An RNA that reduces expression of EIF4A1

Abstract

The RNA capable of reducing EIF4A1 expression relates to the technical field of bioengineering, and particularly relates to a RNA capable of reducing EIF4A1 expression.The RNA capable of reducing EIF4A1 expression is mmu-miR-1258-3p.The method for reducing EIF4A1 expression is as follows: mmu-miR-1258-3p is used as diluted RNA in lipo3000 transfection reagent, a lipid nanoparticle is prepared, and then the cell is transfected, so that the expression of EIF4A1 can be reduced.mmu-miR-1258-3p targets the mRNA sequence of EIF4A1, and the expression of EIF4A1 is reduced.EIF4A1 is a translation process regulating element, the expression amount of EIF4A1 is reduced, the expression amount of downstream IL6 and IL1beta is reduced, and it is inferred that mmu-miR-1258-3p can be used for inhibiting inflammation.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, specifically to an RNA that can reduce EIF4A1 expression. Background Technology

[0002] EIF4A1 is a subunit of the eIF4F complex, involved in cap recognition, and essential for mRNA binding to ribosomes. In current translation initiation models, eIF4A unwinds the RNA secondary structure in the 5'-UTR of mRNA, which facilitates efficient binding of mRNA to small ribosomal subunits and subsequent scanning of the start codon. Previous reports have indicated that EIF4A1 can enhance the inflammatory response by increasing the expression of inflammatory factors such as IL6 (interleukin-6) and IL1β (interleukin-1β) during the translation process. Summary of the Invention

[0003] The objective of this invention is to reduce EIF4A1 expression by targeting EIF4A1, thereby reducing the expression levels of downstream IL6 and IL1β. To achieve this objective, this invention provides an RNA that can reduce EIF4A1 expression.

[0004] The present invention can reduce the expression of EIF4A1 RNA, wherein the RNA that can reduce the expression of EIF4A1 is mmu-miR-1258-3p, and the sequence of mmu-miR-1258-3p is 5'-TTAGGGAA-3'.

[0005] The present invention carries RNA liposomes that can reduce EIF4A1 expression, wherein the RNA is mmu-miR-1258-3p.

[0006] The present invention relates to a method for reducing EIF4A1 expression. This method uses mmu-miR-1258-3p as diluted RNA in the lipo3000 transfection reagent to form lipid nanoparticles, which are then transfected into cells to reduce EIF4A1 expression.

[0007] The mmu-miR-1258-3p sequence TTAGGGAA targets the EIF4A1 mRNA sequence, reducing EIF4A1 expression. Since EIF4A1 is a regulatory element in the translation process, reduced EIF4A1 expression decreases the expression of downstream IL6 and IL1β; therefore, it is hypothesized that mmu-miR-1258-3p can be used to inhibit inflammation.

[0008] Liposomes carrying mmu-miR-1258-3p significantly reduced the expression of downstream inflammatory genes IL6 and IL1β transcribed from EIF4A1, demonstrating that mmu-miR-1258-3p exerts anti-inflammatory effects by targeting EIF4A1. Furthermore, TNF-α-induced inflammation induces increased EIF4A1 protein expression and the transcription of inflammatory factors, thus aggravating inflammation; however, liposome-encapsulated mmu-miR-1258-3p reduces EIF4A1 expression, thereby alleviating inflammation.

[0009] Beneficial effects:

[0010] 1. The present invention mmu-miR-1258-3p significantly reduces the expression level of the fluorescent gene in plasmids carrying Eif4a1, and mmu-miR-1258-3p has targeting properties for Eif4a1.

[0011] 2. Lipids carrying mmu-miR-1258-3p significantly reduce the expression of downstream inflammatory genes IL6 and IL1β transcribed from Eif4a1, thus exerting an anti-inflammatory effect. Attached Figure Description

[0012] Figure 1 The pmirGLO vector map;

[0013] Figure 2 This is a diagram of gene insertion sites for the pmirGLO vector.

[0014] Figure 3 This is a graph showing the results of dual-luciferase reporter gene detection in Example 2;

[0015] Figure 4 This is a graph showing the results of real-time quantitative PCR detection in Example 3;

[0016] Figure 5 This is a graph showing the Western Blot detection results in Example 3. Detailed Implementation

[0017] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0018] Definitions and notes:

[0019] The pmirGLO carrier was purchased from Promega, Inc. (product number E1330).

[0020] Eif4a1 is eukaryotic translation initiation factor 4A1, an ATP-dependent RNA helicase primarily responsible for unwinding the complex secondary structure at the 5' end of mRNA during translation initiation, facilitating ribosome binding and initiating protein synthesis. Eif4a1 was purchased from Beijing E-Tech Co., Ltd.

[0021] The TOP10 Escherichia coli competent cells were purchased from Thermo Fisher Scientific.

[0022] 293T cells were purchased from Thermo Fisher Scientific.

[0023] The Lipofectamine 3000 transfection reagent was purchased from Thermo Fisher Scientific.

[0024] mimics / Negative.Control: miRNA mimics Negative Control (miRNA mimic negative control) was purchased from Thermo Fisher Scientific.

[0025] HaCaT cells were purchased from Cybio (Shanghai) Biotechnology Co., Ltd.

[0026] Rabbit anti-EIF4A1 polyclonal antibody, rabbit anti-IL6 polyclonal antibody, rabbit anti-IL1β polyclonal antibody, rabbit anti-GAPDH monoclonal antibody Wuhan Enji Life Science Technology Co., Ltd.

[0027] For any operations not described in the embodiments of this invention, please refer to the reagent or kit instructions or use existing conventional methods.

[0028] Example 1

[0029] This embodiment uses the pmirGLO vector (such as...) Figure 1 As shown, the pmirGLO vector gene insertion site is as follows: Figure 2 As shown in the figure, the 3'UTR sequence of Eif4a1 was inserted into the pmirGLO vector using two restriction enzyme sites, SacI and SbfI, to construct pmirGLO Eif4a1-WT and pmirGLO Eif4a1-MUT, respectively.

[0030] Among them, the 3'UTR sequence of Eif4a1 inserted into pmirGLO Eif4a1-WT is WT-3'UTR (such as SEQ IDNO.1 shown): 5'-gggttcagtcctggggtggggctaaggaagagctggaggggggaggggagggagccaagggatggacatcttgtttttgttttggctttttttttttttgtttcagttttttt ttctctatgaataaatgtcactttttgaggcaaaaagaaggaaccgtgaacattttagacacccttttctttggggtaggctctgccccaggcgccgtctccttccccccccaaacactaatgcat ttccctaa The 3' UTR sequence in pmirGLO Eif4a1-WT is wild-type (WT), and the underlined sequence is complementary to the 3p base of mmu-miR-1258-3'.

[0031] Construction of pmirGLO Eif4a1-MUT The 3'UTR sequence of the inserted Eif4a1 is MUT-3'UTR (as shown in SEQ IDNO.2): 5'- gggttcagtcctggggtggggctaaggaagagctggaggggggaggggagggagccaagggatggacatcttgtttttgttttggctttttttttttttgtttcagttttttttctcta tgaataaatgtcactttttgaggcaaaaagaaggaaccgtgaacattttagacacccttttctttggggtaggctctgccccaggcgccgtctccttccccccccaaacactaatgcat ggaaagccIn the cctagtcacctcgttcctaaaggctttcctaccccagccaaatctccaaaagtgagtcaaggggctaaaaaacaaggctggcctcatttgctggaccaaatctacagggagaacccctgagtgaggttgtccagggaattgtcccctggtgagg-3'. In pmirGLO Eif4a1-MUT, the 3' UTR sequence is a mutant (MUT), and the underlined sequence is the mutant fragment.

[0032] Specific construction steps for pmirGLO Eif4a1-WT and pmirGLO Eif4a1-MUT:

[0033] 1. The amplification primers for the pmirGLO Eif4a1-WT and pmirGLO Eif4a1-MUT inserted DNA fragments (WT-3'UTR and MUT-3'UTR) were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and diluted to 10 μM respectively; the upstream primer F sequence is 5'-ACTGACCTGCTGGGAAAACT-3' (as shown in SEQ ID NO.3), and the downstream primer R sequence is 5'-TCAGCAACATTGAGGGGCAT-3' (as shown in SEQ ID NO.4);

[0034] 2. PmirGLO was double-digested with SacI and SbfI. The digestion system is shown in Table 1.

[0035] Table 1

[0036] 20ul enzyme digestion system 37℃ for 1 hour 2ul pmirGLO vector (1000 ng / ul) 1ul SacI 1ul SbfI 2ul 10×buffer 14ul <![CDATA[H2O]]>

[0037] 3. Gel recovery after enzyme digestion;

[0038] 4. The DNA fragments in WT-3'UTR and MUT-3'UTR were artificially synthesized;

[0039] 5. The PCR systems for DNA fragments of WT-3'UTR and MUT-3'UTR are shown in Table 2, and the PCR reaction conditions are shown in Table 3.

[0040] Table 2

[0041] 20 ul PCR system 0.5ul DNA fragment template 10ul Pfu mix 0.5ul upstream primer 0.5ul Downstream primer 8.5ul <![CDATA[H2O]]>

[0042] Table 3

[0043] Pre-variation 98℃ for 1 min transsexual 94℃ 30 s annealing 65℃ 30 s extend 72℃ 30 s cycle 40 cycles

[0044] 6. Connection: The connection system is shown in Table 4. The connection fluid was incubated overnight at 16°C.

[0045] Table 4

[0046] 1ul PmirGLO vector digested with enzymes (approximately 50 ng / ul) 1ul Ligase buffer 1ul T4 DNA Ligase 4ul <![CDATA[H2O]]>

[0047] 7. Transformed competent cells (TOP10 E. coli competent cells); resistance: Amp; cultured overnight at 37°C;

[0048] 8. On the second day, pick a single colony and inoculate it into 5 ml of LB medium containing the antibiotic. Shake the culture at 37°C and 220 rpm / min for 16 hours. Perform plasmid mini-extraction and send the extracted plasmid to the company for sequencing.

[0049] 9. Select samples with correct sequencing results for plasmid extraction and endotoxin removal; obtain plasmids pmirGLOEif4a1-WT and pmirGLO Eif4a1-MUT respectively.

[0050] Example 2

[0051] Cell transfection and detection:

[0052] 1. Based on the required transfection grouping and replicate number, seed 293T cells into 24-well plates (approximately 6 × 10⁶ cells per well) one day before transfection. 4 (1 cell), and perform cell transfection experiments when the cell density reaches 50%-70%;

[0053] 2. Mix 50 μL of DMEM medium and 1 μL of 20 pmol / μL mimics / Negative.Control (NC), then add 0.4 μg of plasmid pmirGLO Eif4a1-WT or 0.4 μg of plasmid pmirGLO Eif4a1-MUT to prepare Eif4a1-WT+NC and Eif4a1-MUT+NC, respectively, and let stand at room temperature for 30 min.

[0054] 3. Mix 48 μL of DMEM medium with 2 μL of lipo3000 transfection reagent thoroughly, then add 0.4 μg of plasmid pmirGLO Eif4a1-WT or 0.4 μg of plasmid pmirGLO Eif4a1-MUT to prepare Eif4a1-WT+mmu-miR-1258-3p and Eif4a1-MUT+mmu-miR-1258-3p respectively, and let stand at room temperature for 30 min;

[0055] The RNA diluted in the lipo3000 transfection reagent is mmu-miR-1258-3p;

[0056] 4. Add the transfection mixtures prepared in steps 2 and 3 to the 24-well plates containing 293T cells, gently shake to mix, and incubate in an incubator.

[0057] 5. Replace with fresh culture medium 6 hours after transfection;

[0058] 6. Perform luciferase detection 24-48 hours after transfection.

[0059] The mmu-miR-1258-3p fragment was artificially synthesized.

[0060] Test results as follows Figure 3 As shown in the figure. The experimental results showed that after co-transfecting 293T cells with the reporter plasmids MMU-miR-1258-3p and PmirGLO-Eif4a1-WT / MUT, the relative expression value of the luciferase reporter gene in the Eif4a1-WT+MMU-miR-1258-3p group was significantly different from that in the Eif4a1-WT+NC group (P<0.05), indicating that MMU-miR-1258-3p can regulate Eif4a1-WT. In addition, there was no significant difference between the Eif4a1-MUT+MMU-miR-1258-3p group and the Eif4a1-MUT+NC group (P>0.05), indicating that MMU-miR-1258-3p exerts its regulatory effect by binding to the predicted site of Eif4a1-WT. Dual-luciferase assays showed that mmu-miR-1258-3p significantly reduced the expression level of the fluorescent gene carrying Eif4a1 in the plasmid, confirming that mmu-miR-1258-3p targets Eif4a1.

[0061] Example 3

[0062] Real-time quantitative PCR detection:

[0063] 1. HaCaT cells were plated one day before transfection (6-well plates, approximately 2 × 10⁶ cells per well). 5 (1,000 cells), and perform cell transfection experiments when the cell density reaches 50%–70%;

[0064] 2. Preparation of liposomes carrying mmu-miR-1258-3p (thin-film dispersion method):

[0065] Weigh out soybean lecithin and cholesterol and dissolve them in 5 mL of chloroform-methanol mixture (volume ratio 2:1) at a molar ratio of 3:1 to prepare a lipid organic solution with a total lipid concentration of 10 mg / mL.

[0066] The above-mentioned lipid organic solution was transferred to a round-bottom flask and placed on a rotary evaporator. It was then rotary evaporated at 37°C under reduced pressure for 30-45 minutes to remove the organic solvent, so that the lipid formed a uniform and transparent lipid film on the inner wall of the flask.

[0067] Place the round-bottom flask with the lipid film in a vacuum desiccator and dry overnight (more than 12 hours) to completely remove residual organic solvents;

[0068] Add 5 mL of RNase-free PBS buffer (pH 7.4) containing mmu-miR-1258-3p mimics (the sequence of mmu-miR-1258-3p mimics is 5'-TTAGGGAATTAGCTCAGCAGTA-3', as shown in SEQ ID NO.5) to a round-bottom flask, hydrate at 37°C for 30 min, gently shaking during the process to allow the lipid membrane to detach completely, so that mmu-miR-1258-3p is encapsulated in the aqueous phase of the liposomes, thus obtaining a liposome suspension;

[0069] The liposome suspension was transferred to a centrifuge tube and sonicated under ice-water bath conditions (power 200 W, working for 3 s, interval 3 s, cycle for a total of 5 min). Then it was extruded and filtered 11 times through a 0.22 μm polycarbonate membrane to obtain ordinary liposomes with uniform particle size carrying mmu-miR-1258-3p, which were stored at 4℃ for later use.

[0070] 3. Preparation of negative control liposomes: Prepare NC liposomes using the same method as in step 2;

[0071] 4. Add the liposomes prepared in steps 2 and 3 to the 6-well plates for culturing HaCaT cells (the final concentration of mmu-miR-1258-3p in each well is 50 nM), gently shake to mix, and incubate in an incubator; replace with fresh complete culture medium 6 h after transfection.

[0072] 5. 24 h after transfection, TNF-α (tumor necrosis factor α) was added to the corresponding groups at a final concentration of 10 ng / mL, and stimulation was continued for 6 h to establish a cell inflammation model;

[0073] The experimental groups are as follows:

[0074] Control group: Only NC liposomes were added, without TNF-α;

[0075] TNF-α group: TNF-α stimulation was added after the addition of NC liposomes;

[0076] mmu-miR-1258-3p group: TNF-α stimulation was added after the addition of liposomes carrying mmu-miR-1258-3p.

[0077] Mutation+miR-1258-3p group: Includes individuals carrying the mutated mmu-miR-1258-3p (mutated mmu-miR-1258-3p sequence is 5'- ggaaagcc-3' After adding TNF-α stimulation to the liposomes;

[0078] 6. After stimulation, discard the culture medium, gently wash the cells once with PBS buffer, add 1 mL of TRIzol reagent to each well, and repeatedly pipette to fully lyse the cells. Transfer the lysate to a 1.5 mL RNase-free centrifuge tube.

[0079] 7. Add 200 μL of chloroform to each tube, shake vigorously for 15 s, and let stand at room temperature for 3 min; centrifuge at 12000 rpm for 15 min at 4℃; carefully aspirate approximately 400 μL of the colorless aqueous phase from the top layer into a new RNase-free centrifuge tube;

[0080] 8. Add an equal volume of isopropanol, gently invert to mix, and let stand at room temperature for 10 min; centrifuge at 4℃ and 12000 rpm for 10 min, and discard the supernatant; add 1 mL of 75% ethanol (prepared with DEPC water) to wash the RNA precipitate, centrifuge at 4℃ and 7500 rpm for 5 min, discard the supernatant, and repeat the washing once.

[0081] 9. Allow the precipitate to air dry at room temperature for 3–5 minutes, add 20 μL of RNase-free water to dissolve the RNA, and incubate in a 55°C water bath for 10 minutes to aid dissolution;

[0082] 10. Reverse transcription to synthesize cDNA: Take an equal amount of total RNA (1 μg per sample), prepare a 20 μL reaction system according to the reverse transcription kit instructions, and the reaction program is 37℃ for 15 min → 85℃ for 5 s → 4℃. The obtained cDNA is diluted 5 times with RNase-free water and stored at −20℃ for later use.

[0083] 11. The qPCR reaction system (20 μL) is shown in Table 5, and the qPCR reaction conditions are shown in Table 6.

[0084] Table 5

[0085] 20 μL qPCR reaction system 2×SYBR Green qPCR Master Mix 10 μL Upstream primer (10 μM) 0.4 μL Downstream primer (10 μM) 0.4 μL cDNA template 2 μL RNase-free water 7.2 μL

[0086] Table 6

[0087] Pre-variation 95℃ 30 s transsexual 95℃ 10 s annealing 60℃ for 30 seconds (fluorescence collection) Cycle number 40

[0088] 12. The detection genes are IL6 and IL1β, and the internal reference gene is GAPDH; each sample has 3 replicates for each gene, and a template-free control (NTC) is also included; the upstream primer for IL6 amplification is 5'-TGCAATAACCACCCCCCGACC-3', and the downstream primer for IL6 amplification is 5'-GTGCCCATGCTACATTTGCC-3'; the upstream primer for IL1β amplification is 5'-AACCTCTTCGAGGCACAAGG-3', and the downstream primer for IL1β amplification is 5'-AGCCATCATTTCACTGGCGA-3'; the primer sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0089] 13. The relative expression levels of each gene were calculated using the 2⁻ΔΔCt method: ΔCt = Ct (target gene) − Ct(GAPDH), ΔΔCt = ΔCt (treatment group) − ΔCt (control group mean), and the relative expression level = 2⁻ΔΔCt. Statistical analysis was performed using GraphPad Prism software, and one-way ANOVA was used for comparisons among multiple groups.

[0090] Test results as follows Figure 4 As shown in the figure. The experimental results showed that, compared with the Control group, the mRNA expression levels of IL6 and IL1β in HaCaT cells of the TNF-α group were significantly increased (P<0.01); compared with the TNF-α group, the mRNA expression levels of IL6 and IL1β in the mmu-miR-1258-3p group were significantly decreased (P<0.05 or P<0.01), indicating that liposomes carrying mmu-miR-1258-3p can significantly inhibit the transcriptional expression of TNF-α-induced inflammatory factors IL6 and IL1β.

[0091] Western Blot analysis:

[0092] 1. HaCaT cells were seeded into 6-well plates (approximately 2 × 10⁶ cells per well) one day before transfection. 5 (1,000 cells), and perform cell transfection experiments when the cell density reaches 50%–70%;

[0093] 2. Add liposomes carrying mmu-miR-1258-3p and NC liposomes to 6-well plates for HaCaT cell culture (final concentration of mmu-miR-1258-3p per well is 50 nM), gently shake to mix, and incubate in an incubator; replace with fresh culture medium 6 h after transfection.

[0094] 3. 24 h after transfection, TNF-α (final concentration 10 ng / mL) was added to the corresponding groups for further stimulation for 12 h; the experimental groups are as follows:

[0095] Control group: Only NC liposomes were added, without TNF-α;

[0096] TNF-α group: TNF-α stimulation was added after the addition of NC liposomes;

[0097] mmu-miR-1258-3p group (miR for short): TNF-α stimulation was added after the addition of liposomes carrying mmu-miR-1258-3p.

[0098] 4. After stimulation, discard the culture medium and wash the cells twice with pre-cooled PBS; add 100–150 μL of RIPA lysis buffer (containing 1% PMSF and 1% phosphatase inhibitor) to each well and lyse on ice for 30 min, gently shaking once every 5 min during the process;

[0099] 5. Scrape the lysate with a cell scraper and transfer it to a 1.5 mL centrifuge tube. Centrifuge at 4°C and 12,000 rpm for 15 min. Take the supernatant and determine the protein concentration using a BCA protein quantification kit.

[0100] 6. Take an equal amount of protein (30 μg per lane), add 5×SDS-PAGE loading buffer, and boil at 100℃ for 5–10 min to denature the protein.

[0101] 7. Prepare a 10% SDS-PAGE separating gel and a 5% stacking gel. After loading the samples, perform electrophoresis: stacking gel stage at 80 V for about 30 min. After the bromophenol blue enters the separating gel, adjust the voltage to 120 V for about 60–90 min, until the bromophenol blue reaches the bottom of the gel.

[0102] 8. Transfer: The protein was transferred to a PVDF membrane (0.45 μm) using the wet transfer method. The transfer conditions were 300 mA for 90 min (EIF4A1 approximately 46 kDa, IL6 approximately 21 kDa, IL1β approximately 17 kDa, GAPDH approximately 36 kDa).

[0103] 9. After the transfer is complete, place the PVDF membrane in 5% skim milk (prepared with TBST) and seal at room temperature for 1–2 hours.

[0104] 10. Discard the blocking solution, add the diluted primary antibody, and incubate overnight at 4°C.

[0105] Rabbit anti-EIF4A1 polyclonal antibody (1:1000 dilution);

[0106] Rabbit anti-IL6 polyclonal antibody (1:1000 dilution);

[0107] Rabbit anti-IL1β polyclonal antibody (1:1000 dilution);

[0108] Rabbit anti-GAPDH monoclonal antibody (1:5000 dilution, internal control);

[0109] 11. The primary antibody was recovered the next day, and the membrane was washed 3 times with TBST for 10 min each time; the corresponding HRP-labeled goat anti-rabbit secondary antibody (1:5000 dilution) was added, and the membrane was incubated at room temperature for 1 h;

[0110] 12. Wash the membrane three times with TBST, 10 min each time; place the membrane in a chemiluminescence imager, add ECL chemiluminescence reagent, expose and acquire images;

[0111] 13. Use ImageJ software to perform quantitative analysis of the band gray values, using GAPDH as an internal reference, and calculate the relative expression level of each target protein (target protein gray value / GAPDH gray value); use GraphPad Prism software for statistical analysis.

[0112] Test results as follows Figure 5 As shown, the results indicated that compared with the Control group, the expression level of EIF4A1 protein in HaCaT cells of the TNF-α group was significantly increased, and the expression levels of IL6 and IL1β genes were also significantly increased. Compared with the TNF-α group, the expression level of EIF4A1 protein in the mmu-miR-1258-3p group was significantly decreased, and the expression levels of IL6 and IL1β genes were also decreased accordingly. This suggests that liposomes carrying mmu-miR-1258-3p exert anti-inflammatory effects by targeting and degrading EIF4A1 mRNA and reducing EIF4A1 protein expression, thereby inhibiting the translation and expression of downstream inflammatory factors IL6 and IL1β.

Claims

1. An RNA that can reduce EIF4A1 expression, characterized in that, The RNA that reduces EIF4A1 expression is mmu-miR-1258-3p, and the sequence of mmu-miR-1258-3p is 5'-TTAGGGAA-3'.

2. A liposome carrying the RNA of claim 1, characterized in that, The RNA is mmu-miR-1258-3p.

3. A method for reducing EIF4A1 expression, characterized in that, This method uses mmu-miR-1258-3p as diluted RNA in the lipo3000 transfection reagent to form lipid nanoparticles, which are then transfected into cells to reduce the expression of EIF4A1.

Images