Application of IFT family genes in regulation of locust locomotion and male reproduction

Abstract

This invention discloses the application of IFT family genes in regulating limb movement and male reproduction in locusts, belonging to the field of genetic engineering technology. The IFT family genes are... LmIFT52 and LmIFT88 The LmIFT52 and LmIFT88 The CDS sequence is shown in SEQ ID NO.22-23; by inhibiting LmIFT52 or LmIFT88 This expression leads to lethality, leg movement disorders, and abnormal male reproductive function in homozygous locusts. This invention utilizes locusts... LmIFT52 and LmIFT88 Using CRISPR-Cas9 gene editing and RNAi technology as the research subjects, the commonalities and differences of two genes in the development, movement and reproduction regulation of locusts were clarified, filling the gap in the study of IFT family protein function, and confirming that the two genes can serve as candidate targets for green control of locusts, providing an important reference for the analysis of the reproductive mechanism of orthoptera insects and green control of agricultural pests.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the application of IFT family genes in regulating limb movement and male reproduction in locusts. Background Technology

[0002] locusts Locusta migratoria Locusts are important agricultural pests belonging to the order Orthoptera, characterized by long migratory distances, rapid reproduction, and a wide range of food sources. Large-scale outbreaks often lead to severe crop yield reductions or even total crop failure, posing a persistent threat to global agricultural production. Currently, locust control mainly relies on chemical pesticides. However, long-term, large-scale use of chemical agents not only causes environmental pollution and kills natural enemies but also leads to locusts developing resistance to many commonly used pesticides, resulting in a gradual decline in control effectiveness. Therefore, developing new, environmentally friendly, and highly targeted green control strategies has become a crucial issue urgently needing to be addressed in the field of agricultural pest management.

[0003] The intraflagellar transport (IFT) system is a core molecular mechanism essential for the assembly, maintenance, and function of cilia and flagella in eukaryotes. The IFT complex consists of two subcomplexes, IFT-A and IFT-B. IFT52 is a key component of the IFT-B complex, playing a structural role in mediating the bidirectional transport of IFT particles along ciliary / flagellate microtubules. IFT88, also belonging to the IFT-B complex, participates in early ciliary / flagellate assembly and length regulation. In mammals, loss of function of IFT52 or IFT88 leads to abnormal primary ciliary development, causing ciliary diseases such as polycystic kidney disease, retinal degeneration, and visceral transposition, and resulting in male reproductive defects. However, in insects, especially Orthoptera, research on the functional regulation of development, movement, and reproduction by IFT family genes is relatively lagging, with few related reports.

[0004] Locust sperm possesses a unique structure of extremely long flagella, the elongation and functional maintenance of which are highly dependent on the IFT (intracellular protein transport) system. Similar to mammalian sperm, during locust sperm flagella development, the proximal (near the nucleus) flagella grow independently of the IFT, while distal elongation strictly depends on IFT-mediated protein transport. This structural feature makes the locust an ideal model for studying the function of IFT proteins in sperm flagella development. However, current techniques do not yet provide specific examples of IFT proteins used in locust sperm development. LmIFT52 or LmIFT88 Reports on the application of genes in locust control. Summary of the Invention

[0005] The purpose of this invention is to provide the application of IFT family genes in regulating limb movement and male reproduction in locusts, in order to solve the problems existing in the prior art. Taking LmIFT52 and LmIFT88 of locusts as research objects, the commonalities and specific differences of IFT52 and IFT88 in the regulation of locust development, movement and reproduction were clarified by CRISPR-Cas9 gene editing and RNAi technology. This fills the gap in the study of the function of IFT family proteins in locusts and confirms that they can be used as candidate targets for green control of locusts, providing an important reference for the analysis of reproductive mechanisms of orthoptera and green control of agricultural pests.

[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides the use of inhibitors of IFT family genes in any of the following: (1) Application in the preparation of products that regulate locust limb movement and male reproduction; (2) Application in the preparation of products for controlling locusts; (3) Application in the preparation of homozygous knockout mutants of IFT family genes; Among them, the IFT family genes are LmIFT52 and LmIFT88 The LmIFT52 and LmIFT88 The genomic fragment sequences are shown in SEQ ID NO.22 and SEQ ID NO.23; The regulation of locust limb movement and male reproduction is achieved by inhibiting the expression of IFT family genes, leading to lethality, leg movement disorders, and abnormal male reproductive function in homozygous locusts.

[0007] LmIFT52 The genome fragment is: GCTGACAACACACAAACACTATTACACATTTTGAAAGTATGTTTATCATTATTTGCAGATAGCTGACTACAACATGATACCAGACACAGCAAAGTTGGCAGAAAGGCCACGCGTATGCCTCCAGGAATCAACAGATGAGAT ACCCATGGATTACACGAAGTTATTTGACCAGCGTTTTCTCCATACATACAGGCATTGTGGCAGATGCAATTGAAGCTTATGATCAACTGAATGTGAAACATGAACCTCTGAAACTTATAACACCTCAGTTTGAAACACCAC.

[0008] LmIFT88 The genome fragment sequence is as follows: TCAAGAAGCACTTCGATCGACATACGCAAAAAGGCCTATTGTAAGTAAATAACAAAATAATTTCAACTATAACTTTAGGAGATGAAATGAATTTAATTTGTACTTGTTTCTATTATGAACACTAAATTTATGCTCTTTGTGTTAAATGCAGACAACAGCAAAGCCTCCCACAG CAATGCGCCTCGGTACATCATCAGGTGTAAGTTAACTGCATACATATTGATAGAACTGGTACTATAGTGATGTCTGTGTTTGTTAAATATTGCTGTGATGTTACAGTATCGTGAGGGAACGAGCTTAAGCTTTCGGCCGGTGACCAGTTCACAAGATGGAGTGAACAGACCA.

[0009] Preferably, the inhibitors of the IFT family genes include: knockout. LmIFT52 The sgRNA of the gene, the target sequence of which is shown in SEQ ID NO.1; or knockout. LmIFT88 The sgRNA of the gene, the target sequence of which is shown in SEQ ID NO.13.

[0010] Preferably, the inhibitors of the IFT family genes include: interference LmIFT52 Gene expression of dsRNA, the nucleotide sequence of which is shown in SEQ ID NO.24; or interference LmIFT88 The dsRNA expressed by the gene, the nucleotide sequence of which is shown in SEQ ID NO.25.

[0011] interference LmIFT52 The gene expression dsRNA sequence is as follows: AAGGCATTCCGCACAAATATTAATTTTCTCCTTGAAGAATATGGCATCATGGTTAATAACGCAATGGCACATTAACAGCACTAGTAACTTAAAGGACAGTAGAAGTGGCGCACTTGATAACAGATATCTGCAGGGCTCTGAGCTTCATATATCCATACGGTGCAACACTGAAGCTCGCACGACCAGCTGTGGCACTCCTGTCCACTGGGAGTGTCGCGTATCCTCATCAGCGACCAGTCTGTGCAGTTTCTGGACGGCTTGTGGTCCTGGGATCAGGACACATGCTGGCCGATCGATACATTGATCGTGAGGATAATGACCGCATTCGAGAGGTGCTGCTGCGACTGTTGTCTCCTCCGCCATTTGATCTCAATCATGTGGATGCAGAAGATCCTGAGATAGCTGACTACAACATGATACCAGACACAGCAAAGTTGGCAGAAAG。

[0012] Interference LmIFT88 The dsRNA sequence for gene expression is: AATTCGGATGCTTGACCAACAAGGTTTAAGTGATAGCCACAATCTTGATCTGACATTTGGTGTTCTTTTCAACTTGGCAAATCAGTATGCTGCAAATGAAATGTACACAGAAGCTTTGAATACATATCAAATTATTACAAAAAACAGGATGTTTCACAATGCAAATCGTCTGAAAGTAAATATGGGCAATATATATTTCAAGTTAGGACAGTATTCTAAAGCTATTAAGATGTATCACATGGCACTGGACCAAGTTCCAAATACTTACAAAGAGTTACGAATTAAGATAATGCACAATATAGGCATATTATTTGTGAAAATGGGTCAGTTTACTGATGCATGCTCAAGTTTTGAATTCATTATGCAAGAAAAGCCAGATTTCATAACAGGACTCCACATCATTCTCTGTTATTATGCCCTTGGTGACAAAGAGAAGATGAAAAGAAGCTTCCAGGCAATGCTTGAGGTTCCTT。

[0013] This invention also provides the use of biological materials that inhibit the expression of said IFT family genes in any of the following: (1) Application in the preparation of products that regulate locust limb movement and male reproduction; (2) Application in the preparation of products for controlling locusts; (3) Application in the preparation of homozygous knockout mutants of IFT family genes; The biomaterials that inhibit the expression of IFT family genes include those that inhibit... LmIFT52 or LmIFT88 The expressed protein or the knockout vector.

[0014] This invention also provides a method for controlling locusts by targeting IFT family genes, comprising the following steps: Reduce the expression level of IFT family genes in locusts, or knock out IFT family genes; The IFT family genes are LmIFT52 and LmIFT88 The LmIFT52 and LmIFT88 The genomic fragment sequences are shown in SEQ ID NO.22 and SEQ ID NO.23.

[0015] Preferably, by interference LmIFT52 Gene or LmIFT88 Gene expression is reduced, among which, interference LmIFT52 The dsRNA sequence for gene expression is shown in SEQ ID NO.24, interfering with... LmIFT88 The dsRNA sequence of the gene expression is shown in SEQ ID NO.25; Knockout LmIFT52 The sgRNA target sequence of the gene is shown in SEQ ID NO.1. Knockout LmIFT88 The sgRNA target sequence of the gene is shown in SEQ ID NO.13.

[0016] This invention also provides a method for constructing a locust IFT family gene mutant, comprising the following steps: (1) Design and synthesize targets LmIFT52 or LmIFT88 The sgRNA of the gene was used to construct a CRISPR-Cas9 editing system; wherein, the targeted... LmIFT52 The sgRNA sequence of the gene is shown in SEQ ID NO.1, targeting... LmIFT88 The sgRNA sequence of the gene is shown in SEQ ID NO.13; (2) The RNP complex formed by Cas9 protein and sgRNA was microinjected into locust eggs to obtain G0 generation chimeric mutants; (3) RNA interference was performed in stages on the 3rd-5th instar larvae of the G0 generation mutant individuals to obtain G0-RNAi chimeric mutants; among which, the interference LmIFT52 The dsRNA sequence for gene expression is shown in SEQ ID NO.24, interfering with... LmIFT88 The dsRNA sequence of the gene expression is shown in SEQ ID NO.25.

[0017] Preferably, the phased implementation of RNA interference is as follows: RNA interference is performed on G0 generation mutant individuals by injecting 4 μg of dsRNA into 3rd instar worms, 6 μg into 4th instar worms, and 8 μg into 5th instar worms.

[0018] Preferably, the LmIFT52 Homozygous mutants are lethal within 1-2 minutes of hatching, with the lethal phenotype being loss of leg motor function; LmIFT88 The homozygous mutant is lethal within 2-3 hours of hatching, and the lethal phenotype is severe bending of the hind legs.

[0019] This invention also provides a biological pesticide for controlling locusts, comprising an inhibitor of the IFT family of genes, wherein the inhibitor of the IFT family of genes comprises any one of the following: (1) Knock out the sgRNA of the LmIFT52 gene, the target sequence of which is shown in SEQ ID NO.1; (2) Knock out the sgRNA of the LmIFT88 gene, the target sequence of which is shown in SEQ ID NO.13; (3) Interference LmIFT52 The dsRNA expressing the gene, the nucleotide sequence of which is shown in SEQ ID NO.24; (4) Interference LmIFT88 The dsRNA expressed by the gene, the nucleotide sequence of which is shown in SEQ ID NO.25.

[0020] The present invention discloses the following technical effects: This invention knockout LmIFT52 Homozygous mutants were found to be lethal; then, an RNAi system was constructed in stages for the G0 generation knockout mutant, achieving a gene silencing efficiency of 81.91%. The results indicate that... LmIFT52 Homozygous mutants are lethal; LmIFT52- G0 generation RNAi mutant individuals exhibited significant leg movement disorders, and the proportion of abnormal eggs in male offspring was as high as 97.78%. Centrosome and mitochondrial staining results showed that... LmIFT52- G0 generation RNAi mutant sperm flagella are significantly shortened and structurally incomplete, with disordered or even absent centrosome arrangement and abnormal protein localization. This invention confirms... LmIFT52The male reproductive function of locusts is maintained by regulating the formation and structural stability of cilia / flagellates.

[0021] LmIFT88 and LmIFT52 They have similar functions and are both involved in the regulation of locust locust movement and male reproductive processes: LmIFT88 homozygous mutant ( LmIFT88 - / - Early-age fatality accompanied by hind leg bowing phenotype, LmIFT88 After RNAi treatment of the G0 generation mutants, the motility of the mutants decreased in an age-dependent manner. Compared to... LmIFT52 , LmIFT88 The lethal effect is milder, and a small number of homozygous mutants can develop into adults; after gene deletion, the proportion of abnormal eggs in male offspring is 94.74%, and this reproductive abnormality is mainly caused by the cessation of growth at the distal end of the sperm flagellum.

[0022] This invention clarifies IFT52 and IFT88 The commonalities and specific differences in the development, movement, and reproductive regulation of locusts fill the gap in the study of the function of IFT family proteins in locusts, and confirm that they can serve as candidate targets for green control of locusts, providing an important reference for the analysis of reproductive mechanisms of orthoptera and green control of agricultural pests. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 for LmIFT52 Definition of locust bouncing standard; Figure 2 for LmIFT52 Genomic structure and sgRNA site distribution; Figure 3 for LmIFT52 Validation of sgRNA gene editing efficiency in vitro; Figure 4 for LmIFT52 Validation of sgRNA gene editing efficiency in vivo; Figure 5 For generational breeding strategies; Figure 6 for LmIFT52 homozygote ( LmIFT52 - / - A: Survival rate differences in the G0 generation; B: Genotypic survival characteristics of the G2 generation; C: Lethality; LmIFT52Sequencing verification of homozygous dead individuals; D: Molecular basis of gene function loss; Figure 7 for LmIFT52 -G0-RNAi interference efficiency; Figure 8 for LmIFT52 G0 generation chimeric and mutant phenotypes; Figure 9 for LmIFT52 Jumping height detection; A: Jumping height of 7-day-old (N5D7) individuals of the fifth instar; B: Jumping height of 2-day-old (AD2) adults; Figure 10 for LmIFT52 Jump statistics chart; Figure 11 for LmIFT52 Oviposition experiments; A: Three mating experiments and egg sac length; B: Number of eggs laid in different mating groups; Figure 12 for LmIFT52 Sequencing results of abnormal eggs; A: Developmental morphology of eggs with different combinations; B: Sequencing results of abnormal egg genomes; Figure 13 for LmIFT52 Abnormal egg percentage; Figure 14 for LmIFT52 -G0-RNAi mutant sperm cells and sperm Anti -LmIFT52 Staining; A: Early spermatocytes; B: Mature sperm bundles; Figure 15 for LmIFT52 -G0-RNAi male mutant locust sperm abnormalities; A: Wild-type locust sperm schematic diagram; green marks centrosome, red marks sperm flagellum morphology, blue marks sperm nucleus; B: This is diagram C. LmIFT52 Schematic diagram of sperm flagella of the -G0-RNAi mutant, C: staining results; Figure 16 for LmIFT88 Genomic structure and sgRNA site distribution; Figure 17 for LmIFT88 Validation of in vitro gene editing efficiency; Figure 18 for LmIFT88 Validation of in vivo gene editing efficiency; Figure 19 for LmIFT88 homozygote ( LmIFT88 - / - A: Survival rate differences in the G0 generation; B: Genotypic survival characteristics of the G2 generation; C: Lethality; LmIFT88 Phenotypic analysis and sequencing validation of homozygous dead individuals; Figure 20 for LmIFT88 -G0-RNAi interference efficiency; Figure 21 for LmIFT88- G0 generation chimeric and mutant phenotypes; Figure 22 for LmIFT88 Jump height test results; Figure 23 for LmIFT88 Jump statistics chart; Figure 24 for LmIFT88 Oviposition experiment; A: Mating experiments in two groups and egg sac length; B: Number of eggs laid in different mating groups; Figure 25 for LmIFT88 The offspring of mutants exhibit abnormal oocyte phenotypes; Figure 26 for LmIFT88 Abnormal egg percentage; Figure 27 for LmIFT88 -G0-RNAi male mutant locust sperm abnormalities; A: Wild-type locust sperm schematic diagram; green marks centrosome, red marks sperm flagellum morphology, blue marks sperm nucleus; B: This is diagram C. LmIFT88 A schematic diagram of the sperm flagella of the -G0-RNAi mutant; C: staining results. Detailed Implementation

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0027] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0028] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0029] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0030] Example 1: LmIFT52 function of genes 1. Experimental Methods 1.1 LmIFT52 Construction of G0 generation mutant locust 1.1.1 Genome structure analysis, sgRNA site design, and primer design (1) LmIFT52 Genome structure analysis: using the "BLAST" tool on the NCBI website (website: htt-ps: / / www.ncbi.nlm.nih.gov / (and the FlyBase fruit fly gene database (website: https: / / flybase.org) to obtain locust information) LmIFT52 The mRNA sequence and genome sequence of the gene were compared; sequence alignment analysis was performed using SnapGene software to accurately label exon and intron regions, and the results were presented in PowerPoint. LmIFT52 The work of drawing genome structure maps; (2) sgRNA site design: Based on the obtained genomic sequence of the gene, log in to the E-CRISP official website (website: http: / / www.e-crisp.org / E-CRISP / index.html ),Will LmIFT52 The first exon sequence of the gene was used to define the design range of sgRNA target sites and was screened online. Based on the comprehensive scoring results of various factors, a sequence with a high score and few off-target sites was selected as the target sequence for subsequent experiments (Table 1). Table 1 LmIFT52 Gene sgRNA sequence (3) Design of specific amplification primers: Design of primers for specific nested PCR on a genome sequence of about 600 bp containing the sgRNA target sequence (Table 2). Table 2 LmIFT52 Nested amplification primers for target gene sequences (4) Design of primers for sgRNA synthesis: After determining the target sequence, forward and reverse primers were designed, and PCR was performed using an 80 bp crRNA / tracrRNA fragment as a template to generate a DNA template for gRNA (Table 3).

[0031] Table 3 Primers for sgRNA synthesis 1.1.2 In vitro enzyme digestion verification of sgRNA (1) Genome extraction: After thoroughly washing the locust eggs, transfer them into 1.5 mL EP tubes (3 eggs per tube), add 300 μL of double-distilled water and two steel balls, and crush them in a grinder to prepare a homogenate; take another 1.5 mL EP tube, add 45 μL of 50 mM sodium hydroxide and 5 μL of the above homogenate, lyse at 95℃ for 10 min, cool to room temperature, add 5 μL of 1M Tris-HCl to neutralize, mix thoroughly, and the result is a template that can be used for PCR amplification.

[0032] (2) Target gene sequence amplification: First, using the locust egg genome as a template, nested PCR was performed in a 200 μL EP tube using specific primers for the first round ( IFT52 -11170-F1、 IFT88 A 12.5 μL reaction system was established using -23064-R1 (Table 4), and the first round of amplification was performed according to the amplification procedure shown in Table 5; subsequently, using the first round amplification product as a template, the second round of amplification was performed using specific primers ( IFT52 -11278-f2、 IFT52 -11545-r2), a 50 μL reaction system was established in a 200 μL EP tube (Table 6), and a second round of amplification was performed according to the amplification protocol in Table 7; finally, the second round of PCR products were loaded onto a 1% agarose gel, the voltage was adjusted to 130V, and after electrophoresis for about 30 min, the molecular weight of the amplified bands was observed.

[0033] Table 4. Experimental system for the first amplification of the target gene sequence Table 5. First procedure for target gene amplification Table 6. Target gene sequence second amplification system Table 7. Target gene second amplification procedure (3) Purification of target fragment: The procedure was performed using the Gel Extraction Kit agarose gel DNA recovery kit.

[0034] (4) Amplification of the 80 bp crRNA / tracrRNA fragment: The sgRNA was ligated to the PAC vector using conventional methods to obtain the plasmid PAC-sgRNA. Then, using the prepared plasmid PAC-sgRNA as a template, the fragment was amplified using primers crRNA / tracrRNA-F and Universal-R (see Table 8). The amplification was performed in a small EP tube with a 25 μL system (Table 9) (Table 10) to obtain an 80 bp fragment. The product was then purified and diluted to 50 ng / μL after quantification for later use.

[0035] Table 8 Primer Sequences Table 9 PCR Amplification System Table 10 PCR Amplification Procedure (5) DNA fragment amplification of sgRNA: Using the obtained 80 bp fragment as a template, primers Universal-F and Universal-R (Table 8) and sgRNA synthesis primers sg were used. IFT52 -11390-F / sg IFT52 Amplification was performed using -11390-R (Table 3). A 50 μL reaction system was constructed using sgRNA primers diluted to 0.5 μM (Table 11). The amplification procedure in Table 10 was followed to obtain the gRNA DNA fragment, which was then purified and quantified by electrophoresis to detect band size.

[0036] Table 11 PCR amplification system (6) In vitro transcription: The T7 RiboMAX™ Express RNAi System kit was used. After transcription, quantification was performed by preparing a 2% agarose gel, taking 0.5 μL for electrophoresis, and checking whether the bands were single. The gel was stored at -20℃.

[0037] (7) Purification of sgRNA: The GeneJET RNA purification and concentration microextraction kit was used to purify the RNA according to the instructions.

[0038] (8) In vitro enzyme digestion: The enzyme digestion reaction system is shown in Table 12. During the experiment, one experimental group (sgRNA and Cas9 are added) and two control groups (sgRNA without Cas9 and Cas9 without sgRNA are added) need to be set up. After incubating at 37°C for 2 hours in a PCR instrument, a 2% agarose gel is prepared for electrophoresis detection and the cleavage efficiency of the sgRNA target site is calculated.

[0039] Table 12 Cas9 / sgRNA in vitro enzyme digestion system 1.1.3 In vivo validation of sgRNA (1) Microinjection of locusts RNP complexes were prepared by mixing Cas9 protein (300 ng, 1 μL) with sgRNA (300 ng, 1 μL). The complexes were injected into locust eggs at an injection pressure of 300 Pa and an injection time of 0.5 s. Twenty eggs were injected into each group. A control group was set up (injected with sterile enzyme-free water).

[0040] After injection, place the insect eggs in a petri dish (with a moist but not dripping filter paper at the bottom) and incubate them in a 30°C incubator. The locust nymphs will hatch after about 14 days.

[0041] (2) In vivo mutation efficiency detection After microinjection, newly formed locust eggs were cultured for 5 days, and 10 well-developed eggs were selected for mutation efficiency detection. The specific steps are as follows: First, genomic DNA was extracted from 10 eggs, and the target gene fragment was amplified by nested PCR; then, the target fragment was separated and recovered by agarose gel electrophoresis and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing; finally, the sequencing results of these 10 eggs were compared with the sequencing peak diagram of the control group eggs injected with sterile enzyme-free water to calculate the mutation efficiency of the target site.

[0042] 1.2 RNA interference LmIFT52 Gene and functional verification 1.2.1 Synthesizing ds LmIFT52 Method (1) During PCR amplification, plasmids were used as templates. The primers used are shown in Table 13. Amplification and purification were performed using the reaction systems and procedures shown in Tables 9 and 10, and then the plasmids were ligated into the T vector to obtain the plasmids. After extraction and purification, the DNA was used as... LmIFT52 double-stranded RNA (ds) LmIFT52 The template was synthesized and then used with T7 RiboMAX. TMThe Express RNAi System kit (Promega, Madison, WI, USA) was used to synthesize dsRNA. The reaction system is shown in Table 14.

[0043] Table 13 ds LmIFT52 Primer sequence Table 14 PCR Amplification System (2) After adding the sample, mix well and react in the PCR instrument: 37°C, 2h; 70°C, 10min; 20°C, 20min.

[0044] (3) After the reaction is complete, take out the sample and treat the residual DNA and synthesized dsRNA with 1 μL DNase I and 1 μL RNase I. The RNase I solution needs to be diluted before use (use DEPC water 1:200).

[0045] (4) The reaction solution was incubated at 37°C for 30 min. After the reaction was completed, it was immediately placed on ice.

[0046] (5) Mix 6.6 μL sodium acetate and 66 μL isopropanol in advance and add the obtained dsRNA product to the mixture. Let it stand overnight at -20°C.

[0047] (6) Take the sample out of the -20℃ freezer and quickly put it into the 4℃ low temperature centrifuge. Set the speed to 12000 rpm and centrifuge for 15 min. After centrifugation, carefully remove the clear supernatant with a pipette, keep the precipitate at the bottom of the tube, and then add 1 mL of pre-cooled 75% alcohol (prepared with DEPC water) to the precipitate. Centrifuge at 12000 rpm and 4℃ for 5 min. Repeat twice.

[0048] (7) Discard the waste liquid, blow the precipitate dry in the clean bench, then add 40 μL of enzyme-free water. After completing the concentration test, the strain needs to be diluted to the specified concentration of 2 μg / μL. After confirming that the band specificity and integrity meet the standard by electrophoresis analysis, transfer it to a -80℃ refrigerator for storage.

[0049] 1.2.2 Construction LmIFT52 -G0-RNAi chimeric mutant locust method The method includes the following steps: (1) When the G0 generation locust eggs edited by CRISPR-Cas9 develop to the 3rd instar stage, the antennae are cut off to extract the genome and sequence it to identify mutant individuals.

[0050] (2) RNAi intervention was carried out in stages on G0 generation individuals: the injection dose for 3rd instar worms was 4 μg, for 4th instar worms it was 6 μg, and for 5th instar worms it was 8 μg, and the results were obtained. LmIFT52 -G0-RNAi chimeric mutant locust.

[0051] 1.2.3 LmIFT52 Phenotypic analysis of chimeric mutant locusts The survival rates of the G0 generation locusts at each age stage were statistically recorded; simultaneously, the survival rates of wild-type and non-wild-type locusts in the G2 generation were statistically recorded. LmIFT52 Heterozygotes and LmIFT52 Survival rate of homozygotes. Predicting survival rate based on base deletion characteristics of homozygotes. LmIFT52 The deletion of transmembrane domains in genes was investigated to identify the mutation type. Simultaneously, morphological characteristics of locust eggs during the hatching period were observed to determine... LmIFT52 Lethal period and cause of death in homozygous individuals.

[0052] 2. Functional Research 2.1 LmIFT52 Functional study in locust migration First, test the G0 generation RNAi individuals. LmIFT52 Gene silencing efficiency; then observed and compared. LmIFT52 -G0 generation and LmIFT52 The morphological and dynamic movement behaviors of individuals with the -G0-RNAi mutant were observed. To quantify movement ability, a 25×15×17 cm foam box was used as the detection device, with the average height of five jumps by a single wild-type locust (7 cm for fifth instar larvae and 14 cm for adults) as the reference standard. Figure 1 ), and statistically compare the G0 generation with LmIFT52 The number of times the -G0-RNAi mutant skipped this baseline is clearly defined. LmIFT52 Did the jumping ability and overall motor ability of individuals with the -G0-RNAi mutants significantly decrease compared to wild-type individuals? Results showed that: WT and LmIFT52 -G0 locusts can cling to the four walls of a foam box; LmIFT52 -G0-RNAi locusts lack the ability to move.

[0053] 2.2 LmIFT52 Functional study in the reproduction of male migratory locusts To investigate LmIFT52 To investigate the regulatory function in locust reproduction, this invention sets up three mating experiments: wild-type male × wild-type female, LmIFT52 -G0 generation male insect × wild-type female insect, LmIFT52 -G0-RNAi mutant males × wild-type females were used to statistically analyze and compare oviposition-related indicators (oosac length, number of eggs, egg morphology, and proportion of abnormal eggs) in the females across the three experimental groups. Simultaneously, extracts were... LmIFT52The genome of abnormal eggs produced by mating a male G0-RNAi mutant with a wild-type female was sequenced to clarify... LmIFT52 The influence of genes on the reproductive function of male locusts.

[0054] 2.3 LmIFT52 Research on the mechanism of action of locust sperm development To investigate sperm development, given the unique structural characteristics of locust sperm (in the early and mature stages of sperm development, the centrosome divides the sperm flagellum into two parts, with the growth of the end closer to the nucleus independent of IFT, while the growth of the other end is mediated by IFT), a series of staining experiments were conducted: First, using Anti-LmIFT52 antibody (labeling LmIFT52 protein), Mito, and DAPI, sperm from mutant locusts in the early developmental stage (the stage when flagellum is about to form) and the mature stage were stained and analyzed. LmIFT52 The study aimed to elucidate its effect on sperm development and its mechanism of action in regulating sperm development in locusts. Secondly, it addressed the impact on sperm development processes. LmIFT52 Sperm bundles (within seminiferous tubules) from 2-day-old adult G0-RNAi mutant locusts were stained with AC-Tubulin (centrioles), Mito (mitochondria), and DAPI (nucleus) to observe changes in sperm length. The primary antibody used was AC-Tubulin. The immunohistochemical methods are as follows: (1) Sampling and slide preparation: Select the seminiferous tubules of male LmIFT52-G0-RNAi locusts that are 8 days old after adulthood. On a glass slide with 20 μL of 1×PBS buffer, dissect and separate the outer membrane of the seminiferous tubules and gently release the sperm cells (control the cell concentration to a moderate level and avoid stacking). After air drying at room temperature, immerse the glass slide in 4% paraformaldehyde (PFA, prepared in 0.1 M PBS) and fix it at 4℃ for 15-20 min. Then proceed with subsequent staining.

[0055] (2) Washing: The fixed sample was washed three times with 1×PBST buffer (containing 0.1% Tween-20) for 10 min each time to remove residual fixative.

[0056] (3) Blocking: Add 2.5% bovine serum albumin (BSA, prepared with 1×PBS) to cover the sample, and block at 37℃ for 1 h to block non-specific binding.

[0057] (4) Primary antibody incubation: Pour off the blocking solution, add the diluted specific primary antibody (LmIFT52 rabbit antibody / AC Tubulin rabbit antibody) diluted with 2.5% BSA at a ratio of 1:200, and incubate overnight in a humidified chamber at 4°C.

[0058] (5) Washing: Wash the sample three times with 1×PBST the next day, for 10 min each time, to remove unbound primary antibody.

[0059] (6) Co-incubation of secondary antibody and dye: Add fluorescent secondary antibody and dye mixture (goat anti-rabbit IgG-Alexa Fluor488 secondary antibody, 1:500 dilution; Mito mitochondrial dye 1:1000; DAPI final concentration 1 μg / mL, all prepared with 2.5% BSA) and incubate at room temperature in the dark for 3 h.

[0060] (7) Washing and mounting: Wash 3 times with 1×PBST (10 min each time), and finally wash 2 times with 1×PBS to remove Tween-20; add anti-fluorescence quenching mounting medium, cover with coverslip, and avoid the formation of air bubbles.

[0061] (8) Fluorescence Imaging and Result Analysis: Imaging was performed using a Leica upright fluorescence microscope with different channel parameters: Alexa Fluor 488 channel (excitation wavelength 488 nm, emission wavelength 520 nm, detecting LmIFT52 signal), Mito-mitochondrial dye channel (excitation wavelength 594 nm, emission wavelength 617 nm), and DAPI channel (excitation wavelength 358 nm, emission wavelength 461 nm, displaying cell nuclei). The same exposure time and imaging parameters were maintained for the same batch of samples, and more than 5 non-overlapping fields of view were captured for each sample.

[0062] 3. Results and Analysis 3.1 LmIFT52 Chimeric mutant locusts cause death 3.1.1 IFT52 genome structure and sgRNA site distribution turn out LmIFT52 The genome length is 36793 bp, containing 2 exons, based on the obtained... LmIFT52 The genomic DNA sequence was screened on the E-CRISP website to obtain the sgRNA-11390 site ( Figure 2 ).

[0063] 3.1.2 Verification of in vitro enzyme digestion efficiency Use the filtered results LmIFT52 The sgRNA site (sgRNA-11390) of the gene was used for subsequent experiments. First, the genomic fragment containing the target site was amplified using nested PCR. Then, Cas9 protein, sgRNA, and the genomic fragment to be cleaved were thoroughly mixed at a ratio of 300 ng:300 ng:300 ng and subjected to in vitro enzyme digestion. If this site can effectively perform cleavage, it is expected to cleave the target gene fragment into two fragments of 173 bp and 114 bp. Figure 3 ImageJ calculations revealed that the sgRNA-11390 site achieved a cleavage efficiency of 66% in vitro.

[0064] 3.1.3 Detection of in vivo mutation efficiency For locust eggs injected with the RNP complex, 20 well-developed samples were selected from each site and divided into 4 groups of 5 eggs each; a control group of 5 samples from each site was also set up. Genomic DNA was extracted from well-developed eggs, and the target gene sequence was amplified using nested PCR. Electrophoresis and sequencing revealed that... LmIFT52 A base deletion and mutation occurred at the sgRNA-11390 site of the gene, and the mutation efficiency at this site in vivo reached 75%. Figure 4 ).

[0065] 3.1.4 Transplantation Strategy for Locust Gene Knockout Individuals After injection, the locust eggs were transferred to a culture dish lined with filter paper and cultured at 30°C. The development of the eggs was monitored daily. Once the locusts reached the fifth instar, antennae were harvested for mutation detection and sequencing to obtain G0 generation chimeras. Subsequently, two generations of hybridization were conducted to select a stable homozygous mutant strain.

[0066] First, G0 generation mutants in the adult stage were crossed with wild-type individuals to obtain G1 generation eggs. Five G1 generation eggs from the same hybridization group were sequenced to check for mutations. If a mutation was confirmed, the eggs were cultured until hatching. Antennae were harvested from the nymph stage for sequencing to identify mutant individuals, who were then reared separately. Heterozygotes from the G1 generation carrying the same mutation type were crossbred to obtain G2 generation eggs. G2 generation eggs were cultured and sequenced using the same method. Based on the sequencing peak patterns, three genotypes could be distinguished: heterozygotes (hybrid peaks), wild-type (no mutation), and homozygotes (no hybrid peaks, but with base deletions). Figure 5 ).

[0067] 3.1.5 LmIFT52 Homozygous locusts caused death (1) Survival rate differences in G0 generation: statistics LmIFT52 The survival rates of the G0 generation migratory locusts at each developmental stage (E1 to AD1) were compared, showing that their survival rates at all developmental stages were significantly lower than those of the wild-type (WT) migratory locusts. Figure 6 (A)

[0068] (2) Genotypic survival characteristics of the G2 generation: Statistical analysis of the genotypes and survival rates of the G2 generation population shows that... LmIFT52 Heterozygote ( LmIFT52 + / - They can survive normally, but LmIFT52 homozygote ( LmIFT52 - / - The survival rate of ) is 0, meaning that no surviving homozygous individuals were obtained in the G2 generation ( Figure 6 (B)

[0069] (3) Lethal period and cause of homozygotes: Based on the results of homozygote detection during the egg stage, the hatching process of G2 generation locust eggs was recorded by imaging, and it was found that LmIFT52 Homozygous individuals can hatch from the eggshell, but die within 1-2 minutes of hatching; immediate sequencing of deceased individuals confirms their homozygosity. LmIFT52 Homozygous, and the deceased was found to be lying face down. Figure 6 (C). Based on macroscopic phenotypic analysis, the cause of death was a deficiency in leg motor ability: the legs were unable to support the body to maintain a normal posture, and the person died while struggling.

[0070] (4) Molecular basis of gene function loss: based on LmIFT52 Analysis of the base deletion characteristics of homozygotes can help predict the cause of mutations. LmIFT52 Deletion of transmembrane domain of gene ( Figure 6 (D), which leads to the loss of LmIFT52 protein function, which is the core molecular mechanism of the above-mentioned survival defects and phenotypic abnormalities.

[0071] 3.2 RNAi effectively silences candidate genes in chimeras against LmIFT52 The lethal phenotype of gene knockout homozygotes was observed. The G0 generation staged RNAi strategy employed in this invention (i.e., microinjection of sgRNA into locust eggs within 2 hours of birth, identification of mutant individuals after development to the 3rd instar, and subsequent RNAi intervention at doses of 4 μg, 6 μg, and 8 μg per locust at the 3rd, 4th, and 5th instars, respectively) demonstrated a good silencing effect: detection results showed that under this strategy, the locust testicular tissue... LmIFT52 The silencing efficiency can reach 81.91% ( Figure 7 The silencing effect was significant, indicating that this RNAi strategy can be effectively used. LmIFT52 Functional phenotypic studies.

[0072] 3.3 LmIFT52 Impact on locust ... right LmIFT52 -G0 generation, LmIFT52 Phenotypic and locomotion analysis of the -G0-RNAi mutant and wild-type (WT) locusts showed that... LmIFT52 The -G0-RNAi mutant exhibits significant locomotor dysfunction around day 8 (N5D8) of the fifth instar worm, accompanied by leg morphological deformities (disordered, bent, and struggling irregularities). Figure 8 ), and the speed of action was significantly slowed down.

[0073] The jumping height of individuals in the 7th day of the fifth instar (N5D7) showed that... LmIFT52The individual jumping height of the -G0-RNAi mutant was lower than the average level of wild-type locusts during the same period. Figure 9 (A), and LmIFT52 - The locusts of generation G0, 2 days old (AD2), also had weaker locust mobility than the wild type. Figure 9 (B)

[0074] Jump statistics show that LmIFT52 Individuals in the -G0-RNAi group almost completely lost their jumping ability, in stark contrast to the wild type. Figure 10 ).also, LmIFT52 -G0-RNAi mutants have weak survival ability, and most individuals cannot develop into adults (the sample size of adults is insufficient and has no statistical value), and they die within 24 hours after the appearance of abnormal movement phenotype.

[0075] The above results indicate that LmIFT52 Genes play a crucial regulatory role in the limb morphogenesis and locomotion of locusts. The loss of their function will significantly impair the locusts' locomotion performance and thus affect their survival.

[0076] 3.4 LmIFT52 Effects on the reproductive capacity of male locusts For wild-type males × wild-type females, LmIFT52 -G0 generation male insect × wild-type female insect, LmIFT52 Analysis of oviposition-related indicators in the mating experiments of three groups of male -G0-RNAi mutant insects × wild-type female insects showed that the offspring of the wild-type combination formed two egg sacs with lengths of 4.6 cm and 4.2 cm, respectively, and the corresponding number of eggs were 71 and 74. LmIFT52 - The offspring of the G0 generation male assemblages formed only one egg sac, 4.0 cm in length, containing 64 eggs; while LmIFT52 The offspring of the -G0-RNAi mutant male combination produced only one egg sac with a length of 3.2 cm, and the number of eggs was further reduced to 45. Figure 11 ).

[0077] Eggs from all groups were cultured simultaneously until 15 days of age (pre-hatching stage), with wild-type combinations and... LmIFT52 The eggs of the G0 generation male assemblage all exhibited normal developmental morphology. LmIFT52 The eggs of the -G0-RNAi mutant male combination showed significant morphological heterogeneity and were in a state of abnormal development. Figure 12 (A) Genome sequencing of these abnormal oocytes revealed heterogeneous peak signals at their target gene loci, confirming that these abnormal oocytes were... LmIFT52 The offspring of male G0-RNAi mutants ( Figure 12 (B)

[0078] Further statistics show that LmIFT52The proportion of abnormal eggs in the offspring of male hybrids with the -G0-RNAi mutant was as high as 97.78%. Figure 13 This result clearly LmIFT52 The male G0-RNAi mutant has a severe defect in reproductive function and is unable to produce healthy offspring.

[0079] 3.5 LmIFT52 Affects the normal development of sperm flagella in locusts Anti-LmIFT52 staining results during early spermatogenesis (flagellation stage, N5 stage) and maturation stage (AD8 stage) showed that in early sperm cells... , LmIFT52 No significant LmIFT52 protein signal was detected in the centriole region of the -G0-RNAi mutant, while a clear LmIFT52 signal was observed near the centriole of wild-type early sperm cells. Figure 14 (A) In mature sperm bundles, LmIFT52 The LmIFT52 signal in the -G0-RNAi mutant is located in a region far from the cell nucleus, which is significantly different from the distribution pattern of LmIFT52 in the wild type, which is located at the junction of the cell nucleus and flagella. Figure 14 (B)

[0080] The above results indicate that LmIFT52 The loss of function not only affects its subcellular localization pattern during sperm development, but also interferes with protein distribution in the centriole region during early sperm development, ultimately disrupting the normal developmental process and structural formation of sperm. This further confirms that... LmIFT52 It plays an irreplaceable regulatory role in the development of locust sperm.

[0081] Based on the mammalian-like structural features of locust sperm flagella, LmIFT52 AC-Tubulin (labeling centrioles), Mito (labeling mitochondria), and DAPI (labeling nuclei) were used to label sperm bundles of the G0-RNAi mutant to more clearly demonstrate the difference between wild-type and... LmIFT52 The structural differences in G0-RNAi mutant sperm were analyzed in this invention, which yielded a schematic diagram of locust sperm. Figure 15 (AB) visually presents the differences in flagella morphology between the two. Staining results show that compared to the wild type, LmIFT52 The sperm flagella of the -G0-RNAi mutant exhibit significant shortening or incomplete structure, along with disordered centrosome arrangement and instances of centrosome structural loss. Figure 15 (C) The above results suggest LmIFT52 The loss of function disrupts the sperm flagella-dependent IFT growth process, thereby affecting the normal structural formation of sperm.

[0082] Example 2: LmIFT88 Functions 1. Experimental Methods 1.1 LmIFT88 Construction of chimeric mutant locusts 1.1.1 Genome structure analysis, sgRNA site design, and primer design (1) Selection of immune genes: Through bioinformatics analysis, immune genes were screened from the locust genome to obtain genes similar to those of the model organism. IFT88 Gene homologous sequences (named) LmIFT88 Based on previous tissue expression profiling data, it was found that this compound was highly expressed in testicular tissues related to spermatogenesis in locusts, suggesting that it may be involved in the regulation of locust spermatogenesis. Therefore, [the following was selected]. LmIFT88 Using this study as the research subject, we will explore its role and mechanism in the development and physiological functions of locusts, and provide experimental support for improving the gene functional network of the IFT family in Orthoptera insects.

[0083] (2) LmIFT88 Genome structure analysis: using the "BLAST" tool on the NCBI website (website: htt-ps: / / www.ncbi.nlm.nih.gov / (and the FlyBase fruit fly gene database (website: https: / / flybase.org) to obtain locust information) LmIFT88 The mRNA sequence and genome sequence of the gene were compared; sequence alignment analysis was performed using SnapGene software to accurately label exon and intron regions, and the results were presented in PowerPoint. LmIFT88 The work of drawing genome structure maps.

[0084] (3) sgRNA site design: Based on the obtained genomic sequence of the gene, log in to the E-CRISP official website (website: http: / / www.e-crisp.org / E-CRISP / index.html ),Will LmIFT88 The second exon sequence of the gene was used to define the design range of sgRNA target sites and was screened online. Based on the comprehensive scoring results of various factors, a sequence with a high score and few off-target sites was selected as the target sequence for subsequent experiments, as shown in Table 15.

[0085] Table 15 LmIFT88 Gene sgRNA sequence (4) Design of specific amplification primers: Design of primers for nested PCR on a genome sequence of about 600 bp containing the sgRNA target sequence (Table 16).

[0086] Table 16 LmIFT88 Nested amplification primers for target gene sequences (5) sgRNA synthesis primer design: Forward and reverse primers were designed on the software, and an 80 bp crRNA / tracrRNA fragment (amplification method see Example 1) was used as a template. Universal-F and Universal-R primers (Table 8) were used for sgRNA synthesis. IFT88 -22807-F / sg IFT88 PCR was performed using -22807-R (Table 17) to obtain the DNA template for the gRNA (Table 17).

[0087] Table 17 sgRNA synthesis primers 1.1.2 In vitro enzyme digestion verification of sgRNA The verification method refers to steps (1)-(8) shown in “1.1.2 sgRNA in vitro enzyme digestion verification” of Example 1.

[0088] 1.1.3 In vivo validation of sgRNA The verification method refers to steps (1)-(2) shown in “sgRNA in vivo verification” of Example 1.

[0089] 1.2 RNA interference LmIFT88 Gene and functional verification 1.2.1 Synthesizing ds LmIFT88 Method (1) During PCR amplification, plasmids were used as templates. The primers used are shown in Table 18. Amplification and purification were performed using the reaction systems and procedures in Tables 9 and 10. The plasmids were then ligated into the T vector to obtain the plasmids. After extraction and purification, the DNA was used as... LmIFT88 double-stranded RNA (ds) LmIFT88 The synthesized template was then used with T7 RiboMAX. TM The Express RNAi System kit (Promega, Madison, WI, USA) was used to synthesize dsRNA. The reaction system was the same as in Table 14 (with the DNA template replaced accordingly, and other reagents and amounts remaining unchanged).

[0090] Table 18 dsLmIFT88 Primer sequence (2)-(7) Same as “1.2 RNA interference” in Example 1 LmIFT52 Steps (2)-(7) in “Gene and Function Verification”.

[0091] 1.2.2 Construction LmIFT88 -G0-RNAi chimeric mutant locust method The method includes the following steps: (1) When the G0 generation locust eggs edited by CRISPR-Cas9 develop to the 3rd instar stage, the antennae are cut off to extract the genome and sequence it to identify mutant individuals; (2) RNAi intervention was implemented in stages for G0 generation individuals: the injection dose for 3rd instar worms was 4 μg, for 4th instar worms it was 6 μg, and for 5th instar worms it was 8 μg, resulting in LmIFT88 -G0-RNAi chimeric mutant locust.

[0092] 1.2.3 LmIFT88 Phenotypic analysis of chimeric mutant locusts The method is the same as in Example 1. LmIFT52 Phenotypic analysis of chimeric mutant locusts.

[0093] 2. Functional Research 2.1 LmIFT88 Functional study in locust migration Same as in Example 1, "2.1" LmIFT52 Functional study in locust movement.

[0094] 2.2 LmIFT88 Functional study in the reproduction of male migratory locusts To investigate LmIFT88 The present invention utilizes a small amount of [unclear text - possibly related to regulatory roles in locust reproduction] to [unclear text - possibly related to the regulatory role in locust reproduction]. LmIFT88 homozygote ( LmIFT88 - / - Two mating experiments were set up: LmIFT88 - / - Female insect × wild-type male insect LmIFT88 - / - Male insects were compared with wild-type females, and oviposition-related indicators, including egg sac length, number of eggs, egg morphology, and proportion of abnormal eggs, were compared between the two groups to clarify... LmIFT88 The impact on the reproductive function of locusts.

[0095] 2.3 LmIFT88 Research on the mechanism of action of locust sperm development Targeting the unique structural features of locust sperm flagella—"centrosome septation, proximal non-IFT dependence, and distal IFT dependence"—this invention provides... LmIFT88 The role of sperm in sperm development was systematically analyzed. First, the role of sperm in sperm development was analyzed. LmIFT88 Sperm bundles from 8-day-old G0-RNAi adults were stained with AC-Tubulin (centriole labeling), Mito (mitochondrial labeling), and DAPI (nuclear labeling) to observe changes in sperm flagella length and elucidate the regulatory mechanism. Specific staining procedures are detailed in "2.3" of Example 1. LmIFT52 "A study on the mechanism of action of locust sperm development."

[0096] 3. Results and Analysis 3.1 LmIFT88 Chimeric mutant locusts cause death 3.1.1 LmIFT88 Genome structure and distribution of sgRNA sites Research results show LmIFT88 The genome is 29013 bp in length and contains 9 exons. Online screening using exon sequences was performed on the E-CRISP website, ultimately identifying the sgRNA-22807 site. Figure 16 ).

[0097] 3.1.2 Verification of in vitro enzyme digestion efficiency Use the filtered results LmIFT88 Subsequent experiments were conducted using the sgRNA site of the gene (sgRNA-22807). First, the genomic fragment containing the target site was amplified using nested PCR. Then, Cas9 protein, sgRNA, and the genomic fragment to be cleaved were thoroughly mixed at a ratio of 300 ng:300 ng:300 ng and subjected to in vitro enzyme digestion. If this site can effectively perform cleavage, it is expected to cleave the target gene fragment into two fragments of 182 bp and 160 bp. Figure 17 ImageJ calculations revealed that the sgRNA-22807 site can be cleaved at an efficiency of 78% in vitro.

[0098] 3.1.3 Detection of in vivo mutation efficiency The detection process was the same as in "3.1.3 Detection of in vivo mutation efficiency," and it was observed that during injection... IFT88 The gene target site contains a base deletion, and the mutation efficiency is 75%. Figure 18 ).

[0099] 3.1.4 Transplantation Strategy for Locust Gene Knockout Individuals Same as "3.1.4 Locust gene knockout individual passaging strategy".

[0100] 3.1.5 LmIFT88 Homozygous locusts caused death (1) Survival rate differences in G0 generation: statistics LmIFT88 The survival rates of the G0 generation migratory locusts at each developmental stage (E1 to AD1) were compared, showing that their survival rates at all developmental stages were significantly lower than those of the wild-type (WT) migratory locusts. Figure 19 (A)

[0101] (2) Genotypic survival characteristics of the G2 generation: Statistical analysis of the genotypes and survival rates of the G2 generation population showed that... LmIFT88 Heterozygote ( LmIFT88 + / - They can survive normally, while LmIFT88Homozygote (LmIFT88) - / - Only 3 survived, indicating that very few homozygous individuals survived in the G2 generation, approaching lethal levels. Figure 19 (B)

[0102] (3) Lethal period and cause of homozygotes: Based on the results of homozygote detection during the egg stage, the hatching process of G2 generation locust eggs was recorded by imaging, and it was found that LmIFT88 Homozygous individuals can hatch from the eggshell, but die within 2-3 hours after hatching; real-time sequencing of deceased individuals confirms their homozygosity. LmIFT88 Homozygous, and the typical phenotype is severe hind leg flexion, making it impossible to maintain a normal standing posture. Figure 19 (C). Based on macroscopic phenotypic analysis, the cause of death was a defect in leg motor function: the mutant died within a short period of time due to the loss of limb support ability and inability to maintain a normal body position.

[0103] 3.2 RNAi effectively silences candidate genes in chimeras against LmIFT88 The lethal phenotype of gene knockout homozygotes was observed. This invention also employed a staged RNAi strategy for the G0 generation (i.e., microinjection into locust eggs within 2 hours of birth, followed by RNAi intervention at doses of 4 μg, 6 μg, and 8 μg at the 3rd, 4th, and 5th instars, respectively), demonstrating a good silencing effect: Detection results showed that under this strategy, locust testes... LmIFT88 The silencing efficiency can reach 93.8% ( Figure 20 The silencing effect was significant, indicating that this RNAi strategy can be effectively used. LmIFT88 Functional phenotypic studies.

[0104] 3.3 LmIFT88 Impact on locust ... right LmIFT88 -G0 generation, LmIFT88 Phenotypic and locomotion analysis of the -G0-RNAi mutant and wild-type (WT) locusts showed that: LmIFT88 The -G0-RNAi mutant exhibits strong locomotor dysfunction at day 8 (N5D8) of the fifth instar worm, accompanied by leg morphological deformities (appearing as bent, struggling, and irregular). Figure 21 ), and the rate of action is significantly slow.

[0105] The jumping height of the fifth instar worms on day 7 (N5D7) and the adults on day 2 showed that... LmIFT88 -G0-RNAi mutants bounced significantly less than wild-type mutants at the same time ( Figure 22 Furthermore, the abnormal movement phenotype is more pronounced in the fifth instar stage, while it weakens in the adult stage.

[0106] Jump statistics show that LmIFT52 Individuals in the -G0-RNAi group almost completely lost their jumping ability, in stark contrast to the wild type. Figure 23 ).also, LmIFT88 The -G0-RNAi mutant can survive for 1-2 days after the onset of abnormal motility phenotypes, demonstrating a certain degree of survival compensation. LmIFT88 For mutants, the lethal effect does not occur instantly, but rather is a gradual process of decay.

[0107] The above results indicate that LmIFT88 The loss of gene function leads to leg deformities and a significant decrease in locust ... LmIFT88 It plays a key regulatory role in the development and functional maintenance of the locust locust's locust ...

[0108] 3.4 LmIFT88 Effects on the reproductive capacity of male locusts Based on two sets of mating experiments— LmIFT88 - / - Female insect × wild-type male insect LmIFT88 - / - Analysis of oviposition indicators in two mating experiments involving male insects and wild-type female insects showed that: LmIFT88 - / - The offspring of a female and a wild-type male produce one egg sac, which is 5 cm long and contains 74 eggs. LmIFT88 - / - The offspring of the male × wild-type female combination also produced one egg sac measuring 3.7 cm in length, with a total of 57 eggs. Figure 24 (AB).

[0109] The eggs in each group were cultured simultaneously until 15 days of age (pre-hatching stage). LmIFT88 - / - The eggs of female insects multiplied by wild-type males develop normally and hatch into nymphs. LmIFT88 - / - The eggs of male insects × wild-type female insects exhibit abnormal development. Figure 25 ).

[0110] Further statistics show that LmIFT88 - / - The proportion of abnormal eggs in the offspring of a female × wild-type male was 13.51%, while LmIFT88 - / - The proportion of abnormal eggs in the offspring of male insects × wild-type female insects was as high as 94.74%. Figure 26 This result clearly reveals that LmIFT88It plays an indispensable role in the male reproduction process of locusts. Its failure will cause reproductive dysfunction in male locusts, resulting in abnormal development of offspring.

[0111] 3.5 LmIFT88 Affects the elongation of sperm flagella in locusts right LmIFT88 Sperm bundles from the -G0-RNAi mutant were stained with AC-Tubulin (for centrioles), Mito (for mitochondria), and DAPI (for nuclei). The results showed that, compared with the wild type, the mutant sperm flagella exhibited a distinct "truncation" phenotype at the distal end of IFT-dependent growth, and the extension process in this region was completely halted. Figure 27 This discovery directly confirms... LmIFT88 It is a core regulatory factor for IFT-dependent growth of distal flagella in locust sperm. Its loss of function will block flagellar extension in this region, thereby disrupting the normal structural formation of sperm.

[0112] As can be seen from the results of Examples 1-2 above, LmIFT52 This gene is essential for the survival of locusts. Homozygous deletion of this gene is lethal and accompanied by leg movement defects, which is speculated to be due to abnormal regulation of ciliary neurons. The staged RNAi strategy established in this study for the G0 generation (silencing efficiency of 81.91%) has solved the obstacle in the study of homozygous lethality. The deletion of this gene resulted in an abnormal egg ratio of 97.78% in male offspring. Due to the failure to regulate sperm flagella growth, it confirms its key role in male reproduction. The main mechanism is to maintain the integrity of cilia / flagellates.

[0113] LmIFT88 Homozygous offspring are lethal in early childhood, exhibiting hind leg curvature and decreased motor function, which affects early childhood dependence. LmIFT52 In comparison, its lethal effect is milder, and a small number of homozygous offspring can survive to adulthood. The deletion of this gene results in an abnormal egg rate of 94.74% in male offspring, mainly because... LmIFT52 and LmIFT88 The locusts have different roles in sperm development. Immunofluorescence and in situ hybridization staining showed that LmIFT88 mRNA is mainly in the sperm cytoplasm, while its protein is concentrated around the nucleus when the cilia are just growing. As the cilia grow longer, it is distributed along the entire length of the flagellum. In contrast, LmIFT52 mRNA and protein are mainly in the sperm head and at the junction of the nucleus and flagellum, while in the sperm cell they are concentrated in the centrosome region where the cilia begin.

[0114] Functionally, the absence of both will result in male offspring having mostly abnormal eggs, but the reasons are different: LmIFT52 The absence of sperm flagella can cause them to become shorter and structurally incomplete, and centrosomes to become disorganized or even absent. LmIFT88 Absence causes the distal end of the sperm flagellum to stop growing, resulting in a "truncation" appearance. Additionally, LmIFT52The lethal effect is stronger; homozygous mutants are almost always lethal, while LmIFT88 The lethality is relatively mild, and a small number of homozygous mutants can grow into adults.

[0115] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of inhibitors of IFT family genes in any of the following: (1) Application in the preparation of products that regulate locust limb movement and male reproduction; (2) Application in the preparation of products for controlling locusts; (3) Application in the preparation of homozygous knockout mutants of IFT family genes; in, The IFT family genes are LmIFT52 and LmIFT88 The LmIFT52 and LmIFT88 The genomic fragment sequences are shown in SEQ ID NO.22 and SEQ ID NO.23; The regulation of locust limb movement and male reproduction is achieved by inhibiting the expression of IFT family genes, leading to lethality, leg movement disorders, and abnormal male reproductive function in homozygous locusts.

2. The application as described in claim 1, characterized in that, The inhibitors of the IFT family genes include: knockout LmIFT52 The sgRNA of the gene, the target sequence of which is shown in SEQ ID NO.1; or knockout. LmIFT88 The sgRNA of the gene, the target sequence of which is shown in SEQ ID NO.

13.

3. The application as described in claim 1, characterized in that, The inhibitors of the IFT family genes include: interference LmIFT52 Gene expression of dsRNA, the nucleotide sequence of which is shown in SEQ ID NO.24; or interference LmIFT88 The dsRNA expressed by the gene, the nucleotide sequence of which is shown in SEQ ID NO.

25.

4. The use of the biological material that inhibits the expression of the IFT family genes as described in claim 1 in any of the following: (1) Application in the preparation of products that regulate locust limb movement and male reproduction; (2) Application in the preparation of products for controlling locusts; (3) Application in the preparation of homozygous knockout mutants of IFT family genes; in, The biomaterials that inhibit the expression of IFT family genes include those that inhibit... LmIFT52 or LmIFT88 The expressed protein or the knockout vector.

5. A method for controlling locusts by targeting IFT family genes, characterized in that, Includes the following steps: Reduce the expression level of IFT family genes in locusts, or knock out IFT family genes; The IFT family genes are LmIFT52 and LmIFT88 The LmIFT52 and LmIFT88 The genomic fragment sequences are shown in SEQ ID NO.22 and SEQ ID NO.

23.

6. The method as described in claim 5, characterized in that, Through interference LmIFT52 Gene or LmIFT88 Gene expression is reduced, among which, interference LmIFT52 The dsRNA sequence for gene expression is shown in SEQ ID NO.24, interfering with... LmIFT88 The dsRNA sequence of the gene expression is shown in SEQ ID NO.25; Knockout LmIFT52 The sgRNA target sequence of the gene is shown in SEQ ID NO.

1. Knockout LmIFT88 The sgRNA target sequence of the gene is shown in SEQ ID NO.

13.

7. A method for constructing a mutant of the IFT family gene in locusts, characterized in that, Includes the following steps: (1) Design and synthesize targets LmIFT52 or LmIFT88 The sgRNA of the gene was used to construct a CRISPR-Cas9 editing system; wherein, the targeted... LmIFT52 The sgRNA sequence of the gene is shown in SEQ ID NO.1, targeting... LmIFT88 The sgRNA sequence of the gene is shown in SEQ ID NO.13; (2) The RNP complex formed by Cas9 protein and sgRNA was microinjected into locust eggs to obtain G0 generation chimeric mutants; (3) RNA interference was performed in stages on the 3rd-5th instar larvae of the G0 generation mutant individuals to obtain G0-RNAi chimeric mutants; among which, the interference LmIFT52 The dsRNA sequence for gene expression is shown in SEQ ID NO.24, interfering with... LmIFT88 The dsRNA sequence of the gene expression is shown in SEQ ID NO.

25.

8. The construction method as described in claim 7, characterized in that, The phased implementation of RNA interference involves injecting dsRNA into G0 generation mutant individuals at a rate of 4 μg for 3rd instar worms, 6 μg for 4th instar worms, and 8 μg for 5th instar worms.

9. The construction method as described in claim 7, characterized in that, The LmIFT52 Homozygous mutants are lethal within 1-2 minutes of hatching, with the lethal phenotype being loss of leg motor function; LmIFT88 The homozygous mutant is lethal within 2-3 hours of hatching, and the lethal phenotype is severe bending of the hind legs.

10. A biological pesticide for controlling locusts, characterized in that, Including inhibitors of IFT family genes, wherein the inhibitors of IFT family genes include any one of the following: (1) Knock out the sgRNA of the LmIFT52 gene, the target sequence of which is shown in SEQ ID NO.1; (2) Knock out the sgRNA of the LmIFT88 gene, the target sequence of which is shown in SEQ ID NO.13; (3) Interference LmIFT52 The dsRNA expressing the gene, the nucleotide sequence of which is shown in SEQ ID NO.24; (4) Interference LmIFT88 The dsRNA expressed by the gene, the nucleotide sequence of which is shown in SEQ ID NO.25.

Images