Codon-optimized ddit4 gene, overexpression vector, cell line, recombinant protein expression system and application thereof

Abstract

This invention relates to a codon optimization DDIT4 Genes, overexpression vectors, overexpression DDIT4 This research focuses on CHO cells, recombinant protein expression systems, and their applications, involving the field of genetic engineering technology. Codon optimization... DDIT4 The nucleotide sequence of the gene is shown in SEQ ID NO.2. This invention utilizes... DDIT4 Gene codon optimization, construction of recombinant overexpression vectors, and modification of CHO-S cells effectively increased the expression levels of recombinant proteins such as trastuzumab, providing a new strategy for the efficient production of recombinant proteins.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more particularly to a codon-optimized method. DDIT4 Genes, overexpression vectors, overexpression DDIT4 CHO cell lines, recombinant protein expression systems and their applications. Background Technology

[0002] CHO cells are currently the preferred host cells for the preparation of recombinant protein drugs such as recombinant antibodies and fusion proteins in the biopharmaceutical field. They possess advantages such as protein glycosylation modification capabilities similar to those of human cells, the ability to be cultured in suspension at high densities, and ease of large-scale fermentation production. Several antibody drugs, including trastuzumab, are produced industrially using CHO cells. With the continued growth in demand for biopharmaceuticals, improving the expression level of recombinant proteins in CHO cells and reducing production costs have remained key research directions in the field of cell engineering.

[0003] Currently, methods to increase CHO cell expression levels mainly fall into three categories: culture medium optimization, culture process regulation, and host cell gene modification. Culture medium and fermentation process optimization are relatively mature, with limited room for further improvement. Modifying the CHO cell genome through genetic engineering to regulate pathways related to cell proliferation, anti-apoptosis, endoplasmic reticulum processing, and protein secretion, and constructing high-yielding cell lines, has become the most effective way to increase recombinant protein production. Genes related to the endoplasmic reticulum unfolded protein response (UPR), autophagy, and oxidative stress can regulate cell viability and protein synthesis and transport efficiency, making them popular targets for CHO cell modification.

[0004] DDIT4 Genes participate in the regulation of cellular stress responses and unfolded protein responses, and can regulate cellular physiological states and maintain cell viability when cells encounter stressful culture environments. CHO cells are highly susceptible to endoplasmic reticulum stress during high-density culture, which inhibits the synthesis and secretion of recombinant proteins. [Utilization] DDIT4 The gene's role in regulating endoplasmic reticulum stress can alleviate endoplasmic reticulum pressure and ensure normal protein synthesis. Naturally derived... DDIT4 The gene sequence differs from the codon preference of CHO cells, resulting in low gene translation efficiency when directly transfecting cells, making it difficult to achieve the desired regulatory effect.

[0005] Therefore, for DDIT4 Codon adaptation of genes to improve the expression level of recombinant proteins has important practical significance for the large-scale production of recombinant antibody drugs. Summary of the Invention

[0006] The purpose of this invention is to provide a codon-optimized... DDIT4 This invention relates to genes and their novel applications. DDIT4Genes were codon-optimized, recombinant overexpression vectors were constructed, and CHO-S cells were modified to obtain engineered cell lines that can be used for recombinant protein production.

[0007] To achieve the above objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides a codon-optimized... DDIT4 The gene, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0008] In a second aspect, the present invention provides a recombinant expression vector comprising the codon-optimized [method / information] of claim 1. DDIT4 Gene.

[0009] Preferably, the recombinant expression vector uses pWTY2412.12-Slc39a4-puro as the backbone vector, which is obtained by transferring the recombinant expression vector into the backbone vector. Slc39a4 The gene sequence was replaced with the one shown in SEQ ID NO.2. DDIT4 Genes obtained, More preferably, the recombinant expression vector is sequentially linked along the transcriptional direction with: a CMV enhancer, a CMV promoter, a T7 promoter, and a codon optimizer. DDIT4 The sequence includes a 6×His tag sequence, a WPRE post-transcriptional enhancement sequence, and an SV40 poly(A) termination tailing signal.

[0010] In a third aspect, the present invention provides a recombinant CHO cell line comprising the recombinant expression vector described above, stably overexpressing the expression vector shown in SEQ ID NO.2. DDIT4 Gene.

[0011] Preferably, the recombinant CHO cell line is obtained by transfecting the recombinant expression vector into CHO cells and then screening them with puromycin.

[0012] More preferably, the screening concentration of the puromycin is 15 μg / mL.

[0013] Preferably, the CHO cells are CHO-S cells that stably express trastuzumab.

[0014] In a fourth aspect, the present invention provides a method described above. DDIT4 Application of genes in the preparation of recombinant expression vectors or recombinant host cells.

[0015] In a fifth aspect, the present invention provides a method described above. DDIT4 Application of genes in enhancing the expression of recombinant proteins in CHO cells.

[0016] Preferably, the recombinant protein is trastuzumab.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention uses CHO cell codon usage preference optimization. DDIT4 Genes are modified by replacing low-frequency, rare codons in the wild-type sequence to adapt the entire sequence to the CHO cell translation system; then the optimized sequence is... DDIT4 Genes were constructed into a recombinant expression vector, transfected into CHO-S cells capable of expressing trastuzumab, and stable integration and continuous expression were obtained through resistance selection. DDIT4 The engineered cell line. Experimental results showed that overexpression of the optimized [cell line]... DDIT4 This invention effectively enhances the expression level of recombinant trastuzumab protein in CHO cells. It provides a novel gene modification strategy and cell modification protocol for the efficient production of recombinant proteins, especially antibody drugs. Attached Figure Description

[0018] Figure 1 The plasmid map of the backbone vector pWTY2412.12-Slc39a4-puro; Figure 2 This is a schematic diagram of the structure of the recombinant overexpression plasmid pWTY2412.12-DDIT4-puro, which was constructed based on a backbone vector. Figure 3 The plasmid map of the recombinant expression vector pWTY240204LH-Tra encoding trastuzumab; Figure 4 For Western blot detection of overexpression DDIT4 The expression level of DDIT4 protein in recombinant CHO cells; Figure 5 For the detection of transient overexpression by Western blot DDIT4 The effect of the effect on recombinant protein expression is shown in the figure. Figure 6 For Western blot detection of stable overexpression DDIT4 The effect of the effect on recombinant protein expression is shown in the figure. Detailed Implementation

[0019] The present invention will be further described in detail below with reference to specific embodiments. These embodiments are for understanding purposes and not for limiting the scope of protection of the present invention.

[0020] Wild type in existing technology DDIT4 The gene codons do not match the codon preferences of CHO cells, resulting in low translation efficiency in CHO cells and an inability to fully exert their regulatory functions. Therefore, this invention first commissioned General Biotechnology (Anhui) Co., Ltd. to investigate... DDIT4The gene was codon-bias optimized to adapt its sequence to the CHO cell translation system; the optimized gene was then constructed into a recombinant expression vector, transfected into CHO-S cells capable of expressing trastuzumab, and stable integration and continuous expression were obtained through resistance selection. DDIT4 The engineered cell line.

[0021] Example 1 Build DDIT4 Overexpression vector Natural and unoptimized DDIT4 The CDS sequence of (NCBI Gene ID: 100759745) is shown in SEQ ID NO. 1: ATGCCTAGCCTTTGGGATCGTTTCTCGTCCTCCTCCTCCTCCTCCTCTCGTCCTCGTCCGGAACTCCAGCCACTGATCGGCCGCCGCGCTCCGCCTGGGGGTCTGCGGCCCGAGAAGAGGGCCTTGACCGCTGCGCGAGCCTGGAGAGCTCGGACTGTGAGTCCTTGGACAGC AGCAACAGTGGCTTCGGACCGGAGGAAGACTCCTCATACCTGGATGGGGTGTCCCTGCCCGACTTTGAGCTGCTCAGTGACCCGGAGGATGAGCATCTGTGTGCCAACCTGATGCAGCTGCTGCAGGAGAGCCTGTCCCAGGCGCGATTGGGCTCGCGGCGCCCCGCGCCTG CTAATGCCAAGCCAGCTGGTGAGCCAGGTGGGCAAGGAACTCCTGCGCCTGGCTTACAGCGAGCCGTGCGGCCTGCGGGGGCACTGCTGGACGTCTGTGTGGAGCAAGGCAAGAGCTGCCATAGCGTGGCTCAGCTGGCCCTCGACCCCAGCCTGGTGCCCACCTTTCAGCTG ACCCTGGTGCTGCGCCTGGACTCTCGCCTCTGGCCCAAAATCCAGGGGCTGTTGAGTTCCGCTAACTCTTCCTTGGTCCCTGGCTACAGCCAGTCCCTGACGCTGAGCACCGGCTTCAGAGTCATCAAGAAGAAACTCTACAGCTCCGAACAGCTGCTCATTGAAGAGTGTTGA To adapt to the CHO cell expression system, this invention... DDIT4The gene underwent codon preference optimization for CHO cells, and the optimized nucleotide sequence is shown in SEQ ID NO.2. The specific sequence is as follows: ATGCCTTCCCTGTGGGACCGGTTCTCCAGCAGCAGCAGCTCTTCCAGCAGCTCTAGCAGCGGCACCCCAGCCACCGACCGGCCTCCTAGATCCGCCTGGGGCAGCGCTGCCAGAGAGGAGGGACTGGACAGGTGTGCCAGCCTGGAGTCCAGCGACTGTGAGTCCCTGGACTC CAGCAATAGCGGCTTCGGCCCTGAGGAGGACTCCAGCTACCTGGATGGCGTGAGCCTGCCTGATTTTGAGCTGCTGAGCGACCCCGAGGACGAGCACCTGTGTGCTAACCTGATGCAGCTGCTGCAGGAGTCCCTGTCCCAGGCTAGGCTGGCAGCAGGAGGCCCGCTAGAC TGCTGATGCCTAGCCAGCTGGTGAGCCAGGTGGGCAAGGAGCTGCTGAGGCTGGCCTACAGCGAGCCCTGCGGCCTGAGAGGCGCCTTGCTGGACGTGTGCGTGGAGCAGGGCAAGAGCTGTCACAGCGTGGCTCAGCTGGCCCTGGACCCTTCCCTGGTGCCTACCTTCCAG CTGACCCTGGTGCTGAGGCTGGACAGCAGGCTGTGGCCCAAGATCCAGGGCCTGCTGAGCAGCGCTAATTCCAGCCTGGTGCCTGGCTATTCCCAGAGCCTGACCCTGAGCACCGGCTTCAGGGTCATCAAGAAGAAGCTGTATTCCAGCGAGCAGCTGCTGATCGAGGAGTGT pWTY2412.12-Slc39a4-puro was selected as the original backbone plasmid, which was provided by the International Joint Laboratory for Recombinant Drug Protein Expression Systems in Henan Province. Its map is shown below. Figure 1 As shown. Sequence SEQ ID NO.1 was codon-optimized to obtain SEQ ID NO.2. Then, using seamless cloning technology, the original Slc39a4 fragment in the vector was deleted, and the codon-optimized sequence was inserted. DDIT4The coding sequence was successfully used to construct the recombinant overexpression plasmid pWTY2412.12-DDIT4-puro, which was synthesized by General Biotechnology (Anhui) Co., Ltd. The recombinant overexpression plasmid pWTY2412.12-DDIT4-puro contains a eukaryotic expression module, a eukaryotic selection marker module, and a prokaryotic amplification module. The eukaryotic expression module, along the transcriptional direction, sequentially connects: a CMV enhancer, a CMV promoter, a T7 promoter, and a codon optimization module. DDIT4 The recombinant overexpression plasmid pWTY2412.12-DDIT4-puro contains a 6×His tag sequence, a WPRE post-transcriptional enhancement sequence, and an SV40 poly(A) termination tailing signal for efficient expression of the His-tagged DDIT4 fusion protein in mammalian cells. The eukaryotic selection marker module, driven by the PGK promoter, expresses the puromycin resistance gene (PuroR) and is coupled downstream with an SV40 poly(A) signal for drug screening of stably transfected cells. The prokaryotic amplification module contains the ampicillin resistance gene (AmpR) and the origin of replication (ori) for plasmid amplification and screening in *E. coli*. A schematic diagram of the key elements of the recombinant overexpression plasmid pWTY2412.12-DDIT4-puro is shown below. Figure 2 As shown.

[0022] Example 2 Construction of a stable CHO-S parental cell line capable of stably expressing trastuzumab The expression vector used in this embodiment is pWTY240204LH-Tra. This vector carries the ampicillin resistance gene (AmpR) for screening prokaryotic cells such as bacteria; the eukaryotic selection marker is BSD (blast fungicide resistance gene), driven by the PGK promoter, for screening stable eukaryotic cell lines. The trastuzumab target gene expression is driven by the EF-1α promoter, with a WPRE element and an SV40 poly(A) tailing signal sequentially linked downstream; EF-1α intron A is also set to enhance transcription levels.

[0023] The trastuzumab coding sequence was inserted into the multiple cloning site of the vector to obtain the recombinant expression vector pWTY240204LH-Tra. The vector map is shown below. Figure 3 As shown. The recombinant vector was molecularly designed by the International Joint Laboratory for Recombinant Drug Protein Expression Systems in Henan Province, and the plasmid was synthesized by General Biotechnology (Anhui) Co., Ltd. The expression vector containing the trastuzumab gene was transfected into CHO-S cells (purchased from Gibco) via liposome transfection. Cell selection was performed under pressure using DMEM / F12 complete medium containing 15 μg / mL blastomycin to obtain a cell pool with stable integrated expression cassettes. Subsequently, the cell pool was subjected to monoclonal selection using limiting dilution to exclude untransfected negative cells, obtaining parental monoclonal cell lines capable of stably expressing trastuzumab.

[0024] In this invention, the CHO-S parental monoclonal cell line capable of constitutively secreting trastuzumab was selected as the host cell for subsequent experiments.

[0025] Example 3 DDIT4 Construction of stable recombinant CHO cell lines Monoclonal cells stably expressing trastuzumab were cultured in DMEM / F-12 complete medium supplemented with 10% heat-inactivated fetal bovine serum at 37°C in a humidified incubator with 5% CO2. Once the cells reached the logarithmic proliferation phase, they were cultured at a rate of 3.0 × 10⁻⁶ cells / year. 5 Seeds were introduced into 6-well plates at a density of cells / mL, and 2mL of complete culture medium was added. The plates were then cultured for 24 hours as usual until the cells reached approximately 80% confluence, which met the conditions for transfection.

[0026] A liposome-mediated transfection strategy was used to transfect the constructed pWTY2412.12-DDIT4-puro plasmid into host cells. The total amount of plasmid transfected per well was 4 μg. The plasmid and Lip2000 transfection reagent were diluted separately with serum-free basal medium and co-incubated to form a transfection complex. Successfully transfected cells were defined as the DDIT4 overexpression experimental group, while untransfected parental CHO-S cells served as the blank control group. Detailed transfection steps are as follows:

[0027] First, prepare the plasmid dilution buffer. Take a sterile 1.5 mL centrifuge tube, add 0.25 mL of serum-free DMEM / F12 basal medium, add 4 μg of recombinant plasmid, gently pipette to mix, and incubate at room temperature for 5 min. Prepare the transfection reagent working solution separately. Add 10 μL of Lip2000 reagent to an equal volume of basal medium, mix well, and incubate at room temperature for 5 min. Then, add the transfection reagent working solution dropwise to the plasmid dilution buffer, gently mix, and incubate at room temperature for 20 min to allow the liposome-plasmid complex to fully form. Before transfection, discard the original cell culture medium, wash the cells twice with sterile PBS, and replace with 1.5 mL of serum-free, antibiotic-free DMEM / F12 medium. Add the prepared transfection complex evenly to each well, gently shake the culture plate horizontally to distribute the system evenly, and incubate in an incubator for 6 h. After incubation, aspirate the transfection solution, replace with fresh complete culture medium, and continue culturing. Forty-eight hours after transfection, puromycin at a final concentration of 15 μg / mL was added for resistance selection under pressure, and this selection was continued for two weeks. Afterward, the puromycin concentration was reduced to 5 μg / mL for maintenance culture. Once cell growth returned to normal, the cells were passaged for amplification to obtain... DDIT4 Stable mixed cell pool.

[0028] The results are as follows Figure 4As shown, compared with CHO-S cells in the Control group, DDIT4 The expression level of DDIT4 protein in CHO cells was significantly increased in the overexpression experimental group.

[0029] Example 4 DDIT4 Effect of trastuzumab expression level detection 1. Transient transfection expression level detection Transiently transfect CHO-S cells capable of secreting trastuzumab with the pWTY2412.12-DDIT4-puro plasmid. After 48 h, all cells were collected, and viable cell counts were performed using 0.2% trypan blue staining. The cell density was adjusted to be no less than 5.0 × 10⁶ cells / year. 5 Cells / mL were inoculated into a culture system containing 3 mL of ExCell OptiVitro CE01 CHO serum-free medium and cultured in suspension for 7 days. After the expiration date, the culture supernatant was collected and the expression level of recombinant antibody was detected.

[0030] Figure 5 The results showed that DDIT4 Transient upregulation of expression significantly increased the secretion yield of trastuzumab in CHO-S cells, and compared with the gray value of the control group band as a reference, the relative expression level of recombinant protein increased by 3.25 times.

[0031] 2. Identification of recombinant protein expression in stable cell lines For those already built DDIT4 Stable CHO overexpressing cell pools were seeded into 6-well plates 48 h after transfection and cultured in suspension using 3 mL of ExCell OptiVitro CE01 serum-free medium for 7 consecutive days. Cell density and viability were monitored daily using a Countstar BioTech automated cell counter. On day 7, cell culture supernatant was collected by centrifugation, and equal volumes of supernatant samples were taken from each group. Western blot analysis was used to compare the control group with the control group. DDIT4 Differences in trastuzumab expression in the overexpression group.

[0032] like Figure 6 As shown, the results indicate that stable overexpression DDIT4 It can significantly enhance the synthesis and secretion capacity of recombinant trastuzumab in CHO-S cells, and compared with the gray value of the control group band as a reference, the relative expression level of recombinant protein increased by 4.51 times.

[0033] It should be noted that the above embodiments are only used to intuitively illustrate the technical solution of the present invention and do not constitute a limitation on the scope of protection of the present invention. Any conventional modifications, component substitutions, or other adjustments made by those skilled in the art based on the design concept of the present invention shall still fall within the scope of protection defined by the claims of the present invention.

Claims

1. A codon-optimized DDIT4 Genes, characterized by, The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

2. A recombinant expression vector, characterized in that, The recombinant expression vector contains the codon-optimized version of claim 1. DDIT4 Gene.

3. The recombinant expression vector according to claim 2, characterized in that, The recombinant expression vector uses pWTY2412.12-Slc39a4-puro as its backbone vector, and the recombinant expression vector contains pWTY2412.12-Slc39a4-puro. Slc39a4 The gene sequence was replaced with the one shown in SEQ ID NO.

2. DDIT4 Genes were obtained.

4. The recombinant expression vector according to claim 2 or 3, characterized in that, The recombinant expression vector is sequentially linked along the transcriptional direction with: a CMV enhancer, a CMV promoter, a T7 promoter, and a codon optimizer. DDIT4 Gene, 6×His tag sequence, WPRE post-transcriptional enhancement sequence and SV40 poly(A) termination tailing signal.

5. A recombinant CHO cell line, characterized in that, The recombinant CHO cell line comprises the recombinant expression vector of claim 2, and stably overexpresses the expression vector shown in SEQ ID NO.

2. DDIT4 Gene.

6. The recombinant CHO cell line according to claim 5, characterized in that, The recombinant CHO cell line was obtained by transfecting the recombinant expression vector into CHO cells and then screening with puromycin.

7. The recombinant CHO cell line according to claim 6, characterized in that, The CHO cells are CHO-S cells.

8. A claim 1 DDIT4 Application of genes in the preparation of recombinant expression vectors or recombinant host cells.

9. A device as claimed in claim 1 DDIT4 Application of genes in enhancing the expression of recombinant proteins in CHO cells.

10. The application according to claim 9, characterized in that, The recombinant protein is trastuzumab.

Images