Nucleic acid aptamer, screening method and system of polymyxin-producing strain
Patent Information
- Application Number
- CN202611013095.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-08
- Publication Date
- 2026-09-25
AI Technical Summary
[0005]本发明的目的是克服现有技术存在的现有多杀菌素生产菌株的筛选方法通量低、劳动强度大、成本高,也无法通过单细胞分选技术进行筛选,也无法通过胞内生物传感器进行检测的问题,提供一种核酸适配体、多杀菌素生产菌株的筛选方法与系统
1.提供了核酸适配体用于多杀菌素检测:针对多杀菌素这一疏水性大分子,采用特异性核酸适配体作为识别元件,克服了传统抗体难以制备、生物传感器难以设计的技术障碍,并提供了核酸适配体中与多杀菌素结合的关键的结合域。
Smart Images

Figure CN122811190A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial technology, specifically to a method and system for screening nucleic acid aptamers and spinosad-producing strains. Background Technology
[0002] Spinosad is a macrolide secondary metabolite produced by aerobic fermentation of Saccharopolyspora spinosa. It is characterized by high efficiency, broad spectrum, low toxicity, and environmental friendliness, and is one of the most widely used biological pesticides in the world.
[0003] Traditional screening of spinosad-producing strains involves mutagenesis, shake-flask fermentation, and then high-performance liquid chromatography (HPLC) detection of spinosad in the fermentation product. This process typically only yields a few hundred clones per week, resulting in low throughput, high labor intensity, and high costs. While single-cell sorting based on flow cytometry has proven effective in screening other strains, it is not suitable for *Spinosarcina*. *Spinosarcina* is a Gram-positive bacterium with filamentous hyphae that readily form hyphal clumps in liquid culture, making them undetectable by flow cytometry. Furthermore, spinosad has a large molecular weight and is highly hydrophobic, making it difficult to detect using intracellular biosensors.
[0004] In summary, existing screening methods for spinosad-producing strains are characterized by low throughput, high labor intensity, and high cost. They also cannot be screened using single-cell sorting technology or detected using intracellular biosensors. Summary of the Invention
[0005] The purpose of this invention is to overcome the problems of existing methods for screening spinosad-producing strains, such as low throughput, high labor intensity, and high cost. These methods also cannot be used for screening via single-cell sorting or detection via intracellular biosensors. This invention provides a method and system for screening nucleic acid aptamers and spinosad-producing strains. It provides nucleic acid aptamers that specifically bind to spinosad, effectively enabling the detection of spinosad. Furthermore, the structural design of the microreaction module solves the screening problem of filamentous bacteria, achieving a screening throughput of up to 10... 6 -10 7 Cloning rate per day, low cost, and broad application prospects.
[0006] To achieve the above objectives, a first aspect of the present invention provides a nucleic acid aptamer including a binding domain having a nucleotide sequence shown in SEQ ID NO:1.
[0007] Preferably, the nucleic acid aptamer is at least one of the following (1)-(4): (1) The nucleotide sequence shown in SEQ ID NO:2; (2) The nucleotide sequence shown in SEQ ID NO:3; (3) The nucleotide sequence shown in SEQ ID NO:4; (4) A nucleotide sequence that has at least 80% homology with any of the nucleotide sequences described in (1)-(3).
[0008] The second aspect of the present invention provides the use of the nucleic acid aptamer described in the first aspect for preparing products for detecting spinosad or screening spinosad-producing strains.
[0009] A third aspect of the present invention provides a microreaction module, comprising: The first unit contains a test strain, and the first reaction is used to cultivate the test strain to produce spinosad. The second unit comprises the nucleic acid aptamer described in the first aspect, wherein the second unit is used to encapsulate the first unit; When the test strain produces spinosad, the spinosad can diffuse from the first unit to the second unit.
[0010] The fourth aspect of the present invention provides a method for preparing the microreaction module described in the third aspect, the method comprising: preparing droplets in a microfluidic device and performing solidification treatment to obtain the microreaction module.
[0011] The fifth aspect of the present invention provides a method for screening spinosad-producing strains, the method comprising: using the nucleic acid aptamer described in the first aspect or the microreaction module described in the third aspect to detect the spinosad level produced by the test strain, and screening the test strain based on the detection result of the spinosad level.
[0012] The sixth aspect of this invention provides a screening system for spinosad-producing strains, comprising: The detection module is used to detect spinosad produced by the test strain; The sorting module is used to sort the strains to be tested based on the results of the detection module; The detection module includes the nucleic acid aptamer described in the first aspect or the microreaction module described in the third aspect.
[0013] Through the above technical solution, the present invention has at least the following beneficial effects: 1. Nucleic acid aptamers are provided for spinosad detection: For spinosad, a hydrophobic macromolecule, specific nucleic acid aptamers are used as recognition elements, overcoming the technical obstacles of traditional antibody preparation and biosensor design difficulties, and providing the key binding domain in the nucleic acid aptamer that binds to spinosad.
[0014] 2. Solving the problem of filamentous bacteria screening: By utilizing the physical separation and function-related structural design of the micro-reaction module, the growth of filamentous bacteria is restricted to the first unit, avoiding the influence of the hyphae generated by the growth on the detection. At the same time, the spinosad product accumulates in the micro-reaction module and diffuses to the second unit, reaching the detectable threshold.
[0015] 3. Ultra-high throughput and low cost: The screening throughput of this invention can reach 10 6 -10 7 The cloning rate per day is tens of thousands of times higher than that of traditional HPLC screening methods, and the cost per droplet is extremely low, making it a promising application. Attached Figure Description
[0016] Figure 1 A schematic diagram of a microfluidic dual emulsion chip; Figure 2 An observation diagram of droplets from the two emulsions; Figure 3 This is a graph showing the yield data after strain screening. Detailed Implementation
[0017] The technical solution of the present invention will be further described in detail below. It should be noted that the specific embodiments are only a detailed description of the present invention and should not be regarded as a limitation of the present invention.
[0018] Based on screening a large number of nucleic acid aptamers, this invention summarizes the conserved sequence and structural rules of nucleic acid aptamers that can bind with high affinity to spinosad. Specifically, spinosad, as a hydrophobic macrolide molecule, requires its aptamers to form a hydrophobic binding pocket through a specific stem-loop structure. The nucleic acid aptamer protected by this invention contains a conserved binding domain (GTAGTTCCTGGC, SEQ ID NO:1).
[0019] The experiments of this invention show that if the nucleotide sequence of the binding domain is partially or entirely replaced, the affinity of the resulting nucleic acid aptamer for spinosad is significantly reduced, for example, the dissociation constant is increased to more than 5 μM, suggesting that the binding domain is necessary for the nucleic acid aptamer to bind spinosad.
[0020] A first aspect of the present invention provides a nucleic acid aptamer including a binding domain having a nucleotide sequence shown in SEQ ID NO:1.
[0021] In this invention, the binding domain is used to form a binding pocket. Therefore, any nucleotide sequence can be placed in the region outside the binding domain without affecting the binding pocket, and since the binding pocket is not affected, the binding of the nucleic acid aptamer to spinosad is also not affected.
[0022] The present invention has found that if a nucleotide sequence containing the binding domain is selected, such as SEQ ID NO:2, and base substitutions, additions or deletions are made in the non-conserved stem region sequences on both sides of the binding domain, as long as at least 80% homology with the pre-mutation sequence is still satisfied, the high affinity for spinosad (dissociation constant Kd < 100 nM) can still be maintained.
[0023] In some embodiments, the nucleic acid aptamer is at least one of the following (1)-(4): (1) The nucleotide sequence shown in SEQ ID NO:2; (2) The nucleotide sequence shown in SEQ ID NO:3; (3) The nucleotide sequence shown in SEQ ID NO:4; (4) A nucleotide sequence that has at least 80% homology with any of the nucleotide sequences described in (1)-(3).
[0024] In this invention, the nucleotide sequence represented by SEQ ID NO:2 refers to (5'-3'): TGCGGTACGGTCATATGCGTAGTTCCTGGCGAGCGGTTGAATCGATCCCCC.
[0025] In this invention, the nucleotide sequence represented by SEQ ID NO:3 refers to (5'-3'): AGCGCAACGGTCATATGCGTAGTTCCTGGCGAGCGGTTGAATCGATGCGCT.
[0026] In this invention, the nucleotide sequence represented by SEQ ID NO:4 refers to (5'-3'): TACGGTCATATGCGTAGTTCCTGGCGAGCGGTTGAATCG.
[0027] Homology between sequences can be determined using methods commonly used in the art. For example, the Bestfit method in a DNA sequence analysis software package can be used to compare two sequences and obtain a homology value. (4) The homology between the nucleotide sequence and any of the nucleotide sequences in (1)-(3) can be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or any range of any two of the above numbers.
[0028] In some embodiments, the nucleic acid aptamer further includes a reporter group for generating a signal when the nucleic acid aptamer binds to spinosad.
[0029] The nucleic acid aptamers of this invention can be used for a series of applications based on their specific binding to spinosad. For example, they can be used to detect spinosad. In this case, a reporter group can be introduced onto the nucleic acid aptamer, and the signal generated by the reporter group can be used to reflect the binding of the nucleic acid aptamer to spinosad, i.e., qualitative detection of spinosad. When multiple nucleic acid aptamers are used to bind to spinosad, each binding will generate a signal, and therefore the signal is positively correlated with the spinosad concentration, thereby achieving quantitative detection of spinosad.
[0030] Preferably, the reporter group includes a fluorescent group and a quenching group.
[0031] In this invention, the fluorescent group and the quenching group are used in pairs. When not bound to spinosad, the fluorescent group and the quenching group are in contact, and no fluorescent signal is generated. After the nucleic acid aptamer binds to spinosad, due to the conformational change of the nucleic acid aptamer, the fluorescent group and the quenching group separate, and the fluorescent group generates a fluorescent signal. Fluorescent groups and quenching groups in the art can be used. For example, a fluorescent group can be attached to the 5' end, and the fluorescent group can be a 6-carboxyfluorescein (FAM) group. Alternatively, a quenching group can be attached to the 3' end, and the quenching group can be a black hole quencher (BHQ1) group.
[0032] The second aspect of the present invention provides the use of the nucleic acid aptamer described in the first aspect for preparing products for detecting spinosad or screening spinosad-producing strains.
[0033] A third aspect of the present invention provides a microreaction module, comprising: The first unit contains a test strain, and the first reaction is used to cultivate the test strain to produce spinosad. The second unit comprises the nucleic acid aptamer described in the first aspect, wherein the second unit is used to encapsulate the first unit; When the test strain produces spinosad, the spinosad can diffuse from the first unit to the second unit.
[0034] In this invention, by embedding the test strain into a corresponding first unit, and allowing the diffusion of spinosad between the first and second units, the spinosad produced by the test strain in the first unit can diffuse to the second unit and be recognized by the nucleic acid aptamer in the second unit to generate a signal. By measuring the signal intensity, it can be determined whether the test strain has the ability to produce spinosad, or the strength of the spinosad production ability of the test strain.
[0035] To enable high-throughput sorting using microfluidic technology, the connection between the first and second units can be designed as a core-shell structure, with the second unit containing the recombinant cells serving as the outer shell for easier detection. In some implementations, the first unit is the core, and the second unit is the outer shell, forming a core-shell structure.
[0036] In some embodiments, the concentration of the nucleic acid aptamer in the second unit is 0.5-20 μM, preferably 2-8 μM. At the preferred nucleic acid aptamer concentration, both detection sensitivity and background noise control can be balanced, improving the accuracy of spinosad detection.
[0037] In some embodiments, the content of the test strain in the first unit is 10. 4 -10 8 Cells / mL, preferably 10 5 -10 7 per mL.
[0038] In some embodiments, the volume ratio of the first unit to the second unit is 1:(1-10), preferably 1:(2-5).
[0039] In this invention, the volume ratio of the first unit and the second unit can be adjusted by adjusting the preparation method. For example, when preparing a microreaction module using a microfluidic method, the volume ratio of the first unit and the second unit can be changed by changing the ratio of the inner phase solution and the intermediate phase solution (e.g., the flow rate ratio).
[0040] In some methods, the test strain includes Polysporum spinosum (Saccharomyces cerevisiae). Saccharopolyspora spinosa ).
[0041] Preferably, the *Saccharopolysporium* comprises wild-type *Saccharopolysporium* and / or *Saccharopolysporium* mutants.
[0042] More preferably, the *Saccharomyces cerevisiae* mutant includes *Saccharomyces cerevisiae* obtained by at least one of the following methods: ultraviolet irradiation, atmospheric pressure and room temperature plasma mutagenesis, chemical mutagenesis, or genetic engineering modification.
[0043] For example, *Saccharomyces cerevisiae* can be cultured until mature spores are formed, and a spore suspension can be prepared. Then, the spore suspension can be subjected to mutagenesis treatment. An ambient pressure room temperature plasma (ARTP) mutagenesis system can be used to treat the spore suspension. The parameters can be: discharge power: 100-130 W; working gas flow rate: 8-12 SLM (standard liters per minute); treatment time: 40-60 s.
[0044] In some embodiments, the first unit includes a bacterial culture medium and an optional thickener, the bacterial culture medium being used to culture the test bacterial strain. In this invention, the bacterial culture medium can be any culture medium in the art that can be used to culture the test bacterial strain.
[0045] Using thickeners can increase the viscosity of the system within the first unit, preventing spore sedimentation and thus increasing the probability of single-cell encapsulation.
[0046] Preferably, the thickener is selected from at least one of methylcellulose, carboxymethylcellulose, cellulose nanocrystals, and polyvinyl alcohol.
[0047] Preferably, in the first unit, the content of the thickener is 1-3 wt%.
[0048] In some embodiments, the second unit further includes a gelling agent. In this invention, the gelling material can be gelled under suitable conditions to prepare a gelling agent, enabling the nucleic acid aptamers of the second unit to be embedded and immobilized.
[0049] Preferably, the gelling agent is obtained by crosslinking a photocrosslinking agent and a photoinitiator; more preferably, the photocrosslinking agent includes at least one of methacrylated gelatin, methacrylated hyaluronic acid, polyethylene glycol diacrylate, methacrylated collagen, methacrylated sodium alginate, and methacrylated chitosan; even more preferably, the photoinitiator includes at least one of 2-hydroxy-2-methyl-1-phenyl-1-propanone, 2-hydroxy-4′-(2-hydroxyethoxy)-2-methylphenylacetone, lithium phenyl(2,4,6-trimethylbenzoyl)phosphate, diphenyl(2,4,6-trimethylbenzoyl)phosphine oxide, eosin Y, and riboflavin.
[0050] More preferably, the amount of the photocrosslinking agent is 2-10 wt% and the amount of the photoinitiator is 0.5-1 wt% compared to the total mass of the second unit.
[0051] Under the preferred concentrations of photocrosslinking agent and photoinitiator of this invention, the second unit can rapidly crosslink under light (e.g., under ultraviolet light) to form a stable gel shell layer.
[0052] The fourth aspect of the present invention provides a method for preparing the microreaction module described in the third aspect, the method comprising: preparing droplets in a microfluidic device and performing solidification treatment to obtain the microreaction module.
[0053] Preferably, the microfluidic device includes: An external phase channel is used to transport an external phase solution, which is used to stabilize the droplets; Intermediate phase channel, used to transport intermediate phase solution to form the second unit; An internal phase channel is used to transport the internal phase solution to form the first unit.
[0054] Preferably, the outer phase channel, the intermediate phase channel, and the inner phase channel form a coaxial nested structure of glass capillaries or a PDMS flow focusing structure.
[0055] In this invention, the coaxial nested glass capillary structure and the PDMS flow focusing structure can be designed with reference to methods known in the art, as long as they can form stable dual emulsion droplets through three-phase fluid shearing. For example, the coaxial nested glass capillary structure can be: the outer phase channel, the intermediate phase channel, and the inner phase channel are all capillaries, one end of the inner phase channel is nested inside one end of the intermediate phase channel, and the end of the intermediate phase channel away from the inner phase channel is nested in the outer phase channel.
[0056] The types of strains to be tested and their mutants can be found in the third aspect above.
[0057] Once the preparation is complete, the internal phase solution corresponds to the first unit of the microreaction module described in the third aspect. The internal phase solution can refer to the first unit and the second unit in the third aspect above.
[0058] In some embodiments, the intermediate phase solution comprises a photocrosslinker and a photoinitiator; preferably, in some embodiments, the intermediate phase solution comprises a photocrosslinker and a photoinitiator; preferably, the photocrosslinker comprises at least one of methacrylated gelatin, methacrylated hyaluronic acid, polyethylene glycol diacrylate, methacrylated collagen, methacrylated sodium alginate, and methacrylated chitosan; preferably, the photoinitiator comprises at least one of 2-hydroxy-2-methyl-1-phenyl-1-propanone, 2-hydroxy-4′-(2-hydroxyethoxy)-2-methylphenylacetone, lithium phenyl(2,4,6-trimethylbenzoyl)phosphate, diphenyl(2,4,6-trimethylbenzoyl)phosphine oxide, eosin Y, and riboflavin; Preferably, in the mesophase solution, the content of the photocrosslinking agent is 2-10 wt%, and the content of the photoinitiator is 0.5-1 wt%.
[0059] Under the preferred concentrations of photocrosslinker and photoinitiator of this invention, the photocrosslinker and photoinitiator can rapidly crosslink during the curing process to form a stable gel shell layer.
[0060] Preferably, the external phase solution comprises a surfactant and a fluorinated oil.
[0061] The role of the outer phase solution is to stabilize the droplets. That is, in the outer phase solution, the inner phase solution and the intermediate phase solution aggregate and form droplets, which are further stabilized by the action of the outer phase solution.
[0062] More preferably, the fluorinated oil includes at least one of HFE-7500, FC-40 and FC-43.
[0063] More preferably, the surfactant includes Pico-Surf and / or EA surfactant.
[0064] In this invention, the EA surfactant can be an anionic surfactant with a fatty alcohol polyoxyethylene ether or a similar structure. For example, commonly used EA surfactants in the art include PFPE-PEG (perfluoropolyether-polyethylene glycol) block copolymers.
[0065] More preferably, the content of the surfactant in the external phase solution is 2-5 wt%.
[0066] Under optimal conditions of fluorinated oil, surfactant type and concentration, the effect of the external phase solution in stabilizing droplets is further enhanced, making the droplets less prone to fusion or breakage during long-term incubation.
[0067] In this invention, the internal phase solution, the intermediate phase solution, and the external phase solution are continuously injected, and their flow rate ratio corresponds to their volume ratio. For example, the volume ratio of the internal phase solution, the intermediate phase solution, and the external phase solution can be (1-4):(4-10):(20-80).
[0068] Preferably, the flow rate of the inner phase solution is 0.05-0.2 mL / h, the flow rate of the intermediate phase solution is 0.2-0.5 mL / h, and the flow rate of the outer phase solution is 1-4 mL / h.
[0069] The specific flow rate is related to the final structure of the microreactor module. The flow rates of the inner phase, intermediate phase and outer phase can be set as above to prepare a stable core-shell structure microreactor module (which can also be called a microsphere). The resulting droplets have uniform particle size, which can realize single-strain scale encapsulation.
[0070] Preferably, the curing includes photocrosslinking curing. Suitable photocrosslinking curing conditions can be selected based on the specific gelling agent; for example, irradiation under 365 nm or 405 nm ultraviolet light for 30-60 seconds.
[0071] Preferably, the inner diameter of the outer phase channel is 300-800 μm, the inner diameter of the intermediate phase channel is 150-250 μm, and the inner diameter of the inner phase channel is 40-80 μm.
[0072] Preferably, the tip of the inner phase channel is hydrophobically treated, and the inner walls of the intermediate phase channel and the outer phase channel are hydrophilic or hydrophobic.
[0073] By treating the tip of the inner phase channel, the middle phase channel, and the inner wall of the outer phase channel, the emulsion type can be controlled to improve droplet stability.
[0074] The fifth aspect of the present invention provides a method for screening spinosad-producing strains, which uses the nucleic acid aptamer described in the first aspect or the microreaction module described in the third aspect to detect the spinosad level produced by the test strain, and screens the test strains based on the detection results.
[0075] The spinosad production capacity of each test strain can be reflected by the level of spinosad produced over a period of time. For example, a marker-labeled nucleic acid aptamer can bind to spinosad, and the total amount or concentration of spinosad can be determined by reading or identifying the marker.
[0076] In some methods, the microreaction module described in the third aspect is cultured under conditions suitable for spinosad synthesis, the spinosad level produced by the test strain is detected using microfluidic technology, and the strains are sorted according to the detection results to obtain spinosad-producing strains.
[0077] In this invention, the first unit of the micro-reaction module contains the test strain, and the micro-reaction module as a whole can be cultured, which is essentially also culturing the test strain. During the culture process, the test strain produces spinosad.
[0078] In this invention, the culture conditions can be set with reference to the actual production conditions of spinosad to reflect the possible performance of the test strain in actual production. For example, the culture conditions may include: temperature of 28-30℃, time of 5-10 days, and humidity ≥80%.
[0079] In this invention, a core-shell structured microreaction module can be used to perform high-throughput sorting using microfluidic technology. For example, the core-shell structured microreaction module (microspheres) is individually read for signals, and based on the difference in signal intensity, high-signal microspheres are separated from low-signal microspheres through physical deflection, flow channel switching, or electric field application. The test strain embedded in the core of the high-signal microspheres can then be isolated, thus obtaining the spinosad-producing strain.
[0080] Preferably, the sorting includes fluorescently activated droplet sorting.
[0081] More preferably, the sorting method includes detecting the intensity of the fluorescence signal output by the micro-reaction module by laser excitation, and sorting out the spinosad-producing strains when the detected fluorescence signal intensity is higher than a preset threshold.
[0082] It is understandable that when sorting based on signal intensity, a threshold can be set to classify microspheres with signal intensity greater than the threshold as high-signal microspheres. For example, when screening mutants of *Saccharomyces cerevisiae* that have undergone mutagenesis, the threshold can be the signal intensity corresponding to the starting strain (*Saccharomyces cerevisiae* that has not undergone mutagenesis). Another example is that the signal intensity of blank microspheres (without the strain to be tested) plus several times the standard deviation can be used as a threshold to exclude microspheres without the encapsulated strain.
[0083] It is understandable that sorting can be performed once or multiple times. Different thresholds can be set for each sorting process. For example, if the signal intensity of each microsphere has been measured in the first sorting, in the second or subsequent sorting, the signal intensity of the top x% of the remaining microspheres can be set as the threshold to sort out the microspheres with the highest signal intensity. The value of x can be set as needed, such as 1, 2, 3, 4 or 5.
[0084] The sorting method can be based on the difference in signal strength, and high-signal microspheres can be separated from low-signal microspheres by physical deflection, flow channel switching or electric field action. For example, target microspheres can be separated by dielectric force or piezoelectric drive.
[0085] The sixth aspect of this invention provides a screening system for spinosad-producing strains, comprising: The detection module is used to detect spinosad produced by the test strain; The sorting module is used to sort the strains to be tested based on the results of the detection module; The detection module includes the nucleic acid aptamer described in the first aspect or the microreaction module described in the fourth aspect.
[0086] In this invention, the detection module can be any component capable of detection. For example, in electrochemical detection, the detection module can be an electrode with a nucleic acid aptamer fixed on it. The binding of the nucleic acid aptamer to spinosad can be reflected in the change of current, and the detection of spinosad can be achieved by measuring the current. As another example, in fluorescence detection, the detection module can be a nucleic acid aptamer coupled with a fluorescent group.
[0087] In this invention, the sorting module can be any component capable of sorting the test strains. For example, when sorting microspheres containing the test strains, the sorting module can be a microfluidic chip, and the sorting module can be equipped with a sorting device that provides dielectric force or piezoelectric drive; or, for example, sorting can be performed in a multi-well plate.
[0088] The present invention will be described in detail below through embodiments. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the reagents, methods and equipment used are conventional reagents, methods and equipment in this technical field.
[0089] In the following examples, *Saccharomyces cerevisiae* (the starting strain) was purchased from the Agricultural Research Culture Collection (NRRL) of the United States, with the serial number NRRL 18395.
[0090] Example 1: Nucleic Acid Aptamers Based on screening a large number of nucleic acid aptamers, this invention summarizes that nucleic acid aptamers capable of binding with high affinity to spinosad possess conserved sequence and structural patterns. Specifically, spinosad, as a hydrophobic macrolide molecule, requires its aptamer to form a hydrophobic binding pocket through a specific stem-loop structure. This invention discovers that the binding pocket can be a conserved binding domain with the nucleotide sequence GTAGTTCCTGGC (SEQ ID NO:1). The complete nucleotide of the nucleic acid aptamer can be as shown in SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4. Base substitutions, additions, or deletions can be made outside this binding domain. As long as the mutated sequence resulting from base substitution, addition, or deletion has at least 80% homology with the sequence shown in SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4, it can maintain high affinity for spinosad.
[0091] A gene synthesis company was commissioned to synthesize nucleic acid aptamers with the following nucleotide sequences: Aptamer a (SEQ ID NO:2, 5'-3'): TGCGGTACGGTCATATGCGTAGTTCCTGGCGAGCGGTTGAATCGATCCCCC.
[0092] Aptamer b (SEQ ID NO:3, 5'-3'): AGCGCAACGGTCATATGCGTAGTTCCTGGCGAGCGGTTGAATCGATGCGCT.
[0093] Aptamer c (SEQ ID NO:4, 5'-3'): TACGGTCATATGCGTAGTTCCTGGCGAGCGGTTGAATCG.
[0094] Aptamer d (SEQ ID NO:5, 5'-3'): TGCGGTACGGTCATATGCCATCAACCTGGCGAGCGGTTGAATCGATCCCCC.
[0095] FAM fluorescent groups were sequentially labeled at the 5' end of aptamers a, b, c, and d, and BHQ1 quenching groups were labeled at the 3' end to obtain aptamer fluorescent probes A, B, C, and D.
[0096] The dissociation constants (Kd) and detection linear ranges of the above aptamer fluorescent probes A, B, C, and D with spinosad A were determined, and the results are shown in Table 1.
[0097] Table 1
[0098] It can be seen that the dissociation constants (Kd) of A, B and C with spinosad are all below 100 nM, which means that they have good affinity with spinosad A and have a wide detection linear range. Their characteristic is that they contain the "GTA GTT CCT GGC" binding domain in the middle.
[0099] The dissociation constant of D with spinosad is higher than 5 μM, which means that it has a low affinity for spinosad A. The binding domain in the middle is "CAT CAA CCT GGC", and the rest of the sequence is the same as that of aptamer A. That is, the "GTA GTT" binding domain in the A sequence is mutated to "CAT CAA". However, this mutation leads to a change in the three-dimensional structure, which makes it impossible to form an effective hydrophobic binding pocket, and thus it is almost impossible to detect.
[0100] The difference between A and B lies in the alteration of some terminal auxiliary folding sequences. They share approximately 88% homology and both exhibit good affinity for spinosad A. The difference between A and C is that C is based on A with unnecessary segments removed. They share approximately 82% homology and both exhibit good affinity for spinosad A.
[0101] Example 2: Microreaction Module The test strain was prepared as follows: Wild-type strain of *Polysporium spp.* (starting strain) was inoculated onto agar plates (20g soluble starch, 5g glucose, 5g peptone, 5g yeast extract, 4g CaCO3, 20g agar, adjusted to 1L, pH 7.2) and incubated at 30℃ for 7-10 days until spores matured. Spores were collected and a spore suspension (approximately 1×10⁻⁶) was prepared. 8 (Spores / mL). The spore suspension was mutagenized using the ARTP mutagenesis system: power 120W, gas flow rate 10 SLM, treatment time 50s (lethality approximately 90%). After mutagenesis, the spores were spread on agar plates for regeneration. The regenerated colonies were collected, and a mixed spore suspension was prepared, which became the initial mutant library, in which any one strain could be used as the test strain.
[0102] The aptamer fluorescent probe is the same as in Example 1, except that aptamer fluorescent probe A is selected.
[0103] The fabrication of the microfluidic dual emulsion chip is as follows: Glass capillaries were drawn to the required dimensions using a microelectrode drawing instrument. The inner phase capillary (inner phase channel) had an inner diameter of 50 μm, the mesophase capillary (mesophase channel) had an inner diameter of 180 μm, and the outer phase capillary (outer phase channel) had an inner diameter of 400 μm. The tips of the inner phase capillary were hydrophobically treated using OTS. The capillaries were assembled in a coaxial nesting manner, fixed on a glass slide, and each injection port was sealed with AB glue. Figure 1 As shown.
[0104] The microreaction module was fabricated using a microfluidic method, as follows: Preparation of internal phase solution: Prepare a suspension of spores from the *Saccharomyces cerevisiae* mutant library (OD200). 600 =0.8 (resuspended in strain culture) and strain culture containing 3 wt% methylcellulose were mixed at a volume ratio of 1:100, resulting in a final concentration of approximately 2.97 wt% methylcellulose and a spore density of approximately 1 × 10⁻⁶. 6 The strain culture medium is a fermentation culture medium that can support spinosad synthesis, including 45 g glucose, 30 g cottonseed powder, 5 g CaCO3, 15 mL soybean oil, and water to a final volume of 1 L, pH 7.0.
[0105] Intermediate phase solution preparation: an aqueous solution containing 10 wt% methacrylic anhydride gelatin (GelMA), 0.5 wt% phenyl (2,4,6-trimethylbenzoyl) lithium phosphate (LAP photoinitiator), and 5 μM aptamer fluorescent probe.
[0106] External phase solution preparation: HFE-7500 fluorinated oil containing 2.5 wt% Pico-Surf surfactant.
[0107] The three-phase solutions were separately drawn into glass syringes and attached to a precision syringe pump. These were then connected to the corresponding inlets on the chip via polyethylene tubing. Flow rates were set as follows: inner phase solution 0.1 mL / h, intermediate phase solution 0.3 mL / h, and outer phase solution 2.5 mL / h. At the chip outlet, monodisperse dual-emulsion droplets were stably generated. The probability of the inner phase of the droplet encapsulating a single *Polysporium spp.* spore followed a Poisson distribution; by adjusting the spore concentration, the empty load rate was controlled to below 20%.
[0108] The collected droplets were placed on an ice bath and irradiated with a 365 nm UV lamp (5W) for 45 s to induce cross-linking of GelMA. The results were then observed under a microscope. Figure 2As shown, a core-shell structure (microspheres) was formed. The microspheres were transferred to a petri dish containing the outer phase solution and incubated statically for 7 days at 30°C and 80% humidity. Mycelial growth and fluorescence signal changes were observed daily under an inverted fluorescence microscope. The results showed that on day 3 of culture, spores germinated in the core, forming mycelial spheres; from day 5 to 7, the shell began to show obvious green fluorescence, and the fluorescence intensity gradually increased with culture time. This indicates that spinosad synthesized by *Saccharomyces cerevisiae* has effectively diffused into the shell and been captured by the aptamers.
[0109] Example 3: Strain Screening Microspheres from Example 2, cultured for 7 days, were re-injected into a microfluidic sorting chip using a syringe pump. The sorting system includes a 488 nm laser, a PMT detector, and a high-frequency high-voltage dielectrophoresis drive module. A detection threshold was set: using the average fluorescence intensity of unloaded microspheres without spinosad, plus three times the standard deviation, as a baseline, the top 1% of microspheres by fluorescence intensity were selected for positive selection.
[0110] After sorting and collecting the microspheres, perfluorooctanoic acid was used to demulsify them. Then, 1 mg / mL collagenase IV solution was added, and the mixture was incubated at 37°C for 15 min to digest the GelMA shell and release the test strain inside. The bacterial culture was then spread on selective plates and incubated at 30°C for 7 days.
[0111] Twenty strains obtained from the initial screening were randomly selected for shake-flask re-screening (fermentation medium: 45g glucose, 30g cottonseed meal, 35g CaCO3, 15mL soybean oil, adjusted volume 1L, pH 7.0, 30℃, 250rpm, cultured for 9 days). Spontacillin production was determined by HPLC. The results showed that the strains obtained by the method of this invention had a positive mutation rate as high as 75%, and the optimal strain achieved a shake-flask yield of 850 mg / L, which was 124% higher than the starting strain (380 mg / L), significantly superior to traditional random screening methods.
[0112] Example 4 Based on Examples 2 and 3, only aptamer fluorescent probe A was replaced with aptamer fluorescent probe B. Shake-flask rescreening results showed that the positive mutation rate reached 70%, and the optimal strain achieved a shake-flask yield of 825 mg / L.
[0113] Example 5 Based on Examples 2 and 3, only aptamer fluorescent probe A was replaced with aptamer fluorescent probe C. The positive mutation rate reached 72%, and the optimal strain yielded 830 mg / L in shake flasks.
[0114] Comparative Example 1 Based on Examples 2 and 3, only the aptamer fluorescent probe A is replaced with the aptamer fluorescent probe D.
[0115] During the sorting process, it was found that due to the low affinity of the probe, microspheres that produced large quantities of spinosad could not generate a fluorescence signal sufficient to overcome the background noise (high false negative rate); at the same time, background fluorescence caused by non-specific binding led to the sorting of some false positive microspheres.
[0116] Among the selected strains, the positive mutation rate was only 15%, and the yield of the best strain in shake flask was only 415 mg / L, which was only a slight improvement over the starting strain (380 mg / L).
[0117] The results of Examples 3, 4, 5 and Comparative Example 1 are as follows: Figure 3 As shown, the spinosad yields of strains screened using different aptamer fluorescent probes varied significantly. Strains screened using aptamer fluorescent probes A, B, and C showed significantly increased spinosad yields, while aptamer fluorescent probe D showed no significant increase. This indicates that the binding domain in the nucleic acid aptamer of this invention is crucial for binding spinosad. Without this binding domain, spinosad cannot be specifically bound, preventing the nucleic acid aptamer from correctly identifying strains with high spinosad yields, leading to serious missed screening. Only with this binding domain can the nucleic acid aptamer correctly identify strains with high spinosad yields.
[0118] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.
Claims
1. A nucleic acid aptamer, characterized in that, It includes a binding domain having the nucleotide sequence shown in SEQ ID NO:
1.
2. The nucleic acid aptamer according to claim 1, wherein, The nucleic acid aptamer is at least one of the following (1)-(4): (1) The nucleotide sequence shown in SEQ ID NO:2; (2) The nucleotide sequence shown in SEQ ID NO:3; (3) The nucleotide sequence shown in SEQ ID NO:4; (4) A nucleotide sequence that has at least 80% homology with any of the nucleotide sequences described in (1)-(3); And / or, the nucleic acid aptamer further includes a reporter group for generating a signal when the nucleic acid aptamer binds to spinosad; Preferably, the reporter group includes a fluorescent group and a quenching group.
3. The use of the nucleic acid aptamer according to claim 1 or 2 for preparing products for detecting spinosad or screening spinosad-producing strains.
4. A micro-reaction module, characterized in that, include: The first unit contains the test strain, and the first unit is used to cultivate the test strain to produce spinosad. The second unit comprises the nucleic acid aptamer as described in claim 1 or 2, wherein the second unit is used to encapsulate the first unit; Wherein, when the test strain produces spinosad, the spinosad can diffuse from the first unit to the second unit; Preferably, the first unit is the core and the second unit is the outer shell, forming a core-shell structure; Preferably, the concentration of the nucleic acid aptamer in the second unit is 0.5-20 μM, more preferably 2-8 μM; Preferably, the content of the test strain in the first unit is 10. 4 -10 8 Cells / mL, more preferably 10 5 -10 7 cells / mL; Preferably, the volume ratio of the first unit to the second unit is 1:(1-10), more preferably 1:(2-5).
5. The microreaction module according to claim 4, wherein, The tested strains include Polysporum spinosum (Saccharomyces cerevisiae) Saccharopolyspora spinosa ); Preferably, the *Saccharopolysporium spp.* includes wild-type *Saccharopolysporium spp.* and / or *Saccharopolysporium spp.* mutants; More preferably, the *Saccharomyces cerevisiae* mutant includes *Saccharomyces cerevisiae* obtained by at least one of the following methods: ultraviolet irradiation, atmospheric pressure and room temperature plasma mutagenesis, chemical mutagenesis, or genetic engineering modification.
6. The microreaction module according to claim 4 or 5, wherein, The first unit includes a bacterial culture medium and an optional thickener, wherein the bacterial culture medium is used to culture the test bacterial strain; Preferably, the thickener is selected from at least one of methylcellulose, carboxymethylcellulose, cellulose nanocrystals, and polyvinyl alcohol; More preferably, the thickener in the first unit is present in an amount of 0.1-5 wt%, preferably 1-3 wt%; And / or, the second unit includes a gelling agent; Preferably, the gelling agent is obtained by crosslinking a photocrosslinking agent and a photoinitiator; more preferably, the photocrosslinking agent includes at least one of methacrylated gelatin, methacrylated hyaluronic acid, polyethylene glycol diacrylate, methacrylated collagen, methacrylated sodium alginate, and methacrylated chitosan; even more preferably, the photoinitiator includes at least one of 2-hydroxy-2-methyl-1-phenyl-1-propanone, 2-hydroxy-4′-(2-hydroxyethoxy)-2-methylphenylacetone, lithium phenyl(2,4,6-trimethylbenzoyl)phosphate, diphenyl(2,4,6-trimethylbenzoyl)phosphine oxide, eosin Y, and riboflavin. More preferably, the amount of the photocrosslinking agent is 0.5-20 wt%, preferably 2-10 wt%, compared to the total mass of the second unit, and the amount of the photoinitiator is 0.05-2 wt%, preferably 0.5-1 wt%.
7. The method for preparing the microreaction module according to any one of claims 4-6, characterized in that, The method includes: preparing droplets in a microfluidic device and solidifying them to obtain a microreaction module; Preferably, the microfluidic device includes: An external phase channel is used to transport an external phase solution, which is used to stabilize the droplets; Intermediate phase channel, used to transport intermediate phase solution to form the second unit; An internal phase channel is used to transport the internal phase solution to form the first unit; Preferably, the outer phase channel, the intermediate phase channel, and the inner phase channel form a coaxial nested structure of glass capillaries or a PDMS flow focusing structure; Preferably, the internal phase solution comprises a bacterial culture medium and an optional thickener, wherein the bacterial culture medium is used to culture the test bacterial strain; More preferably, the thickener is selected from at least one of methylcellulose, carboxymethylcellulose, cellulose nanocrystals and polyvinyl alcohol; More preferably, the content of the thickener in the internal phase solution is 1-3 wt%; Preferably, the concentration of the nucleic acid aptamer in the inner phase solution is 2-8 μM; Preferably, the intermediate phase solution comprises a photocrosslinking agent and a photoinitiator; more preferably, the photocrosslinking agent comprises at least one of methacrylated gelatin, methacrylated hyaluronic acid, polyethylene glycol diacrylate, methacrylated collagen, methacrylated sodium alginate, and methacrylated chitosan; even more preferably, the photoinitiator comprises at least one of 2-hydroxy-2-methyl-1-phenyl-1-propanone, 2-hydroxy-4′-(2-hydroxyethoxy)-2-methylphenylacetone, lithium phenyl(2,4,6-trimethylbenzoyl)phosphate, diphenyl(2,4,6-trimethylbenzoyl)phosphine oxide, eosin Y, and riboflavin; More preferably, in the mesophase solution, the content of the photocrosslinking agent is 2-10 wt%, and the content of the photoinitiator is 0.5-1 wt%. Preferably, the external phase solution comprises a surfactant and a fluorinated oil; More preferably, the fluorinated oil includes at least one of HFE-7500, FC-40 and FC-43; More preferably, the surfactant includes Pico-Surf and / or EA surfactant; More preferably, the surfactant content in the external phase solution is 0.5-10 wt%, preferably 2-5 wt%. Preferably, the flow rate of the inner phase solution is 0.01-0.5 mL / h, more preferably 0.05-0.2 mL / h; the flow rate of the intermediate phase solution is 0.05-1.0 mL / h, more preferably 0.2-0.5 mL / h; and the flow rate of the outer phase solution is 0.5-10 mL / h, more preferably 1-4 mL / h. Preferably, the curing includes photocrosslinking curing; Preferably, the inner diameter of the outer phase channel is 200-1000 μm, more preferably 300-800 μm; the inner diameter of the intermediate phase channel is 100-400 μm, more preferably 150-250 μm; and the inner diameter of the inner phase channel is 20-150 μm, more preferably 40-80 μm. Preferably, the tip of the inner phase channel is hydrophobically treated, and the inner walls of the intermediate phase channel and the outer phase channel are hydrophilic or hydrophobic.
8. A method for screening spinosad-producing strains, characterized in that, The method includes: using the nucleic acid aptamer of claim 1 or 2 or the microreaction module of any one of claims 4-6 to detect the spinosad level produced by the test strain, and screening the test strain based on the detection result of the spinosad level.
9. The method according to claim 8, wherein, The method includes: culturing the microreaction module according to any one of claims 4-6 under conditions suitable for spinosad synthesis, detecting the spinosad level produced by the test strain using microfluidic technology, and sorting the strains according to the detection results to obtain spinosad-producing strains; Preferably, the cultivation conditions include: a temperature of 28-30℃, a time of 5-10 days, and a humidity of ≥80%; Preferably, the sorting includes fluorescently activated droplet sorting; More preferably, the sorting method includes detecting the intensity of the fluorescence signal output by the micro-reaction module by laser excitation, and sorting out the spinosad-producing strains when the detected fluorescence signal intensity is higher than a preset threshold.
10. A screening system for spinosad-producing strains, characterized in that, include: The detection module is used to detect spinosad produced by the test strain; The sorting module is used to sort the strains to be tested based on the results of the detection module; The detection module includes the nucleic acid aptamer as described in claim 1 or 2, or the microreaction module as described in any one of claims 4-6.