Lncrna-mediated ceRNA regulatory axis and application thereof in proliferation regulation of muscle satellite cells of shanbei white cashmere goat

Abstract

The application discloses a kind of 1ncRNA-mediated ceRNA regulatory axis and its application in the proliferation regulation of muscle satellite cell of Shanbei white cashmere goat.The ceRNA regulatory axis is composed of MSTRG.5182.1, chi-miR-424-5p and IKBKG gene;MSTRG.5182.1 is targeted to adsorb chi-miR-424-5p by molecular sponge effect, removes the expression inhibition of chi-miR-424-5p to IKBKG gene, up-regulates the expression amount of IKBKG gene, and then regulates the proliferation and migration of muscle satellite cell of Shanbei white cashmere goat.The application identifies the specific ternary ceRNA regulatory network of this breed in Shanbei white cashmere goat in vivo for the first time, clarifies the targeted interaction and regulation correlation among the three, and then can construct a standardized muscle satellite cell in vitro research model, provides new molecular target and theoretical basis for the functional mechanism analysis of cashmere goat muscle cell in vitro, and has good application prospect.

Description

Technical Field

[0001] This invention belongs to the field of animal molecular biology and gene regulation technology, specifically involving a lncRNA-mediated ceRNA regulatory axis and its application in the regulation of muscle satellite cell proliferation in Shaanbei white cashmere goats. Background Technology

[0002] Muscle satellite cells are skeletal muscle-specific stem cells, and their proliferation and migration abilities are core evaluation indicators for in vitro muscle cell function studies. The competitive endogenous RNA (ceRNA) mechanism is a core pathway by which non-coding RNA regulates gene expression.

[0003] Long non-coding RNAs (lncRNAs) can target and adsorb microRNAs (miRNAs) through base pairing, relieving the inhibitory effect of miRNAs on the expression of downstream target mRNAs, regulating the expression level of target genes, and thus mediating various biological processes such as cell proliferation, migration, and differentiation. Existing research has identified multiple lncRNA-miRNA-mRNA ceRNA regulatory pathways involved in the regulation of muscle cell development in various livestock and poultry species, including pigs, cattle, and sheep, verifying the important role of non-coding RNAs in the in vitro functional regulation of livestock and poultry muscle cells.

[0004] Currently, significant technological shortcomings and research gaps remain in the field of molecular regulation of livestock and poultry muscle cells. Firstly, existing research on ceRNA regulatory mechanisms primarily focuses on common livestock and poultry such as pigs, cattle, and sheep. Research on the breed-specific muscle cell regulatory network of the Shaanbei White Cashmere Goat is insufficient, and the molecular mechanism by which MSTRG.5182.1 adsorbs chi-miR-424-5p via ceRNA, thereby regulating IKBKG gene expression and affecting the biological function of muscle satellite cells, has not yet been elucidated. Secondly, existing technologies do not clarify the pairwise targeting and expression regulation relationships among MSTRG.5182.1, chi-miR-424-5p, and IKBKG, lacking a ternary ceRNA regulatory axis system adapted to Shaanbei White Cashmere Goat muscle satellite cells. Thirdly, there is currently no in vitro targeted regulation technology for muscle satellite cells based on this breed-specific ternary ceRNA regulatory axis, hindering the development and utilization of in vitro functional models of primary Shaanbei White Cashmere Goat muscle cells.

[0005] In summary, existing technologies have significant shortcomings in the regulation mechanism of specific ceRNA in muscle cells of Shaanbei white cashmere goats, the three-molecule interaction regulatory network of MSTRG.5182.1, chi-miR-424-5p, and IKBKG, as well as in vitro targeted regulation technology of muscle cells, making it difficult to support the research and application of related technologies for in vitro functional models of muscle satellite cells of Shaanbei white cashmere goats. Summary of the Invention

[0006] To address the shortcomings of existing technologies, such as the lack of a specific MSTRG.5182.1-chi-miR-424-5p-IKBKG ternary ceRNA regulatory network for Shaanbei white cashmere goats and the absence of an in vitro targeted regulatory system adapted to muscle cells, the purpose of this invention is to provide a lncRNA-mediated ceRNA regulatory axis and its application in the proliferation of muscle satellite cells from Shaanbei white cashmere goats.

[0007] This invention completes the technical construction through a three-layer experimental system: targeted interaction verification, regulatory pathway analysis, and cell functional phenotype detection. First, it verifies the pairwise targeting and binding relationships between MSTRG.5182.1 and chi-miR-424-5p, and between chi-miR-424-5p and IKBKG, thus identifying for the first time a specific ceRNA regulatory axis for muscle satellite cells of Shaanbei white cashmere goats. Second, it elucidates the endogenous competitive expression regulation law of the three mutually restraining each other, enriching the relevant theories of non-coding RNA regulation during the development of cashmere goat muscle satellite cells. Finally, it clarifies the regulatory role of this axis in the proliferation and migration of muscle satellite cells, constructs an in vitro molecular experimental system for studying and intervening in the biological functions of muscle cells, and fills the research gap in the molecular mechanisms of cashmere goat breed-specific muscle cells.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] The first aspect of this invention provides a lncRNA-mediated ceRNA regulatory axis, which is an MSTRG.5182.1-chi-miR-424-5p-IKBKG regulatory axis, composed of a long non-coding MSTRG.5182.1, chi-miR-424-5p, and an IKBKG encoding gene. The nucleotide sequence of the long non-coding MSTRG.5182.1 is shown in SEQ ID NO.1, the nucleotide sequence of chi-miR-424-5p is shown in SEQ ID NO.2, and the nucleotide sequence of the IKBKG encoding gene is shown in SEQ ID NO.3. MSTRG.5182.1 adsorbs chi-miR-424-5p through a base-pairing sponge, and chi-miR-424-5p specifically targets and negatively regulates the transcriptional expression of the IKBKG gene. These three components form an endogenous competitive regulatory network in the muscle satellite cells of Shaanbei white cashmere goats.

[0010] Preferably, in the muscle satellite cells of Shaanbei white cashmere goats, the endogenous competitive regulatory network exhibits the following expression regulation relationships: overexpression of chi-miR-424-5p downregulates IKBKG gene expression, and inhibition of chi-miR-424-5p upregulates IKBKG gene expression; when MSTRG.5182.1 expression is inhibited, IKBKG expression is downregulated and chi-miR-424-5p expression is upregulated; when IKBKG expression is inhibited, MSTRG.5182.1 expression is downregulated and chi-miR-424-5p expression is upregulated; when chi-miR-424-5p expression is inhibited, MSTRG.5182.1 expression is upregulated.

[0011] A second aspect of the present invention provides the application of the above-mentioned lncRNA-mediated ceRNA regulatory axis in the in vitro proliferation regulation of muscle satellite cells of Shaanbei white cashmere goats.

[0012] Preferably, by utilizing the endogenous sponge adsorption of chi-miR-424-5p by MSTRG.5182.1 in the ceRNA regulatory axis, the inhibitory effect of chi-miR-424-5p on the expression of downstream IKBKG gene is relieved, thereby achieving positive regulation of muscle satellite cell proliferation and migration, providing a new target for in vitro functional research of muscle satellite cells of Shaanbei white cashmere goat.

[0013] Preferably, downregulating the expression of MSTRG.5182.1 or IKBKG can inhibit the proliferation and migration of muscle satellite cells of Shaanbei white cashmere goats; downregulating the expression of chi-miR-424-5p can promote the proliferation and migration of muscle satellite cells of Shaanbei white cashmere goats.

[0014] This invention focuses on the aforementioned ceRNA regulatory axis and conducts a series of verification experiments: molecular targeting verification clarifies the specific targeting and binding relationships between MSTRG.5182.1 and chi-miR-424-5p, and between chi-miR-424-5p and IKBKG, laying the molecular basis for the regulatory axis's function; gene interference expression experiments analyze the mutual restraint and regulation of the three; and combined with cell function detection, elucidates the regulatory mechanism of this axis on the proliferation and migration of muscle satellite cells in Shaanbei white cashmere goats.

[0015] The molecular regulatory mechanism of the above-mentioned ceRNA regulatory axis is as follows: MSTRG.5182.1 acts as a molecular sponge through base complementarity pairing, specifically binding to chi-miR-424-5p; chi-miR-424-5p can target the downstream IKBKG gene, and the three form a stable targeted regulatory association within muscle cells. In the muscle satellite cells of Shaanbei white cashmere goats, these three molecules form a dynamically balanced interaction system: downregulation of MSTRG.5182.1 simultaneously inhibits IKBKG expression and increases chi-miR-424-5p levels; knockdown of IKBKG reduces the transcriptional level of MSTRG.5182.1 and upregulates chi-miR-424-5p; inhibition of chi-miR-424-5p promotes MSTRG.5182.1 expression, thereby constructing a dynamically balanced ternary ceRNA regulatory network. Functional validation showed that MSTRG.5182.1 and IKBKG positively promoted the proliferation and migration of muscle satellite cells from Shaanbei white cashmere goats, while chi-miR-424-5p negatively regulated these two biological processes. MSTRG.5182.1, by competitively binding to chi-miR-424-5p, relieved the inhibition of IKBKG expression by this microRNA, ultimately positively regulating the in vitro biological activity of muscle satellite cells.

[0016] Beneficial effects (1) Filling the gap in research on the specific ceRNA regulatory mechanism of Shaanbei white cashmere goat. Existing technologies have failed to fully elucidate the lncRNA-miRNA-mRNA regulatory pathway in muscle satellite cells of Shaanbei white cashmere goat, and lack functional molecular targets suitable for this breed. This invention is the first to construct a three-way ceRNA regulatory network of MSTRG.5182.1-chi-miR-424-5p-IKBKG, elucidating its molecular rules for regulating myocyte proliferation and migration, improving the theoretical system of molecular regulation of cashmere goat muscle cell development, and providing a stable and reliable new molecular target for in vitro functional research of muscle cells.

[0017] (2) Excellent regulatory specificity, suitable for primary muscle cell in vitro research system. All verification experiments of this invention were carried out based on primary muscle satellite cells of Shaanbei white cashmere goats. The endogenous effects of this regulatory axis are stable and the targeting specificity is high. There is no obvious off-target effect, and it can be used to build a standardized in vitro research model of muscle cells.

[0018] (3) It breaks through the limitations of single gene regulation and has a wide range of applicable scenarios. Traditional single molecular targets can only mediate a single cell phenotype, and their application scope is obviously limited. The ternary ceRNA regulatory axis constructed in this invention can simultaneously regulate two biological processes, namely proliferation and migration of muscle satellite cells. It is applicable to various in vitro functional experiments of muscle cells from Shaanxi white cashmere goats and has outstanding basic scientific research application value. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 This is a schematic diagram of the g-IKBKG-wt wild-type vector structure; Figure 2 A schematic diagram of the design of the IKBKG binding site mutation site with chi-miR-424-5p; Figure 3 Sequencing identification maps of IKBKG wild-type and mutant recombinant plasmids; Figure 4 This is a schematic diagram of the structure of the wild-type vector g-MSTRG.5182.1-wt; Figure 5 A schematic diagram of the design of the binding site mutation site for MSTRG.5182.1 and chi-miR-424-5p; Figure 6 Sequencing patterns for wild-type and mutant recombinant plasmids of MSTRG.5182.1; Figure 7 Sequencing identification results for the chi-miR-424-5p sponge recombinant plasmid; Figure 8 The results of dual-luciferase activity assays for chi-miR-424-5p and IKBKG; Figure 9 The results of dual-luciferase activity assays for chi-miR-424-5p and MSTRG.5182.1 are shown. Figure 10 Sequencing pattern of MSTRG.5182.1-sh1 recombinant plasmid; Figure 11 Sequencing identification map of IKBKG-sh1 recombinant plasmid; Figure 12The results of qRT-PCR detection of IKBKG gene expression in chi-miR-424-5p overexpression and interference stable cell lines are shown in (a) and (b) respectively. Figure 13 The results of qRT-PCR detection of gene expression in the MSTRG.5182.1 interference stable cell line are shown in (a) and (b) are the results of IKBKG gene expression and chi-miR-424-5p expression, respectively. Figure 14 The expression results of each axis molecule in the stable cell lines with different gene interference were detected by qRT-PCR. (a) shows the expression result of MSTRG.5182.1 in the IKBKG interference group, (b) shows the expression result of chi-miR-424-5p in the IKBKG interference group, and (c) shows the expression result of MSTRG.5182.1 in the chi-miR-424-5p interference group. Figure 15 The proliferation activity of different stable muscle satellite cell lines was detected by CCK-8 assay. (a) shows the proliferation results of the MSTRG.5182.1 interference group, (b) shows the proliferation results of the IKBKG interference group, and (c) shows the proliferation results of the chi-miR-424-5p interference group. Figure 16 To detect cell migration results of chi-miR-424-5p-interfered stable cell lines at different culture times using a cell scratch assay; Figure 17 Statistical results of 24h cell migration efficiency for chi-miR-424-5p interference-stabilized cell lines; Figure 18 The cell migration results of stable cell lines with different gene interference were detected by the cell scratch assay. (a) shows the migration results of the MSTRG.5182.1 interference group, and (b) shows the migration results of the IKBKG interference group. Figure 19 The statistical results of 24-hour cell migration efficiency of MSTRG.5182.1 and IKBKG interference-stabilized cell lines; Figure 20 A schematic diagram of the regulatory mechanism of MSTRG.5182.1-chi-miR-424-5p-IKBKG ceRNA. Detailed Implementation

[0021] To further clarify the MSTRG.5182.1-chi-miR-424-5p-IKBKG regulatory axis involved in this invention and its application in the regulation of muscle satellite cell function in Shaanbei white cashmere goats, the technical solution of this invention will be described in complete detail below with reference to specific embodiments. The following embodiments are only used to explain this invention and are not intended to limit the scope of protection of this invention.

[0022] The molecular sequences used in the following specific embodiments of the present invention are as follows: the nucleotide sequence of the long non-coding RNA MSTRG.5182.1 is shown in SEQ ID NO.1, the nucleotide sequence of chi-miR-424-5p is shown in SEQ ID NO.2, and the nucleotide sequence of the IKBKG encoding gene is shown in SEQ ID NO.3.

[0023] This invention constructs a model of the overall regulatory network of MSTRG.5182.1-chi-miR-424-5p ceRNA, and the regulatory mechanism is as follows: Figure 20 As shown, MSTRG.5182.1, as a competitive endogenous RNA (ceRNA), specifically adsorbs chi-miR-424-5p through molecular sponge action, thereby relieving the transcriptional repression of downstream target gene IKBKG by chi-miR-424-5p and regulating the proliferation and migration biological processes of muscle satellite cells.

[0024] All cells used in this invention were primary muscle satellite cells from Shaanbei white cashmere goats; the dual-luciferase backbone vector pSI-Check2 and lentiviral vector were commercially available; the complete cell culture medium was DMEM / F12 + 10% fetal bovine serum, and the culture conditions were 37℃ and 5% CO2; the cell transfection reagents, qRT-PCR detection kits, CCK-8 cell proliferation detection kits, and dual-luciferase activity detection kits were all commercially available reagents commonly used in the field; all experimental operations followed the general standard procedures of molecular biology and cell culture; all nucleic acid amplification procedures, cell passage digestion, and plasmid extraction adopted the standard procedures in the field of molecular biology.

[0025] Example 1 Target binding site prediction and construction of dual-luciferase reporter vector Using BiBiServ online analysis software combined with manual sequence alignment, the target binding sites and binding free energies of chi-miR-424-5p with IKBKG 3'UTR and MSTRG.5182.1 with chi-miR-424-5p were predicted and analyzed to screen for target regions with good stability for the design and construction of wild-type and mutant reporter vectors.

[0026] In this embodiment, the pSI-Check2 dual-luciferase reporter gene vector was first used as the backbone vector to construct the g-IKBKG-wt wild-type vector. The vector structure results are as follows. Figure 1 As shown.

[0027] Sequence alignment and prediction of chi-miR-424-5p and IKBKG 3'UTR showed that both contain one 7mer binding site and seven 6mer binding sites. The binding free energy of the 7mer binding site is -26.1 kcal / mol, indicating good thermodynamic stability, suggesting stable binding at this site. This demonstrates that IKBKG is a potential target gene of chi-miR-424-5p. Site-directed mutagenesis was performed based on this key 7mer binding site. The mutation site design results are as follows: Figure 2 As shown in the figure. Further sequencing identification of the constructed IKBKG wild-type and mutant recombinant plasmids was performed, and the sequencing results are shown in the figure. Figure 3 As shown in the figure. The results indicate that the inserted sequences and mutation sites of each plasmid are completely consistent with the preset target sequences, with no base deletions, shifts, or non-specific mutations, confirming that the IKBKG vector is successfully constructed and the sequence is accurate, and can be used for subsequent dual-luciferase detection experiments.

[0028] Building upon the above, further experiments were conducted to predict the target sites of MSTRG.5182.1 and chi-miR-424-5p and to construct the vector. Combining manual sequence alignment and BiBiServ software prediction results, it was found that MSTRG.5182.1 and chi-miR-424-5p possess one 7-mer binding site and one 6-mer binding site. The 7-mer binding site has a free energy of -24.0 kcal / mol and exhibits stable thermodynamic binding characteristics, indicating that the two can stably bind together. This suggests that MSTRG.5182.1 possesses the structural basis for sponge-like adsorption of chi-miR-424-5p via a ceRNA mechanism.

[0029] In this embodiment, the pSI-Check2 vector was used as the backbone to construct the g-MSTRG.5182.1-wt wild-type vector. The vector structure results are as follows. Figure 4 As shown in the figure. Site-directed mutagenesis was performed targeting the key 7mer binding site of both molecules. The design results of the chi-miR-424-5p-MSTRG.5182.1 mutation site are shown below. Figure 5 As shown. Simultaneously, the MSTRG.5182.1 7mer site mutant vector g-MSTRG.5182.1-mut was constructed and used together with the aforementioned IKBKG vector for experiments verifying the bidirectional targeting relationship of the ceRNA regulatory axis.

[0030] The constructed wild-type and mutant recombinant plasmids MSTRG.5182.1 were sequenced and identified. The sequencing results are as follows: Figure 6 As shown in the figure. The results indicate that the inserted sequences and mutation sites of each plasmid are completely consistent with the target design sequences, with no base deletions, shifts, or non-specific mutations, confirming that the g-MSTRG.5182.1-wt and g-MSTRG.5182.1-mut vectors were successfully constructed and their sequences were accurate. The above IKBKG vectors and the MSTRG.5182.1 vector together constitute a complete targeted validation vector system, meeting the detection requirements of subsequent dual-luciferase experiments.

[0031] Based on the key binding sites of the above-mentioned site-directed mutagenesis modification, this embodiment simultaneously compiles the core target sequence and site mutation sequence of chi-miR-424-5p and the target gene, and supplements the complete insertion sequence of the miRNA sponge vector. The specific sequence information is as follows: chi-miR-424-5p mature strand (wild-binding sequence that binds to the target gene): CAGCAGCAATTCATGTTTTGA; Wild-type target binding sequence (reverse complementary sequence, wild-type binding site of target gene): TCAAAACATGAATTGCTGCTG; Site-mutated target-binding sequence (mutated reverse complementary sequence, for use in mutant vectors): TCAAAACATATTTGCTGCTG; Complete insertion sequence of chi-miR-424-5p sponge vector (SEQ ID NO.4): TCAAAACATATTTGCTGCTGTATACTCAAAACATATTTGCTGCTGACATCTCAAAACATATTTGCTGCTGTCTTCATCAAAACATATTTGCTGCTG; The sponge recombinant plasmid was sequenced and compared for verification. The sequencing identification results are as follows: Figure 7 As shown, the sequencing results indicate that the sequencing sequence completely matches the preset target sequence, with no base mutations or deletions, confirming that the miRNA sponge vector construction is qualified and can be used for subsequent in vitro molecular adsorption verification experiments.

[0032] In summary, this invention successfully constructed and validated the bidirectional targeting reporter vectors IKBKG and MSTRG.5182.1. Targeting prediction results confirmed that chi-miR-424-5p possesses a stable 7-mer target binding site with both IKBKG and MSTRG.5182.1, exhibiting low binding free energy and stable molecular binding structure, providing precise sequence support for site-directed mutagenesis modification of the vectors. Combined with the vector structure design, mutation site screening, and plasmid sequencing validation results, it can be confirmed that all wild-type and mutant recombinant vector sequences constructed in this invention are accurate and effectively constructed. The aforementioned IKBKG vector, MSTRG.5182.1 vector, and miRNA sponge vector together constitute a complete in vitro targeting validation vector system. This invention obtained all the experimental materials required for bidirectional targeting validation of the ceRNA regulatory axis and clarified the targeting binding structural characteristics between MSTRG.5182.1-chi-miR-424-5p-IKBKG molecules, providing a stable and reliable experimental foundation for subsequent in vitro targeting validation experiments.

[0033] Example 2 Dual-luciferase reporter gene assay to verify direct molecular targeting relationship To verify the specific direct targeting binding relationships between MSTRG.5182.1 and chi-miR-424-5p, and between chi-miR-424-5p and IKBKG in vitro, this example conducted a dual-luciferase reporter gene assay. Muscle satellite cells from Shaanbei white cashmere goats were used as the experimental vector. A mimic-NC negative control group and a chi-miR-424-5p mimic overexpression group were set up, with three biological replicates for each group. Cells were cultured for 48 h after transfection, and the relative luciferase activities of each group were detected and statistically analyzed to determine the targeting binding characteristics between molecules.

[0034] (1) Validation of the target relationship between chi-miR-424-5p and IKBKG Luciferase activity assay results are as follows Figure 8 As shown in the figure. The results indicated that, compared with the NC mimics control group, overexpression of chi-miR-424-5p significantly inhibited the luciferase activity of the g-IKBKG-wt wild-type vector (P < 0.001). After site-directed mutagenesis of the IKBKG 3'UTR targeting binding site, the luciferase activity of the g-IKBKG-mut mutant vector was not significantly different from that of the control group, and the targeting inhibitory effect of chi-miR-424-5p was completely lost. This confirms the specific targeting regulatory relationship between chi-miR-424-5p and IKBKG.

[0035] chi-miR-424-5p significantly inhibited vectors carrying the wild-type IKBKG 3'UTR sequence, showing no significant regulatory effect on vectors with site mutations. This indicates that the targeted inhibition effect strictly depends on the pre-defined specific binding site, and there is no non-specific regulatory interference. This example demonstrates in vitro that chi-miR-424-5p can specifically target and bind to the IKBKG 3'UTR and inhibit its transcriptional activity, clarifying the downstream target correspondence of this ceRNA regulatory axis.

[0036] (2) Validation of the targeting relationship between MSTRG.5182.1 and chi-miR-424-5p Luciferase activity assay results are as follows Figure 9 As shown in the figure. The results showed that, compared with the NC mimics control group, overexpression of chi-miR-424-5p significantly reduced the luciferase activity of the g-MSTRG.5182.1-wt wild-type vector, with a highly significant difference between groups (P < 0.001). After mutation modification of the key target binding site of MSTRG.5182.1, there was no significant difference in luciferase activity between the experimental group and the control group, and the inhibitory effect of chi-miR-424-5p on the vector completely disappeared. This confirms that chi-miR-424-5p has a specific target binding relationship with MSTRG.5182.1.

[0037] In vitro targeting validation results further demonstrate that the targeted inhibitory effect of chi-miR-424-5p on the wild-type sequence of MSTRG.5182.1 exhibits strict site specificity. Binding to site mutations completely blocks the interaction between the two, with no off-target or non-specific regulatory phenomena. Combined with the aforementioned targeting validation results of chi-miR-424-5p and IKBKG, this corroborates that MSTRG.5182.1 can indirectly regulate the expression of the downstream IKBKG gene through site-specific binding and adsorption of chi-miR-424-5p, thereby regulating the biological behavior of muscle satellite cells in Shaanbei white cashmere goats through the MSTRG.5182.1-chi-miR-424-5p-IKBKG regulatory axis.

[0038] Example 3 qRT-PCR validates the regulatory relationship of endogenous expression along the regulatory axis This embodiment constructs stable cell lines with MSTRG.5182.1 and IKBKG gene interference lentiviruses, as well as stable cell lines with chi-miR-424-5p overexpression and interference. The negative control siRNA, target gene siRNA, and shRNA double-stranded sequence information used in each experiment are as follows: (1) Negative control NC universal full sequence Control siRNA single-stranded sequence: TTCTCCGAACGTGTCACGTAA; Control shRNA positive strand (top strand): GATCCGTTCTCCGAACGTGTCACGTAATTCAAGAGATTACGTGACACGTTCGGAGAATTTTTTC; The reference shRNA antisense strand (bottom strand) is: AATTGAAAAAATTCTCCGAACGTGTCACGTAATCTCTTGAATTACGTGACACGTTCGGAGAACG; (2) Target lncRNA g-MSTRG.5182 target sequence (sh1) Targeting the core interference sequence of siRNA1: TGTCCTGCCATGTTGTTAAAT; MSTRG.5182.1 shRNA1 positive strand (top strand, vector insertion complete single strand) (SEQ ID NO.5): GATCCGTGTCCTGCCATGTTGTTAAATCTCGAGATTTAACAACATGGCAGGACATTTTTTG; MSTRG.5182.1 shRNA1 antisense strand (Bottom strand) (SEQIDNO.6): AATTCAAAAAATGTCCTGCCATGTTGTTAAATCTCGAGATTTAACAACATGGCAGGACACG; The sequencing results of the g-MSTRG.5182 shRNA1 recombinant plasmid were completely consistent with the pre-defined sequence, indicating successful vector construction. The sequencing map is shown below. Figure 10 .

[0039] (3) IKBKG interference sequence (sh1) Targeting siRNA1 sequence: AGCAGCTGCAGAGGGAATATA; IKBKGshRNA1 positive strand (Topstrand, SEQ ID NO.7): GATCCGAGCAGCTGCAGAGGGAATATACTCGAGTATATTCCCTCTGCAGCTGCTTTTTTTG; IKBKGshRNA1 antisense strand (Bottomstrand, SEQ ID NO. 8): AATTCAAAAAAAAGCAGCTGCAGAGGGAATATACTCGAGTATATTCCCTCTGCAGCTGCTCG; The sequencing results of the g-IKBKGshRNA1 recombinant plasmid completely matched the designed sequence, indicating successful vector construction. Sequencing results are shown below. Figure 11 .

[0040] To verify the true regulatory relationship among the three in the cellular endogenous environment, this embodiment constructed various stable muscle satellite cell lines with chi-miR-424-5p overexpression, chi-miR-424-5p interference, MSTRG.5182.1 interference, and IKBKG interference. The expression changes of each molecule were detected by qRT-PCR to analyze the endogenous regulatory characteristics of the ceRNA axis.

[0041] The shRNA, siRNA, and primer sequences used in this invention are shown in Tables 1 and 2.

[0042] Table 1. miRNA primer sequence information

[0043] Table 2. Primer sequence information for lncRNA and mRNA

[0044] (1) chi-miR-424-5p negatively regulates IKBKG expression. qRT-PCR detection results are as follows: Figure 12 As shown in the figure. The results showed that, compared with the blank group and the negative control group, the mRNA expression level of IKBKG in the chi-miR-424-5p overexpression cell line was significantly downregulated (P < 0.01); the mRNA expression level of IKBKG in the chi-miR-424-5p interference cell line was extremely significantly upregulated (P < 0.001). This confirms that the construction of chi-miR-424-5p overexpression and interference stable cell lines via lentiviral transfection can effectively regulate the endogenous expression level of the IKBKG gene, indicating that chi-miR-424-5p can participate in the biological regulation of muscle satellite cells of Shaanbei white cashmere goats by regulating IKBKG expression.

[0045] (2) Regulation of chi-miR-424-5p / IKBKG expression pattern by MSTRG.5182.1. The gene expression detection results after interfering with MSTRG.5182.1 are shown in Figure 13. The results show that in the MSTRG.5182.1-sh1 stable muscle satellite cell line, the expression level of IKBKG was significantly reduced, and the expression level of chi-miR-424-5p was significantly increased. This confirms that after knocking down MSTRG.5182.1, the number of ceRNA molecules that can adsorb miRNAs in the cell is reduced, and a large amount of free chi-miR-424-5p accumulates, thereby enhancing the transcriptional repression effect on the downstream IKBKG gene, which is completely consistent with the endogenous regulation characteristics of ceRNA.

[0046] (3) Regulatory Axis Molecular Linkage Regulation: The results of molecular linkage expression detection are shown in Figure 14. The results showed that in the IKBKG interference-stabilized muscle satellite cell line, the expression of MSTRG.5182.1 was significantly decreased, while the expression of chi-miR-424-5p was significantly increased; in the chi-miR-424-5p interference-stabilized cell line, the expression of MSTRG.5182.1 also showed a significant downregulation trend. This confirms that the expression of molecules within the regulatory axis is interconnected and mutually restrictive, forming a stable ceRNA regulatory network in the muscle satellite cells of Shaanbei white cashmere goats.

[0047] Example 4 Verification of the regulatory role of the regulatory axis in the proliferation and migration of muscle satellite cells To clarify the regulatory effect of the MSTRG.5182.1-chi-miR-424-5p-IKBKG regulatory axis on the biological function of muscle satellite cells in Shaanbei white cashmere goats, this invention uses the CCK-8 assay and cell scratch healing assay to detect the cell proliferation and migration ability of each stable cell line, and systematically analyzes the regulatory rules of this ceRNA regulatory axis on the proliferation and migration of muscle satellite cells.

[0048] (1) Verify the regulatory role of the regulatory axis in the proliferation of muscle satellite cells. The proliferation viability of each stable cell line was quantitatively detected using the CCK-8 assay. The specific procedure was as follows: Stable muscle satellite cells from each group were seeded into 96-well plates. The optimal incubation time for CCK-8 was set at 3 days. PBS buffer was added to the outer channels of the wells to prevent evaporation of the culture medium and ensure the stability of the culture system. After culturing the cells for 24 h, 48 h, 72 h, and 96 h, CCK-8 reagent was added to each well. After incubation for the appropriate time under light-protected conditions, the OD of each group of cells was measured using a microplate reader. 450nmAbsorbance values ​​were used to plot cell proliferation curves, thereby quantitatively evaluating the cell proliferation capacity of each group. Specific test results are as follows: Figure 15 As shown.

[0049] The results showed that the stable muscle satellite cell line with MSTRG.5182.1 interference exhibited significantly lower cell proliferation than the control group from 48 h of culture. The stable cell line with IKBKG interference showed significantly lower cell proliferation than the control group at all time points. The stable cell line with chi-miR-424-5p interference showed significantly higher cell proliferation than the control group from 48 h of culture. These results confirm that MSTRG.5182.1 and downstream IKBKG have a positive regulatory effect on muscle satellite cell proliferation, and that chi-miR-424-5p can significantly inhibit cell proliferation.

[0050] (2) Verify the regulatory role of the regulatory axis in the migration of muscle satellite cells. The migration ability of stable cells in each group was quantitatively detected using a cell scratch healing assay. The specific steps are as follows: (a) Cell plating: The muscle satellite cells of Shaanbei white cashmere goats were digested with trypsin according to the cell digestion method described above. The prepared single-cell suspension was evenly seeded into 6-well cell culture plates and placed in a conventional cell culture incubator for continuous culture to ensure that the cell seeding density of each group was uniform and the culture conditions were consistent.

[0051] (b) Cell scratch treatment: The scratch test was carried out when the cell fusion density in the 6-well plate reached about 90%. Before the test, a sterile ruler was used for positioning. A sterile 200 μL pipette tip was used to scratch the cell monolayer at a uniform speed perpendicular to the bottom of the culture plate. Each well was scratched 3 times to ensure that the scratch width was uniform and the direction was straight, so as to avoid the scratch difference from interfering with the test results.

[0052] (c) Washing and Culture: After scratching, the cells in the well plate were gently washed three times with 1 mL of sterile PBS to thoroughly remove any detached floating cells and avoid interference from residual floating cells in the imaging results. After washing, the culture medium was replaced with fresh medium containing 2% serum, and the cell scratch area was immediately photographed at the 0 h time point. After photography, the culture plate was quickly returned to the cell culture incubator for incubation at a constant temperature. After 24 h of continuous culture, the same field of view was photographed again.

[0053] ImageJ image analysis software was used to measure the area of ​​the scratch-induced blank region at 0 h and 24 h, respectively. The migration rate was calculated quantitatively using the formula: Cell migration rate = 1 - (Area of ​​blank region at 24 h / Area of ​​blank region at 0 h). Independent samples t-tests were used to analyze the statistical differences between the experimental and control groups. GraphPadPrism 8 software was used to visualize and statistically analyze all experimental data, clarifying the regulatory mechanisms of different gene interventions on muscle satellite cell migration ability. The results of the cell scratch assay are shown below. Figure 16-19 As shown.

[0054] Depend on Figure 16 The results showed that MSTRG.5182.1, IKBKG, and chi-miR-424-5p all participate in regulating the migration process of muscle satellite cells in Shaanbei white cashmere goats. Knockdown of MSTRG.5182.1 and IKBKG significantly inhibited cell migration and reduced scratch healing efficiency; while inhibition of chi-miR-424-5p expression effectively promoted cell migration and accelerated the scratch healing process. These findings preliminarily confirm that the three molecules play positive and negative regulatory roles in cell migration, respectively, thus supporting the biological function of this ceRNA regulatory axis.

[0055] Depend on Figure 17 The results showed that, compared with the control group, the stable cell line with chi-miR-424-5p interference significantly improved the scratch healing rate and cell migration activity at 24 h. This result further validates the negative regulatory characteristics of chi-miR-424-5p; inhibiting its expression can relieve the inhibitory effect on muscle satellite cell migration and effectively promote cell migration, providing phenotypic evidence for the mechanism of action of the regulatory axis in mediating cell migration.

[0056] Depend on Figure 18 The results showed that after constructing stable MSTRG.5182.1-sh1 and IKBKG-sh1 cell systems and intervening, the scratch healing rate of cells was significantly reduced, and cell migration activity was significantly decreased after 24 h. These results clearly confirm that MSTRG.5182.1 and IKBKG are positive regulators of muscle satellite cell migration, and knocking down their expression significantly weakens cell migration ability, supporting the functional regulatory mechanism of this ceRNA axis.

[0057] Depend on Figure 19 The results showed that knocking down the expression of MSTRG.5182.1 and IKBKG significantly reduced the degree of scratch healing in muscle satellite cells and markedly inhibited cell migration rate. These quantitative results further validated the positive regulatory function of MSTRG.5182.1 and IKBKG in cell migration; the absence of these two functions directly blocks the migration behavior of muscle satellite cells.

[0058] The cell scratch assay results show that different gene intervention methods can induce significantly differentiated migration phenotypes in muscle satellite cells of Shaanbei white cashmere goats. The experimental results are stable and reproducible, with highly consistent phenotypic patterns across groups. The results indicate that interference with MSTRG.5182.1 and IKBKG significantly reduces the migration ability of muscle satellite cells, while interference with chi-miR-424-5p significantly enhances cell migration. These experimental conclusions clearly confirm that MSTRG.5182.1 and its downstream IKBKG play a positive regulatory role in muscle satellite cell migration, while chi-miR-424-5p has a significant inhibitory effect on cell migration. This invention comprehensively verifies the regulatory function of this ceRNA regulatory axis on muscle satellite cell migration behavior at the level of cell motility, providing systematic and reliable experimental support for elucidating the regulation of the in vitro biological functions of muscle satellite cells by this regulatory axis.

[0059] Comprehensive cell proliferation and migration function assays showed that the ceRNA regulatory mechanism disclosed in this invention can stably regulate the biological behavior of muscle satellite cells from Shaanbei white cashmere goats. Different gene intervention methods resulted in significant differential changes in cell proliferation and migration phenotypes. All experimental results were stable, reliable, consistent, and reproducible. Functional phenotype results confirmed that knocking down the expression of MSTRG.5182.1 and IKBKG significantly inhibited the proliferation and migration of muscle satellite cells from Shaanbei white cashmere goats; while inhibiting chi-miR-424-5p expression significantly promoted muscle cell proliferation and migration.

[0060] This invention, through a series of multi-dimensional experiments, systematically elucidated the targeting interactions, endogenous regulatory relationships, and cellular biological functions of MSTRG.5182.1, chi-miR-424-5p, and IKBKG, constructing a rigorous and closed-loop molecular mechanism verification system. Specifically, the dual-luciferase reporter gene assay clearly demonstrated a direct, site-specific targeting binding relationship between MSTRG.5182.1 and chi-miR-424-5p. chi-miR-424-5p significantly reduced the luciferase activity of wild-type MSTRG.5182.1, and this inhibitory effect completely disappeared after mutation of the binding site, effectively proving that MSTRG.5182.1 can specifically adsorb chi-miR-424-5p through molecular sponge action. qRT-PCR endogenous expression assays revealed a stable regulatory linkage between MSTRG.5182.1, chi-miR-424-5p, and IKBKG. Interference with the expression of any one molecule significantly altered the endogenous expression levels of the other two molecules, establishing a dynamic ceRNA regulatory pattern of balance in the muscle satellite cells of Shaanbei white cashmere goats. Cellular function validation further corroborated this, showing that MSTRG.5182.1 positively regulates muscle cell development through the chi-miR-424-5p-IKBKG regulatory axis. Interference with either MSTRG.5182.1 or IKBKG significantly inhibited muscle satellite cell proliferation and migration, while interference with chi-miR-424-5p significantly enhanced cell proliferation and migration activity.

[0061] In summary, this invention systematically elucidated the molecular interactions and biological functions of MSTRG.5182.1, chi-miR-424-5p, and IKBKG through dual-luciferase targeting verification, qRT-PCR endogenous expression detection, and cell function experiments. The series of experimental results were stable and reproducible, clearly demonstrating a dynamic balance of endogenous regulatory relationships among these molecules, and effectively regulating the proliferation and migration phenotype of muscle satellite cells in Shaanbei white cashmere goats. This invention is the first to comprehensively validate the breed-specific MSTRG.5182.1-chi-miR-424-5p-IKBKG ceRNA regulatory pathway in Shaanbei white cashmere goats, overcoming the limitations of fragmented and unsystematic research on related mechanisms in existing technologies. It elucidates a novel molecular mechanism by which lncRNA regulates the development of cashmere goat muscle cells, filling a research gap in related fields and providing reliable experimental evidence and theoretical support for research on the muscle development mechanism of Shaanbei white cashmere goats and the development of molecular targets.

[0062] This invention is not limited to the specific embodiments described above. Any modifications made by those skilled in the art based on the above concept without creative effort are within the scope of protection of this invention.

Claims

1. A lncRNA-mediated ceRNA regulatory axis, characterized in that, The ceRNA regulatory axis is the MSTRG.5182.1-chi-miR-424-5p-IKBKG regulatory axis, which is composed of the long non-coding MSTRG.5182.1, chi-miR-424-5p, and the IKBKG encoding gene. The nucleotide sequence of the long non-coding MSTRG.5182.1 is shown in SEQ ID NO.1, the nucleotide sequence of chi-miR-424-5p is shown in SEQ ID NO.2, and the nucleotide sequence of the IKBKG encoding gene is shown in SEQ ID NO.

3. MSTRG.5182.1 adsorbs chi-miR-424-5p through a base-pairing sponge. Chi-miR-424-5p specifically targets and negatively regulates the transcriptional expression of the IKBKG gene. The three form an endogenous competitive regulatory network in the muscle satellite cells of Shaanbei white cashmere goats.

2. The lncRNA-mediated ceRNA regulatory axis according to claim 1, characterized in that, In the muscle satellite cells of Shaanbei white cashmere goats, the endogenous competitive regulatory network exhibits the following expression regulation relationships: overexpression of chi-miR-424-5p downregulates IKBKG gene expression, and inhibition of chi-miR-424-5p upregulates IKBKG gene expression; inhibition of MSTRG.5182.1 expression downregulates IKBKG expression and upregulates chi-miR-424-5p expression; inhibition of IKBKG expression downregulates MSTRG.5182.1 expression and upregulates chi-miR-424-5p expression; inhibition of chi-miR-424-5p expression upregulates MSTRG.5182.1 expression.

3. The application of the lncRNA-mediated ceRNA regulatory axis as described in claim 1 in the in vitro proliferation regulation of muscle satellite cells of Shaanbei white cashmere goat.

4. The application according to claim 3, characterized in that, By utilizing the endogenous sponge adsorption of chi-miR-424-5p by MSTRG.5182.1 in the ceRNA regulatory axis, the inhibitory effect of chi-miR-424-5p on the expression of downstream IKBKG gene is relieved, thereby achieving positive regulation of muscle satellite cell proliferation and migration.

5. The application according to claim 3, characterized in that, Downregulation of MSTRG.5182.1 or IKBKG expression inhibited the proliferation and migration of muscle satellite cells from Shaanbei white cashmere goats; downregulation of chi-miR-424-5p expression promoted the proliferation and migration of muscle satellite cells from Shaanbei white cashmere goats.

Images