A method for constructing a CLOCK gene knockout cell line based on CRISPR / Cas9 technology

Abstract

The application discloses a method for constructing a CLOCK gene knockout cell line based on CRISPR / Cas9 technology, which comprises the following steps: (1) sgRNA design and preparation: an sgRNA target sequence is designed to target the 3rd exon of the CLOCK gene; (2) editing vector construction: the double-stranded sgRNA obtained in the step (1) is inserted into a PX459 vector linearized by BbsI enzyme cutting, and after transformation of competent cells, a recombinant plasmid PX459-CLOCK-sgRNA is obtained through screening; (3) cell transfection: the recombinant plasmid obtained in the step (2) is transfected into HEK293T cells; (4) resistance screening: 2 μg / mL puromycin is added into the culture medium 24 hours after transfection, and the resistance cells are obtained through continuous screening for 10 days; (5) single clone acquisition: the survived resistant cells are inoculated and cultured at a low density, and the single clones are picked and amplified; (6) editing verification: the CLOCK gene knockout effect of the single clones is verified from the mRNA and protein levels, and a CLOCK gene knockout HEK293T cell line is obtained.

Description

Technical Field

[0001] This invention relates to a method for constructing a CLOCK gene knockout cell line based on CRISPR / Cas9 technology. Background Technology

[0002] The CLOCK (Circadian Locomotor Output Cycles Kaput) gene is one of the core genes in the mammalian circadian rhythm regulatory network. Currently, methods for studying CLOCK gene function mainly include RNA interference (RNAi), homologous recombination knockout, and CRISPR / Cas9 gene editing technology. Among these, RNAi suffers from off-target effects and incomplete knockout; traditional homologous recombination knockout is inefficient and time-consuming. The CRISPR / Cas9 system, due to its ease of operation, high editing efficiency, and strong specificity, has become the preferred tool for gene function research.

[0003] In 2019, a study developed a simplified CRISPR gene knockout method for clock genes, featuring three key characteristics: integrating a Cas9 protein expression cassette, an sgRNA expression cassette, and a fluorescent label into a single vector, forming an "integrated" vector system. Using the Gateway cloning strategy, specific sgRNA is rapidly cloned into the integrated vector via PCR and in vitro recombination, eliminating the need for traditional enzyme digestion and ligation steps. Adenovirus is used as the delivery vector, leveraging its large-capacity packaging capacity and high transduction efficiency to package the integrated vector into adenovirus particles for infecting target cells. However, this technology has limitations: after infecting cells, the adenovirus genome exists as an episome within the cell nucleus and does not integrate into the host genome. With cell division, the adenovirus genome gradually dilutes and is lost, resulting in the inability of the CRISPR / Cas9 editing system to achieve long-term stable expression in cells. This is detrimental to research requiring long-term stable gene knockout. While the Gateway cloning system simplifies vector construction, it requires dedicated starter and target vectors, as well as an LR recombinase mixture. These reagents are expensive, and the recombination reaction usually takes more than 16 hours overnight, which is not efficient for experiments that require rapid construction of multiple sgRNA vectors.

[0004] In 2021, a study addressed the functional redundancy issue in the clock gene family by developing a multiplex CRISPR-Cas9 system based on a single AAV vector. However, this technology has limitations: the maximum packaging capacity of an AAV vector is approximately 4.7 kb, while the SpCas9 gene itself is already close to 4.2 kb. Adding elements such as the sgRNA expression cassette and promoter further limits the capacity. This prevents the inclusion of more sgRNA or multiple editing elements within the same AAV vector; it also prevents the simultaneous expression of reporter genes or selection markers; and it necessitates the use of gene knock-in mouse models (Cas9-expressing mice) to compensate for the limited capacity, increasing the complexity and cost of model construction. In vivo application of this technology relies on a pre-constructed Cas9 gene knock-in mouse model (i.e., all cells in the mouse stably express the Cas9 protein). Research teams without such a mouse model cannot directly utilize this technology. Summary of the Invention

[0005] The purpose of this invention is to overcome at least one of the above-mentioned problems, provide a CRISPR / Cas9 editing system targeting the CLOCK gene and its construction method, and establish a complete operation process from gene editing to functional verification, providing technical support for CLOCK gene function research and the establishment of cell models of CLOCK-related diseases.

[0006] This invention provides a method for constructing a CLOCK gene knockout cell line based on CRISPR / Cas9 technology, which includes the following steps:

[0007] (1) sgRNA design and preparation: sgRNA targeting sequences were designed to target the third exon of the CLOCK gene. The design of the sgRNA simultaneously met the following conditions: it targeted the third exon region of the CLOCK gene; the PAM sequence immediately downstream of the target site was 5'-NGG-3', where N was any one of A, T, C or G; and there were no four or more consecutive T bases in the sequence.

[0008] (2) Design PCR primers in the regions flanking the sgRNA target site to amplify the genomic fragment containing the target site;

[0009] (3) Vector construction: Insert the double strand of sgRNA obtained in step (1) into the linearized PX459 vector, transform competent cells and screen to obtain recombinant plasmid PX459-CLOCK-sgRNA;

[0010] (4) Cell transfection: Transfect the recombinant plasmid obtained in step (3) into the target cells;

[0011] (5) Resistance selection: After transfection, resistance selection is performed to obtain resistant cells;

[0012] (6) Monoclonal acquisition: Low-density seeding and culture of surviving resistant cells, and selection and amplification of monoclonal cells;

[0013] (7) Editing and verification: The effect of single-clonal CLOCK gene knockout was verified at the mRNA and protein levels to obtain CLOCK gene knockout cell lines.

[0014] Further, in step (1), the sgRNA targeting sequence is 5'-ctagtgaaattcgacaggac-3'. The sense strand containing the BbsI sticky end is: gRNA-F: 5'-CACCctagtgaaattcgacaggac-3'; the antisense strand containing the BbsI sticky end is: gRNA-R: 5'-AAACgtcctgtcgaatttcactag-3'.

[0015] Further, in step (2), the designed PCR primers are: forward primer CLOCK-F: 5'-CACCtcctggtaatgctagaaaga-3', reverse primer CLOCK-R: 5'-AAACtctttctagcattaccagga-3'; PCR reaction program: pre-denaturation at 95℃ for 5 min, incubation at 85℃ for 5 min, then gradient cooling to 25℃ at a rate of 1℃ / min, and holding at 25℃ for 5 min.

[0016] Further, step (3) specifically includes: taking 1 μg of PX459 vector, digesting it with BbsI-HF restriction endonuclease at 37℃ for 3 h, and recovering the linearized vector fragment; mixing the sgRNA double strand with the linearized vector at a molar ratio of 3:1, adding T4 DNA ligase, ligating at room temperature for 20 min, transforming DH5α competent cells, plating on LB plates containing 100 μg / mL ampicillin, and culturing overnight at 37℃; picking single clones for sequencing verification, and obtaining the recombinant plasmid PX459-CLOCK-sgRNA after confirming that the inserted sequence is correct.

[0017] Further, in step (4), target cells were seeded into 6-well plates 24 hours before transfection, with the density controlled at 50%~70%, and transfected using Lipofectamine 3000 transfection reagent, with 2 μg of recombinant plasmid transfected per well; at the same time, empty vector transfection group and untransfected group were set up as controls.

[0018] Furthermore, during the screening process in step (5), the culture medium containing 2 μg / mL puromycin was replaced every 24-48 hours, and all untransfected cells died within 5-7 days.

[0019] Furthermore, the acquisition of monoclonal cells in step (6) specifically includes: after screening, digesting and counting the surviving cells, at a rate of 10 cm⁻¹. 2Low-density plating of 500-1000 cells per culture dish, cultured at 37°C and 5% CO2 for 7-14 days, then select individual clones for sequential amplification in 24-well plates, 6-well plates, and T25 culture flasks.

[0020] Furthermore, in step (7), the mRNA level verification was performed using qRT-PCR with GAPDH as an internal reference to calculate the relative expression level of the CLOCK gene; the protein level verification was performed using Western Blot, with CLOCK protein-specific antibody used to detect protein expression.

[0021] The present invention also provides a kit for constructing a CLOCK gene knockout cell line, which includes the recombinant plasmid PX459-CLOCK-sgRNA, a matching transfection reagent, a puromycin screening reagent, and PCR primers for CLOCK gene editing verification.

[0022] Compared with the prior art, this technical solution has the following advantages:

[0023] 1. This invention designs sgRNA in the third exon region of the CLOCK gene, which belongs to the early exon of the coding region. Introducing a frameshift mutation at this site leads to the complete loss of most downstream key functional domains (including the bHLH domain and PAS domain), thus avoiding the possibility of truncated proteins that retain some activity from late exon targeting, ensuring the acquisition of completely loss-of-function CLOCK gene knockout cells. The downstream of the selected sgRNA target strictly adheres to the SpCas9 PAM sequence requirement of 5′-NGG-3′, ensuring that the Cas9 protein can correctly recognize and bind to the target DNA site, avoiding cleavage failure due to PAM deletion or mismatch, and significantly improving editing efficiency.

[0024] 2. The sgRNA sequence designed in this invention has a GC content within an appropriate range, avoiding both non-specific binding caused by excessively high GC and instability in sgRNA-Target hybridization caused by excessively low GC, thus ensuring cleavage activity while reducing off-target risk. This sgRNA sequence does not contain four or more consecutive T bases, effectively preventing premature transcriptional termination mediated by the U6 promoter, ensuring full-length sgRNA expression, and enhancing the overall editing activity of the CRISPR / Cas9 system. Bioinformatics prediction shows that this sgRNA sequence has no obvious stem-loop secondary structure, which is conducive to the correct folding of sgRNA and Cas9 protein and the formation of a stable complex, further improving targeted cleavage efficiency.

[0025] 3. The aforementioned multiple screening strategy of "early exon targeting + PAM adaptation + moderate GC + no continuous T + no secondary structure" achieves an optimal balance in terms of sgRNA specificity, stability, expression level, and cleavage efficiency. Combined with puromycin screening and monoclonal amplification, a large number of CLOCK gene knockout cell lines, validated by both mRNA and protein, can be obtained in a short time, providing an efficient and reliable experimental tool for CLOCK gene function research and the construction of related disease models.

[0026] 4. Traditional enzyme digestion and ligation method, low cost: This invention uses the traditional cloning method of BbsI enzyme digestion and T4 DNA ligase. The reagents are all commonly used laboratory consumables, which are low cost and mature technology.

[0027] 5. No capacity limitation of plasmid vector: The present invention uses the PX459 plasmid vector, which has a large capacity (about 9 kb) and can simultaneously express SpCas9, sgRNA and puromycin resistance gene, without the need to consider packaging capacity issues.

[0028] 6. Not dependent on any transgenic animal model: This invention targets in vitro cell-level editing, which does not require any transgenic animal model and has a wider range of applications. Attached Figure Description

[0029] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0030] Figure 1. Schematic diagram of the location of sgRNA in the exon of the CLOCK gene.

[0031] Figure 2 Sequencing peaks of the PX459-CLOCK-sgRNA vector

[0032] Figure 3. Morphological diagram of CLOCK KO cells and WT (wild-type) cells.

[0033] Figure 4. Relative expression level of CLOCK mRNA

[0034] Figure 5. Western blot analysis of CLOCK protein expression changes at the protein level.

[0035] Figure 6 Figure 4 Quantitative analysis chart in

[0036] Figure 7. Viability assay of CLOCK gene knockout cells Detailed Implementation

[0037] The technical principles related to this invention are as follows:

[0038] Utilizing the sequence-specific DNA cleavage capability of the CRISPR / Cas9 system, specific exon regions of the human CLOCK gene were cleaved site-specifically under the guidance of artificially designed sgRNA. Frameshift mutations were introduced through the cell's own DNA repair mechanisms, preventing the normal synthesis of the CLOCK protein and thus achieving functional knockout of the CLOCK gene. Based on this, CLOCK gene knockout cell lines were obtained through antibiotic selection, single-clone acquisition, and joint validation.

[0039] (1) sgRNA-guided recognition principle

[0040] The sgRNA (sequence: ctagtgaaattcgacaggac) designed in this invention can specifically pair complementary with the DNA strand at the target site of the CLOCK gene. After binding to the Cas9 protein, the sgRNA guides Cas9 to the target site. Cas9 can only cleave DNA after recognizing the PAM sequence (5′-NGG-3′), which ensures the specificity of cleavage.

[0041] (2) Frame shift mutation principle

[0042] When the length of an insertion or deletion of a base is not a multiple of 3, it results in a frameshift mutation. A frameshift mutation completely alters the amino acid sequence downstream of the mutation site and causes a premature stop codon, leading to premature termination of translation and the production of a truncated, nonfunctional CLOCK protein.

[0043] (3) Screening principle

[0044] The PX459 vector co-expresses Cas9 and puromycin resistance genes. After the addition of 2 µg / mL puromycin, untransfected cells died, while successfully transfected cells survived. A 10-day selection period ensures that non-mutated cells are eliminated, increasing the positive rate.

[0045] (4) Monoclonal Acquisition Principle

[0046] The surviving cells were spaced at approximately 1000 per 10 cm³. 2 Low-density inoculation of the dish allows individual cells to proliferate independently, forming cell clusters (monoclonals) derived from a single cell. After 7-14 days of culture, a visible clone is formed.

[0047] Example 1

[0048] 1. Design of sgRNA and PCR primers

[0049] (1) sgRNA design

[0050] The genomic sequence of the human CLOCK gene was obtained from the NCBI database, and its exon structure was analyzed using SnapGene software. Within exon 3 of the coding region, the PAM motif (5′-NGG-3′) was identified, and an sgRNA was designed approximately 20 nucleotides upstream of it. Figure 1 ).

[0051] The designed sgRNA targeting sequence is as follows:

[0052]

[0053] (2) Design of PCR primers for verification

[0054] PCR primers were designed in the regions flanking the sgRNA target site to amplify genomic fragments containing the target site in order to verify the gene editing effect.

[0055] The designed PCR primer sequences are as follows:

[0056] Name sequence (5'→3') description

[0057] CLOCK-Fcacctcctggtaatgctagaaaga upstream primer, containing CACC adapter (SEQ ID NO: 4)

[0058] CLOCK-Raaactctttctagcattaccagga downstream primer, containing AAAC adapter (SEQ ID NO: 5).

[0059] According to NCBI BLAST comparison, the above primers have high specificity in the human genome and no risk of nonspecific amplification.

[0060] 2. Construction of the editing medium

[0061] (1) Preparation of sgRNA double strands

[0062] Prepare 10 µL reaction systems of the designed gRNA-F and gRNA-R according to the table below.

[0063] Reaction system table

[0064]

[0065] After preparing the reaction system, the PCR reaction was performed according to the following procedure: first, pre-denaturation was carried out at 95°C for 5 min, followed by treatment at 85°C for 5 min; then, a gradient cooling was performed, decreasing the temperature by 1°C per minute until reaching 25°C, and then holding at 25°C for 5 min. (10 × Annealing buffer was purchased from New England Biolabs.)

[0066] (2) Vector digestion

[0067] Take 1 µg of PX459 vector (Addgene), add 3 µL of 10× CutSmart Buffer (New England Biolabs), 1 µL of BbsI-HF restriction endonuclease (New England Biolabs), and add water to a final volume of 20 µL. Digest at 37°C for 3 hours. Separate the digestion products by 1% agarose gel electrophoresis and recover the linearized vector fragment.

[0068] (3) Connection and transformation

[0069] The annealed sgRNA double strands were mixed with the linearized PX459 vector at a molar ratio of 3:1, and 1 µL of T4 DNA ligase (New England Biolabs) and 1 µL of 10 × T4 buffer (New England Biolabs) were added. The mixture was ligated at room temperature for 20 min to obtain the ligation product.

[0070] The ligation product was added to competent DH5α cells, incubated on ice for 30 min, and then heat-shocked in a 42°C water bath for 90 s. 500 µL of antibiotic-free LB liquid medium was then added. The mixture was shaken at 100 rpm for 1 h at 37°C, followed by centrifugation at 5000 rpm for 2 min at 37°C to obtain a cell pellet. Approximately 300 µL of supernatant was discarded, and the cell pellet was thoroughly resuspended in the remaining medium. Finally, the resuspended bacterial culture was evenly spread onto LB solid medium plates containing ampicillin (100 µg / mL) (Shanghai Maclean Biochemical Technology Co., Ltd.), and incubated overnight at 37°C.

[0071] (4) Sequencing verification

[0072] Pick 3-5 single clones and inoculate them into LB liquid medium (containing 100 µg / mL ampicillin) and culture overnight at 37°C with shaking. Extract the plasmid and sequence it using U6 promoter sequencing primers (5′-gagggcctatttcccatgattcc-3′, SEQ ID NO: 6). The sequencing result should show the inserted sequence as CACCctagtgaaattcgacaggac (SEQ ID NO: 2). After confirmation, name it PX459-CLOCK-sgRNA. Figure 2 ).

[0073] 3. Cell transfection

[0074] (1) Cell culture

[0075] HEK293T cells were cultured in DMEM high glucose medium (Gibco Life Sciences, USA) (containing 10% fetal bovine serum (Gibco Life Sciences, USA) and 1% penicillin / streptomycin (Gibco Life Sciences, USA)) and routinely cultured in a 37°C, 5% CO2 incubator.

[0076] (2) Transfection

[0077] Twenty-four hours before transfection, HEK293T cells were seeded into 6-well plates at a density of 50%–70%. Using Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific), 2 µg of PX459-CLOCK-sgRNA plasmid was transfected into each well. An empty vector transfection group and an untransfected group were also set up as controls.

[0078] 4 Resistance screening

[0079] Twenty-four hours after transfection, 2 µg / mL of puromycin (Thermo Fisher Scientific) was added to the culture medium of all experimental and control groups. During the selection period, the culture medium containing 2 µg / mL puromycin was replaced every 24–48 hours for 10 days. Untransfected cells should have all died within 5–7 days, while a small number of surviving cells were observed in the empty vector transfection group.

[0080] 5. Single Clon Acquisition and Amplification

[0081] (1) Cell digestion and inoculation

[0082] After screening, the culture medium was discarded, and the cells were washed once with PBS. They were then digested for 1 minute with 0.25% trypsin (Gibco Life Sciences, USA), and the digestion was terminated by adding serum-containing culture medium. The cell suspension was transferred to a 15 mL centrifuge tube and centrifuged at 800 rpm for 3 minutes to collect the cell pellet. The cells were resuspended in fresh culture medium and counted. After dilution, the cells were seeded at 10 cm⁻¹. 2 In each culture dish, 500 to 1000 cells are seeded.

[0083] (2) Monoclonal culture

[0084] Place the culture dishes in a 37℃, 5% CO2 incubator and incubate statically for 7–14 days, changing the culture medium every 3 days. Observe under an inverted microscope until a visible monoclonal cell cluster forms.

[0085] (3) Single clone selection and amplification

[0086] Use a sterile pipette tip to pick up a single clone and transfer it to a 24-well plate for further amplification. Once the cells have reached confluence, gradually expand to 6-well plates and then to T25 culture flasks.

[0087] 6. Verification of Editing Results

[0088] (1) mRNA level verification

[0089] Single-clonal cells were harvested, and total RNA was extracted using the TRIzol method, followed by reverse transcription to synthesize cDNA. The expression level of the CLOCK gene mRNA was detected by qRT-PCR. GAPDH was used as an internal reference gene, and 2^... (-ΔΔCt) The relative expression level was calculated using the method (Trizol was purchased from Hunan Aikerui Biotechnology Co., Ltd.).

[0090] At the mRNA level, the expression level of CLOCK mRNA in CLOCK gene knockout cell lines was significantly reduced. Figure 4 ).

[0091] (2) Protein level verification

[0092] Single-clonal cells were harvested and RIPA lysis buffer (containing protease inhibitors) (Beijing Solarbio Science & Technology Co., Ltd.) was added to extract total protein. Protein concentration was determined by BCA method. An equal volume of protein was subjected to SDS-PAGE electrophoresis, and after transfer to a membrane, Western blot analysis was performed using anti-CLOCK antibody and anti-GAPDH antibody.

[0093] At the protein level, the CLOCK protein band was almost undetectable in the CLOCK gene knockout cell line. Figure 5 , 6 ).

[0094] 7. CCK-8 Cell Viability Assay

[0095] The absorbance at 450 nm was measured in each well of the two cell groups using an ELISA reader to detect the difference in cell viability between the wild-type (WT) cell line and the CLOCK gene knockout cell line.

[0096] CLOCK gene knockout had no significant effect on cell proliferation. Figure 7 Furthermore, there was no significant morphological difference between the WT cell line and the CLOCK gene knockout cell line. Figure 3 ).

[0097] The above description is merely a preferred embodiment of the present invention, and therefore should not be construed as limiting the scope of the present invention. All equivalent changes and modifications made in accordance with the scope of the patent and the contents of the specification should still fall within the scope of the present invention.

Claims

1. A method for constructing a CLOCK gene knockout cell line based on CRISPR / Cas9 technology, characterized in that, Includes the following steps: (1) sgRNA design and preparation: sgRNA targeting sequences were designed to target the third exon of the CLOCK gene. The design of the sgRNA simultaneously met the following conditions: it targeted the third exon region of the CLOCK gene; the PAM sequence immediately downstream of the target site was 5'-NGG-3', where N was any one of A, T, C or G; and there were no four or more consecutive T bases in the sequence. (2) Design PCR primers in the regions flanking the sgRNA target site to amplify the genomic fragment containing the target site; (3) Vector construction: Insert the double strand of sgRNA obtained in step (1) into the linearized PX459 vector, transform competent cells and screen to obtain recombinant plasmid PX459-CLOCK-sgRNA; (4) Cell transfection: Transfect the recombinant plasmid obtained in step (3) into the target cells; (5) Resistance selection: After transfection, resistance selection is performed to obtain resistant cells; (6) Single clone acquisition: Low-density seeding and culture of resistant cells, and selection of single clones for amplification; (7) Editing and verification: The effect of single-clonal CLOCK gene knockout was verified at the mRNA and protein levels to obtain CLOCK gene knockout cell lines.

2. The method according to claim 1, characterized in that, In step (1), the target sequence of the sgRNA is 5'-ctagtgaaattcgacaggac-3'; the sense strand containing the BbsI sticky end is: gRNA-F: 5'-CACCctagtgaaattcgacaggac-3'; and the antisense strand containing the BbsI sticky end is: gRNA-R: 5'-AAACgtcctgtcgaatttcactag-3'.

3. The method according to claim 1, characterized in that, In step (2), the designed PCR primers are: forward primer CLOCK-F: 5'-CACCtcctggtaatgctagaaaga-3', reverse primer CLOCK-R: 5'-AAACtctttctagcattaccagga-3'; PCR reaction program: pre-denaturation at 95℃ for 5 min, incubation at 85℃ for 5 min, then gradient cooling to 25℃ at a rate of 1℃ / min, and holding at 25℃ for 5 min.

4. The method according to claim 1, characterized in that, Step (3) specifically includes: taking 1 μg of PX459 vector, digesting it with BbsI-HF restriction endonuclease at 37℃ for 3 h, and recovering the linearized vector fragment; mixing the sgRNA double strand with the linearized vector at a molar ratio of 3:1, adding T4 DNA ligase and ligating at room temperature for 20 min, transforming DH5α competent cells, plating on LB plates containing 100 μg / mL ampicillin, and culturing overnight at 37℃; picking single clones for sequencing verification, and obtaining the recombinant plasmid PX459-CLOCK-sgRNA after confirming that the inserted sequence is correct.

5. The method according to claim 1, characterized in that, In step (4), target cells were seeded into 6-well plates 24 hours before transfection, with the density controlled at 50%~70%. Lipofectamine 3000 transfection reagent was used for transfection, with 2 μg of recombinant plasmid transfected into each well. At the same time, empty vector transfection group and untransfected group were set up as controls.

6. The method according to claim 1, characterized in that, During the screening process in step (5), the culture medium containing 2 μg / mL puromycin was replaced every 24-48 hours. All untransfected cells died within 5-7 days.

7. The method according to claim 1, characterized in that, Step (6) for obtaining monoclonal antibodies specifically includes: after screening, digesting and counting the surviving cells, at a rate of 10 cm⁻¹. 2 Low-density plating of 500-1000 cells per culture dish was carried out, and the cells were cultured at 37°C and 5% CO2 for 7-14 days. Independent single clones were then picked and amplified sequentially in 24-well plates, 6-well plates, and T25 culture flasks.

8. The method according to claim 1, characterized in that, In step (7), the mRNA level verification was performed using qRT-PCR with GAPDH as an internal reference to calculate the relative expression level of the CLOCK gene; the protein level verification was performed using Western Blot with a CLOCK protein-specific antibody to detect protein expression.

9. A kit for constructing a CLOCK gene knockout cell line, characterized in that, It includes the recombinant plasmid PX459-CLOCK-sgRNA used in the method of any one of claims 1 to 8, the matching transfection reagent, the puromycin screening reagent, and the PCR primers for CLOCK gene editing verification.

Images