGGCCACC. (B8)

[0023] In some embodiments of the present invention, the sequence of SEQ ID NO:12 is: ACATCTGCTTCTGACACAACTACATCAACTTCACTAATCATACGGCCACC. (B9)

[0024] In some embodiments of the present invention, the 5' end of the nucleotide in the above-described 5' UTR element further includes a GGG base and / or an AG base.

[0025] In some embodiments of the present invention, the 5' UTR element described above has:

[0026] (4) A nucleotide sequence as shown in any of SEQ ID NO:33 to SEQ ID NO:36; or

[0027] (5) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (4), and which has the same or similar function as the nucleotide sequence shown in (4); or

[0028] (6) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (4) or (5).

[0029] In some embodiments of the present invention, the sequence of SEQ ID NO:13 is: GGGACTCTTCTGCTCGCCACAGTCTGGAGACGAACGCACC. (GGG+A1)

[0030] In some embodiments of the present invention, the sequence of SEQ ID NO:14 is: AGACTCTTCTGCTCGCCACAGTCTGGAGACGAACGCACC. (AG+A1)

[0031] In some embodiments of the present invention, the sequence of SEQ ID NO:15 is: GGGATTGGATTGTGACGAAGAGATTGAGAGAACTGACC. (GGG+A2)

[0032] In some embodiments of the present invention, the sequence of SEQ ID NO:16 is: AGATTGGATTGTGACGAAGAGATTGAGAGAACTGACC. (AG+A2)

[0033] In some embodiments of the present invention, the sequence of SEQ ID NO:17 is: GGGATAGGATTGTGACGAAGAGATTGAGAGAACTGACC (GGG+A3)

[0034] In some embodiments of the present invention, the sequence of SEQ ID NO:18 is: AGATAGGATTGTGACGAAGAGATTGAGAGAACTGACC(AG+A3)

[0035] In some embodiments of the present invention, the sequence of SEQ ID NO:19 is: GGGAATATTAAGGTAAAAAGAGAGTGAGAGAACGCACC. (GGG+A5)

[0036] In some embodiments of the present invention, the sequence of SEQ ID NO:20 is: AGAATATTAAGGTAAAAAGAGAGTGAGAGAGAACGCACC. (AG+A5)

[0037] In some embodiments of the present invention, the sequence of SEQ ID NO:21 is: GGGAATATTAAGGTAAAAAGAGAGAGGTGAATTAGAGAGTAGCCACC. (GGG+A7)

[0038] In some embodiments of the present invention, the sequence of SEQ ID NO:22 is: AGAATATTAAGGTAAAAAGAGAGAGGTGAATTAGAGAGTAGCCACC. (AG+A7)

[0039] In some embodiments of the present invention, the sequence of SEQ ID NO:23 is: GGGAATATTATTGTAAAAAGAGAGTGAGAGAGAAGGGACC. (GGG+A9)

[0040] In some embodiments of the present invention, the sequence of SEQ ID NO:24 is: AGAATATTATTGTAAAAAGAGAGTGAGAGAGAAGGGACC. (AG+A9)

[0041] In some embodiments of the present invention, the sequence of SEQ ID NO:25 is: GGGAATATTAGGGTAAAAAGAGAGTGAGAGAGAAGGGACC. (GGG+A10)

[0042] In some embodiments of the present invention, the sequence of SEQ ID NO:26 is: AGATATTAGGGTAAAAAGAGAGTGAGAGAGAAGGGACC. (AG+A10)

[0043] In some embodiments of the present invention, the sequence of SEQ ID NO:27 is: GGGAATATTAGAGTAAAAAGAGAGTGAGAGAGAAGGGACC. (GGG+A11)

[0044] In some embodiments of the present invention, the sequence of SEQ ID NO:28 is: AGAATATTAGAGTAAAAAGAGAGTGAGAGAGAAGGGACC. (AG+A11)

[0045] In some embodiments of the present invention, the sequence of SEQ ID NO:29 is: GGGACATTTGCTTCTGACACAACTGTGTTCACTTCACGCATCAAACAGACACC. (GGG+B1)

[0046] In some embodiments of the present invention, the sequence of SEQ ID NO:30 is: AGACATTTGCTTCTGACACAACTGTGTTCACTTCACGCATCAAACAGACACC. (AG+B1)

[0047] In some embodiments of the present invention, the sequence of SEQ ID NO:31 is: GGGACATTTGCTTCTGACACAACTGTGTTCACTTCACGCATCAAACGGACACC. (GGG+B2)

[0048] In some embodiments of the present invention, the sequence of SEQ ID NO:32 is: AGACATTTGCTTCTGACACAACTGTGTTCACTTCACGCATCAAACGGACACC. (AG+B2)

[0049] In some embodiments of the present invention, the sequence of SEQ ID NO:33 is: GGGACATTTGCTTCTGACACAACTACATCAACTTCACTAATCATACGGCCACC. (GGG+B8)

[0050] In some embodiments of the present invention, the sequence of SEQ ID NO:34 is: AGACATTTGCTTCTGACACAACTACATCAACTTCACTAATCATACGGCCACC. (AG+B8)

[0051] In some embodiments of the present invention, the sequence of SEQ ID NO:35 is: GGGACATCTGCTTCTGACACAACTACATCAACTTCACTAATCATACGGCCACC. (GGG+B9)

[0052] In some embodiments of the present invention, the sequence of SEQ ID NO:36 is: AGACATCTGCTTCTGACACAACTACATCAACTTCACTAATCATACGGCCACC. (AG+B9)

[0053] The present invention also provides an expression box, comprising: the aforementioned 5' UTR element.

[0054] The present invention also provides an expression vector comprising: the above-described 5' UTR element and / or the above-described expression cassette and an acceptable gene element.

[0055] In some embodiments of the present invention, the gene element in the above expression vector includes one or more of the following: a promoter, a Kozak sequence, a luciferase gene, a 3' UTR element, and a polyadenosine tail.

[0056] In some embodiments of the present invention, the promoter in the above expression vector includes the T7 promoter.

[0057] In some embodiments of the present invention, the luciferase gene in the above expression vector includes: Gaussian luciferase gene or firefly luciferase gene.

[0058] In some embodiments of the present invention, the expression vector further includes a backbone plasmid: pmRVac.

[0059] The present invention also provides a host, transformation and / or transfection of the above expression vector.

[0060] The present invention also provides the application of the above-described 5' UTR element, the above-described expression cassette, the above-described expression vector and / or the above-described host in in vitro transcription of mRNA.

[0061] The present invention also provides the above-mentioned 5' UTR element, the above-mentioned expression cassette, the above-mentioned expression vector and / or the above-mentioned host to improve the expression efficiency and / or capping efficiency of in vitro transcribed mRNA.

[0062] The present invention also provides a method for in vitro transcription of mRNA, wherein the above expression vector is linearized, mRNA is transcribed in vitro, and a capping reaction is performed to obtain the mRNA.

[0063] This invention provides a 5' UTR element, the 5' UTR element having:

[0064] (1) A nucleotide sequence as shown in any of SEQ ID NO:9 to SEQ ID NO:12; or

[0065] (2) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (1), and which has the same or similar function as the nucleotide sequence shown in (1); or

[0066] (3) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2).

[0067] The beneficial effects of this invention include:

[0068] (1) The capping efficiency of the 5' UTR sequence in this invention is very high in in vitro synthesized mRNA.

[0069] (2) The capping efficiency of the 5' UTR sequence in this invention is as high as 80% or more.

[0070] (3) The expression efficiency of the 5' UTR sequence in this invention is higher than that of the existing modified 5' UTR sequence in in vitro synthesized mRNA.

[0071] (4) Therefore, the expression efficiency and capping efficiency of the 5' UTR sequence in this invention are extremely high among known 5' UTR sequences in in vitro synthesized mRNA. Attached Figure Description

[0072] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0073] Figure 1 Map of mRNA expression vectors;

[0074] Figure 2 The image shows the expression intensity of each 5' UTR AG version in cells.

[0075] Figure 3 The image shows the expression intensity of each 5' UTR GGG version in cell experiments.

[0076] Figure 4 This figure shows a comparison of the expression intensity of some of the embodiments and comparative examples in cell experiments;

[0077] Figure 5 The image shows the fluorescence intensity of the first group of GGG version mRNAs in mouse in vivo imaging.

[0078] Figure 6 The image shows the fluorescence intensity of the second group of GGG version mRNAs in mouse in vivo imaging.

[0079] Figure 7 The image shows the fluorescence intensity of the first group of AG version mRNAs in mouse in vivo imaging.

[0080] Figure 8 The image shows the fluorescence intensity of the second group of AG version mRNAs in mouse in vivo imaging.

[0081] Figure 9 A comparison of luminescence intensity in live mouse imaging of GGG version mRNA;

[0082] Figure 10 A comparison of luminescence intensity in mouse in vivo imaging of the AG version of mRNA. Detailed Implementation

[0083] This invention discloses a 5' UTR element, an expression vector, and its applications.

[0084] It should be understood that the expression “one or more of…” individually includes each of the objects described after the expression, as well as various different combinations of two or more of the described objects, unless otherwise understood from the context and usage. The expression “and / or” combined with three or more described objects should be understood to have the same meaning, unless otherwise understood from the context.

[0085] The terms “including,” “having,” or “containing,” including the use of their grammatical synonyms, should generally be understood as open-ended and non-restrictive, for example, not excluding other unstated elements or steps, unless otherwise specifically stated or understood from the context.

[0086] It should be understood that the order of the steps or the order in which certain actions are performed is not important as long as the invention remains operational. Furthermore, two or more steps or actions can be performed simultaneously.

[0087] The use of any and all instances or exemplary language such as “e.g.” or “including” in this document is merely intended to better illustrate the invention and is not intended to limit the scope of the invention unless the claims are made. No language in this specification should be construed as indicating that any unclaimed element is essential to the practice of the invention.

[0088] Furthermore, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as precisely as possible. However, any value inevitably contains standard deviations due to individual test methods. Therefore, unless explicitly stated otherwise, it should be understood that all ranges, quantities, values, and percentages used in this disclosure are modified with the word "approximately". Here, "approximately" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a specific value or range.

[0089] The expression effect detection mentioned in this invention involves the following: mRNA is translated into corresponding proteins within cells. Gaussian luciferase expression vectors can translate this protein into Gaussian luciferase within cells, which reacts with the substrate coelenterate to emit fluorescence. The intensity of the chemiluminescence can be detected using a microplate chemiluminescence detector and converted into a numerical value. Based on the numerical value, the expression levels of Gaussian luciferase mRNA expression vectors containing different 5' UTRs within cells can be compared, i.e., the strength of the expression effect.

[0090] The capping efficiency mentioned in this invention is as follows: During the capping process of mRNA in vitro synthesis, a variety of intermediate products are formed. The molecular weights of all intermediate and final products are calculated, and substances of corresponding molecular weights can be detected by liquid chromatography-mass spectrometry. By summing the total value of all intermediate and final products, the proportion of the capped product to all intermediate and final products in all capping processes can be calculated, and the capping efficiency can be obtained.

[0091] There are several types of 5' caps on mRNA. The most important of these is Cap 1. Descriptions of improving capping efficiency in this invention refer to increasing the proportion of Cap 1.

[0092] The sequence involved in this invention is shown below:

[0093] GGG+A4: GGGACTCTTCTGCTCGCCACAGTCTCGAGACGAACGCACC. (As shown in SEQ ID NO:37)

[0094] GGG+A6: GGGAATATTAAGGTAAAAAGAGAGTGAGAGAGAAGCCACC. (As shown in SEQ ID NO:38)

[0095] GGG+A8: GGGAATATTAAGGTAAGTTAGAGAGAGGTGAATTAGAGAGTAGCCACC. (As shown in SEQ ID NO:39)

[0096] GGG+B3:GGGACATTTGCTTCTGACACAACTGTGTTCACTTATTAGCTCAAACAGACACC. (As shown in SEQID NO:40)

[0097] GGG+B4:GGGACATTTGCTTCTGACACAACTGTGTTCACTTATTAGCTGAAACAGACACC. (As shown in SEQID NO:41)

[0098] GGG+B5:GGGACATTTGCTTCTGACACAACTAAATAAACTTCACAAATCAAACGGACACC. (As shown in SEQID NO:42)

[0099] GGG+B6:GGGACATTTGCTTCTGACACAACTAAATAAACTTCACAAATCATACGGCCACC. (As shown in SEQID NO:43)

[0100] GGG+B7: GGGACATTTGCTTCTGACACAACTAAATAAACTTCACTAATCATACGGCCACC. (as shown in SEQ ID NO: 44)

[0101] GGG+B10: GGGACATCTGCTTCTGACACAACTACATCAACTTCACTAATTTTACGGCCACC. (as shown in SEQ ID NO: 45)

[0102] AG+A4: AGACTCTTCTGCTCGCCACAGTCTCGAGACGAACGCACC. (as shown in SEQ ID NO: 46)

[0103] AG+A6: AGAATATTAAGGTAAAAAGAGAGTGAGAGAGAAGCCACC. (as shown in SEQ ID NO: 47)

[0104] AG+A8: AGAATATTAAGGTAAGTTAGAGAGAGGTGAATTAGAGAGTAGCCACC. (as shown in SEQ ID NO: 48)

[0105] AG+B3: AGACATTTGCTTCTGACACAACTGTGTTCACTTATTAGCTCAAACAGACACC. (as shown in SEQ ID NO: 49)

[0106] AG+B4: AGACATTTGCTTCTGACACAACTGTGTTCACTTATTAGCTGAAACAGACACC. (as shown in SEQ ID NO: 50)

[0107] AG+B5: AGACATTTGCTTCTGACACAACTAAATAAACTTCACAAATCAAACGGACACC. (as shown in SEQ ID NO: 51)

[0108] AG+B6: AGACATTTGCTTCTGACACAACTAAATAAACTTCACAAATCATACGGCCACC. (as shown in SEQ ID NO: 52)

[0109] AG+B7: AGACATTTGCTTCTGACACAACTAAATAAACTTCACTAATCATACGGCCACC. (as shown in SEQ ID NO: 53)

[0110] AG+B10: AGACATCTGCTTCTGACACAACTACATCAACTTCACTAATTTTACGGCCACC. (as shown in SEQ ID NO: 54)

[0111] C1: ACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACC. (as shown in SEQ ID NO: 55)

[0112] GGG+C1: GGGACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACC. (as shown in SEQ ID NO: 56)

[0113] GGG+C2: GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACCCCGGCGCC. (as shown in SEQ ID NO: 57)

[0114] C3: AGACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACCCAACCGCGGTTCGCGGCCGCT. (as shown in SEQ ID NO: 58)

[0115] C4: AGGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGA. (as shown in SEQ ID NO: 59)

[0116] C5: AGACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACCCCCCGGCGCC. (as shown in SEQ ID NO: 60)

[0117] C6: AGGGCAGTAATAGAATGCTTTCAGGAAGATGACAGAATCAGGAGAAAGATGCTGTTTTGCACTATCTTGATTTGTTACAGCAGCCAACTTATTGGCATGATGGAGTGACAGGAAAAACAGCTGGC. (as shown in SEQ ID NO: 61)

[0118] C7: AGGGGCAAAAATCAAAATCAATCATCATCACAACATCAACAATCAATCATCAACACATCATCAAGACACCACC. (as shown in SEQ ID NO: 62)

[0119] The sequence of AG+C1 is: AGACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACC. (As shown in SEQ ID NO:63)

[0120] In the embodiments and comparative examples of this invention, all raw materials and reagents used are commercially available.

[0121] The present invention will be further illustrated below with reference to the embodiments:

[0122] Example 1

[0123] 1. When using the GGG version of the 5' UTR sequence of human hemoglobin α-globulin, the inventors found that its intracellular expression was very poor. Capping efficiency of the mRNA was measured to be 0% (Cap 1 proportion). Inputting the 5' UTR sequence into the RNA structure and energy prediction website (http: / / rna.tbi.univie.ac.at / / cgi-bin / RNAWebSuite / RNAfold.cgi) revealed a low thermodynamic free energy, suggesting that the low thermodynamic free energy might hinder the capping reaction. To verify the relationship between the capping efficiency of the mRNA 5' UTR and its thermodynamic free energy, and to obtain a 5' UTR sequence with high capping efficiency, the inventors developed this invention.

[0124] 2. Based on the length of the 5' UTR sequence of human hemoglobin α-globulin, and combined with the inventors' conjecture regarding the relationship between the thermodynamic free energy and capping efficiency of the 5' UTR sequence, the inventors designed nine 5' UTR sequences (37 nt) with the same length as the 5' UTR sequence of human hemoglobin α-globulin, one 5' UTR sequence with a length of 44 nt, and one 5' UTR sequence with a length of 45 nt, for a total of 11 5' UTRs, designated as experimental group A. In addition, to investigate whether the 5' UTR length affects its thermodynamic free energy and capping efficiency, the inventors designed ten 5' UTR sequences with a length of 50 nt, designated as experimental group B. To investigate whether the relationship between the thermodynamic free energy and capping efficiency of the 5' UTR sequence has the same effect in different in vitro transcription processes, GGG or AG was added to the front of the 5' UTR sequences of groups A and B to use different transcription processes for in vitro mRNA synthesis, referred to as the GGG version or AG version.

[0125] 3. The thermodynamic free energy values ​​of GGG version 5' UTR are shown in Table 1:

[0126] Table 1. Predicted Thermodynamic Free Energy of the Designed 5' UTR

[0127]

[0128]

[0129] 4. Apply the new 5' UTR sequence to an mRNA expression vector containing the Gaussian luciferase gene. For example... Figure 1 As shown, the mRNA expression vector contains a T7 promoter, a 5' UTR, a Kozak sequence, a Gaussian luciferase gene, a 3' UTR, a polyadenylated tail, and pmRVac Carrier and other components.

[0130] 5. Construct the corresponding mRNA expression vector using genetic engineering methods and transform the vector into *E. coli*. Grow the transformed *E. coli* on LB agar plates containing agar and kanamycin. Pick a single colony, inoculate it in LB liquid medium containing kanamycin, and incubate overnight. Extract the plasmid using a plasmid extraction kit. Verify the correctness of the base sequence from the T7 promoter to the polyadenylated tail in the plasmid using Sanger sequencing.

[0131] 6. Inoculate the glycerol bacteria corresponding to the plasmids whose sequences are verified to be correct by Sanger sequencing into LB liquid medium containing kanamycin, culture overnight, preserve the bacterial culture with glycerol, and extract plasmids from the remaining bacterial culture using an endotoxin-free plasmid extraction kit.

[0132] 7. Take the plasmid from step 6 and cut it with restriction endonuclease to linearize it. Purify the linearized plasmid using a DNA purification and recovery kit. After purification, perform agarose gel electrophoresis on the sample to confirm that the enzyme digestion is complete.

[0133] 8. Using the linearized DNA from step 7 as a template, synthesize mature mRNA containing a 5' cap structure (GGG version) through in vitro transcription followed by a capping reaction, or synthesize mature mRNA containing a cap structure (AG version) in vitro through co-transcription and capping. Purify the mRNA using an mRNA purification kit. Determine the concentration of the mRNA sample and perform gel electrophoresis on the mRNA using denaturing agarose gel to identify the integrity of the mRNA.

[0134] 9. Transfect the mRNA from step 8 into HEK293T cells and culture at 37°C. At four time points post-transfection (6 h, 24 h, 48 h, and 72 h), aspirate the cell culture supernatant and mix it with the substrate and reaction buffer. The expression product, Gaussian luciferase, reacts with its substrate, coelenterate, to produce an enzymatic reaction and chemiluminescence. The intensity of the chemiluminescence is measured using a microplate chemiluminescence analyzer and converted into a numerical value, indicating the expression efficiency of the product. The intensity of the chemiluminescence reaction corresponds to the expression efficiency of mRNAs with different 5' UTRs.

[0135] 10. Use liquid chromatography-mass spectrometry to measure the capping efficiency of mRNA.

[0136] Based on intracellular expression efficiency and capping efficiency data, 5' UTR sequences with better intracellular expression efficiency than comparative C1 and a Cap 1 capping efficiency greater than 80% were selected.

[0137] The Cap 1 capping efficiency is calculated as the percentage of the peak area of ​​Cap 1 in mass spectrometry detection relative to the sum of the peak areas of the substrate, all intermediate products, and the final product during the capping process. A Cap 1 ratio exceeding 80% is considered excellent, and the higher the better.

[0138] The capping efficiency of GGG and AG mRNA versions is shown in Table 2. The Cap 1 ratio of the designed 5' UTR mRNAs all exceeded 80%. These results suggest that the capping efficiency of the GGG mRNA is influenced to some extent by the thermodynamic free energy of its 5' UTR sequence, while the capping efficiency of the AG mRNA may not be affected by the thermodynamic free energy of its 5' UTR sequence.

[0139] Table 2. Results of mRNA capping rate detection for the designed GGG and AG versions of 5' UTR.

[0140]

[0141]

[0142] 11. Use cell experiments to detect differential mRNA expression.

[0143] HEK293T cells were transfected with mRNA of Gaussian luciferase of various 5' UTR versions using 12-well cell culture dishes. The transfection volume was 0.3 μg / well. At 6 h, 24 h, 48 h and 72 h after transfection, 20 μL of cell culture supernatant was collected, mixed with the substrate coelomicin and reaction buffer, and then placed in a microplate chemiluminescence detector to detect the chemiluminescence intensity.

[0144] Results of the intracellular expression effect verification experiment are as follows: Figure 2 , Figure 3 As shown in Tables 3 and 4.

[0145] Among them, the AG version mRNA, with AG+C1 as the positive control and untransfected HEK293T cells as the blank control, showed that the expression efficiency of AG+A1, AG+A2, AG+A3, AG+A4, AG+A5, AG+A6, AG+A7, AG+A10, AG+B1, and AG+B2 exceeded that of AG+C1.

[0146] Because the capping rate of GGG+C1 is extremely low, the expression efficiency of its mRNA expression vector in cells is affected by the capping rate and cannot be accurately reflected. Therefore, a known superior 5' UTR, C2, was used as a comparison for intracellular expression efficiency. Among the various modified GGG versions, with GGG+C2 as a positive control and untransfected HEK293T cells as a blank control, the expression efficiencies exceeding those of GGG+C2 were: GGG+A1, GGG+A2, GGG+A3, GGG+A5, GGG+A7, GGG+A9, GGG+A10, GGG+A11, GGG+B1, GGG+B7, and GGG+B8.

[0147] Table 3. Data on the expression intensity of each 5' UTR AG version in cells.

[0148]

[0149]

[0150]

[0151] Table 4. Data on the expression intensity of each 5' UTR GGG version in cell experiments.

[0152]

[0153]

[0154]

[0155] The results of the intracellular expression effect verification experiment were analyzed for significant differences between the two groups of data in Tables 3 and 4, and univariate analysis was performed using data at the 48-hour time point. The results are shown in Tables 5 and 6.

[0156] Table 5. Analysis of Significant Differences Between GGG Versions

[0157]

[0158]

[0159] Table 6. Significant Difference Analysis of AG Versions

[0160]

[0161]

[0162] Based on the results of the intracellular expression effect verification experiment (Tables 5 and 6), the analysis of the significant differences between the two groups showed that there were 8 groups with significant differences in GGG expression: GGG+A1, GGG+A2, GGG+A5, GGG+A7, GGG+A9, GGG+A10, GGG+B1, and GGG+B8; and 11 groups with significant differences in AG expression: AG+A1, AG+A3, AG+A4, AG+A5, AG+A6, AG+A7, AG+A10, AG+B1, AG+B2, AG+B4, and AG+B10. Based on the experimental results of the two groups, we identified the following sequences with statistically significant differences: A1, A2, A3, A4, A5, A6, A7, A9, A10, B1, B2, B4, B8, and B10. Although the differences between A11 and B9 and the control group were not significant, cell experiment data showed that their expression effects were superior to those of the control group.

[0163] Comparative Example

[0164] This comparative example used six Gaussian luciferase mRNA expression vectors with relatively high intracellular expression efficiency (AG+C1, C3, C4, C5, C6, C7) to compare with four 5' UTRs (AG+A2, AG+A5, AG+A7, AG+A10) randomly selected from the statistically significant sequence difference groups in the examples of this invention. The transfection dosage was 0.5 μg, and the experimental procedures and other variables were consistent with the examples. Untransfected HEK293T cells were used as a blank control. The experimental results are shown in Table 7 and... Figure 4 As shown, the intracellular expression efficiency of AG+A2, AG+A5, AG+A7, and AG+A10 of the present invention is superior to that of the comparative example.

[0165] Table 7 Comparison of expression intensity in cell experiments of some examples and comparative examples

[0166]

[0167]

[0168] The differences between Examples AG+A2, AG+A5, AG+A7, and AG+A10 and each comparative example were analyzed for significance, and univariate analysis was performed using data from 48-hour time points. The results are shown in Tables 8, 9, 10, and 11.

[0169] Table 8. Significant Difference Analysis between AG+A2 and the Comparative Example

[0170]

[0171] Table 9. Significant Difference Analysis between AG+A5 and the Comparative Example

[0172]

[0173] Table 10. Significant Difference Analysis between AG+A7 and the Comparative Example

[0174]

[0175] Table 11. Significant Difference Analysis between AG+A10 and the Comparative Example

[0176]

[0177] Based on the cell experiments and significant difference analysis results of the above-mentioned examples (AG+A2, AG+A5, AG+A7, AG+A10) and comparative examples (AG+C1, C3, C4, C5, C6, C7), it can be concluded that the expression effects of AG+A5 and AG+A7 are significantly higher than those of the comparative examples C1, C3, C4, C5, C6, and C7. The expression effect of AG+A10 shows a partially significant difference compared to the comparative examples. The expression effect of AG+A2 does not show a significant difference compared to the comparative examples.

[0178] Explanation of the comparative examples: Comparative example C1 is the 5' UTR sequence of wild-type human hemoglobin α-globulin. C2-C7 are 5' UTR sequences published in the literature or NCBI, and their predicted thermodynamic free energy data are shown in Table 12.

[0179] Table 12 Comparative Thermodynamic Free Energy Prediction and Capping Efficiency Data

[0180]

[0181] Validation example: Firefly luciferase

[0182] Mouse experiment:

[0183] Because Gaussian luciferase is secreted, its expression in mice leads to extracellular secretion and systemic diffusion via the bloodstream, hindering signal collection. Therefore, the expression of the non-secretory firefly luciferase gene was investigated in mice. Firefly luciferase in Mg 2+ In the presence of ATP and O2, it can catalyze the oxidation and decarboxylation of D-luciferin, emitting visible light with a wavelength of 550-580 nm.

[0184] One 5' UTR with good expression performance was selected from the cell experiments of Gaussian luciferase to construct a firefly luciferase mRNA expression vector. Two versions, AG and GGG, were developed. Firefly luciferase gene expression vectors containing different 5' UTRs were constructed using the same method to obtain mRNA. To ensure more stable entry of firefly luciferase mRNA into mouse cells, the inventors encapsulated the mRNA using lipid nanoparticles (LNPs) to form LNP-mRNA. The concentration, encapsulation efficiency, particle size, potential, and aggregation index of LNPs were measured. LNP quality detection data are shown in Table 13.

[0185] Table 13 LNP Quality Inspection Data Table

[0186]

[0187] Eight-week-old ICR mice were weighed and injected with LNP-mRNA via the tail vein at a dose of 0.25 mg / kg. Six hours later, the substrate solution was injected intraperitoneally, and the mice were anesthetized before in vivo imaging experiments were performed.

[0188] Experimental results are as follows Figures 5-10 And as shown in Table 14:

[0189] Table 14. Luminescence Intensity Data of Mouse In vivo Imaging

[0190]

[0191] Significance analysis was performed on the luminescence intensity data from mouse in vivo imaging. The results are shown in Table 15.

[0192] Table 15. Comparative Significance Analysis of GGG+A2 and GGG+C1

[0193]

[0194] Table 16. Significant Difference Analysis of AG+A2 and AG+C1 Pairs

[0195]

[0196] Based on the above in vivo mouse experiments and significant difference analysis results, it can be seen that the expression effect of Example GGG+A2 mice is slightly better than that of Comparative Example GGG+C2; the expression effect of Example AG+A2 is slightly better than that of Comparative Example AG+C1, but the difference is not significant.

[0197] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

A 1.5' UTR element, characterized in that, The 5' UTR element has: (1) A nucleotide sequence as shown in SEQ ID NO:11 and / or SEQ ID NO:12; or (2) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (1), and which has the same or similar function as the nucleotide sequence shown in (1); or (3) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2).

2. The 5' UTR element as described in claim 1, characterized in that, The 5' end of the nucleotide also includes a GGG base and / or an AG base.

3. The 5' UTR element as described in claim 2, characterized in that, The 5' UTR element has: (4) A nucleotide sequence as shown in any of SEQ ID NO:33 to SEQ ID NO:36; or (5) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (4), and which has the same or similar function as the nucleotide sequence shown in (4); or (6) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (4) or (5).

4. An expression box, characterized in that, include: The 5' UTR element as described in any one of claims 1 to 3.

5. An expression vector, characterized in that, include: The 5' UTR element as described in any one of claims 1 to 3 and / or the expression cassette as described in claim 4, as well as acceptable gene elements.

6. The expression vector as described in claim 5, characterized in that, The genetic elements include one or more of the following: a promoter, a Kozak sequence, a luciferase gene, a 3' UTR element, and a polyadenosine tail.

7. The host, characterized in that, Transformation and / or transfection with the expression vector as described in claim 5 or 6.

8. The use of the 5' UTR element as described in any one of claims 1 to 3, the expression cassette as described in claim 4, the expression vector as described in claim 5 or 6, and / or the host as described in claim 7 in in vitro transcription of mRNA.

9. The 5' UTR element as described in any one of claims 1 to 3, the expression cassette as described in claim 4, the expression vector as described in claim 5 or 6, and / or the host as described in claim 7, which enhances the expression efficiency and / or capping efficiency of in vitro transcribed mRNA.

10. A method for in vitro transcription of mRNA, characterized in that, After linearizing the expression vector as described in claim 5 or 6, mRNA is transcribed in vitro, followed by a capping reaction to obtain the mRNA.