A product, method and use for modulating lycopene content in persimmon fruit

Abstract

The present application belongs to the technical field of molecular biology, and provides a product, a method and a use for regulating lycopene content of persimmon fruits. Through comparative transcriptome analysis of red fruit variety 'Zhongshi No. 7' and yellow fruit variety 'Zhongshi No. 6', combined with WGCNA co-expression network, yeast one-hybrid screening library and persimmon fruit transient transformation technology, the present application identifies a key transcription factor DkMADS52 for regulating lycopene synthesis, and reveals that DkMADS52 positively regulates the expression of DkPSY1 by specifically binding to the DkPSY1 promoter, forming a DkMADS52-DkPSY1 module to promote lycopene synthesis and accumulation in persimmon fruits. The present application provides a key gene resource and a molecular breeding target for improving color and quality of persimmon fruits.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to a product, method, and use for regulating the lycopene content of persimmon fruit. Background Technology

[0002] Persimmon (Diospyros kaki Thunb.), native to East Asia, is an important woody food tree species in my country with a cultivation history of over 3,000 years. Persimmon fruit is rich in sugars, phenols, dietary fiber, and carotenoids, offering significant potential for comprehensive development. With rising consumer demand, fruit appearance and internal quality have become core factors determining market competitiveness. Fruit color is a crucial indicator of appearance quality, with significant differences in color among different persimmon varieties, among which red fruit is more favored by the market. Research shows that the higher the lycopene content in the persimmon peel, the redder the fruit. Lycopene also possesses strong antioxidant activity, offering nutritional and health benefits such as anti-cancer properties, cardiovascular disease prevention, and immune enhancement; its antioxidant capacity is approximately twice that of β-carotene and 100 times that of vitamin E. Therefore, elucidating the molecular regulatory mechanism of lycopene synthesis in persimmon fruit and identifying key regulatory factors is of significant theoretical and practical value for improving the efficiency of persimmon fruit color breeding and cultivating new varieties with high nutritional quality. It also contributes to the development of cultivation regulation techniques to enhance fruit color and nutritional value.

[0003] In the carotenoid biosynthesis pathway, phytoene synthase (PSY) is the rate-limiting enzyme, catalyzing the condensation of geraniol-geraniol pyrophosphate (GGPP) to form phytoene, which is the first irreversible key step in carotenoid biosynthesis. Overexpression of PSY genes from different sources can significantly promote carotenoid accumulation in plants. For example, overexpression of *Prunus cerasifera* (ChPSY), strawberry (FvPSY), and persimmon (DkPSY) can all promote increased carotenoid content in their respective plants, indicating that PSY genes play a central role in cross-species regulation of carotenoid metabolism. However, PSY gene expression is regulated by multiple transcription factors, and simple overexpression of the PSY gene may encounter metabolic bottlenecks or regulatory feedback inhibition. Therefore, identifying key upstream transcription factors is more important for precise regulation of lycopene synthesis.

[0004] At the transcriptional regulation level, multiple MADS-box transcription factors have been shown to directly regulate the expression of carotenoid synthesis genes, promoting lycopene production. The MADS-box gene family is an important family of transcription factors in plants, widely involved in plant growth and development, floral organ development, fruit ripening, and secondary metabolism regulation. For example, the tomato RIN (RipeningInhibitor) protein, as a MADS-box transcription factor, precisely coordinates lycopene metabolism by directly activating the expression of carotenoid synthesis genes such as PSY1, PSY2, ZISO, and CRTISO, while simultaneously inhibiting the expression of downstream cyclase genes LYCB and LYCE. It is a key regulator of tomato fruit ripening and color formation. Overexpression of CsMADS3 in citrus significantly increases the content of lycopene, xanthophyll, and lutein in callus tissue. Furthermore, apple MdMADS36 and banana MaMADS have also been reported to participate in color regulation during fruit ripening. These studies indicate that MADS-box transcription factors play a conserved and important role in the regulation of fruit carotenoid metabolism.

[0005] Chinese invention patent application CN111118026A discloses the application of the tomato LAT61 gene in regulating ethylene release and lycopene accumulation in fruit. This gene encodes a BES1 family transcription factor; overexpression promotes tomato fruit ripening and increases lycopene content, while RNAi-silenced lines show reduced lycopene content, indicating that this gene plays a positive regulatory role in fruit ripening and pigment accumulation.

[0006] Chinese invention patent application CN116200421A discloses the application of the tomato SlWRKY40 gene in regulating lycopene synthesis in tomato fruit. Overexpression of this gene can promote the accumulation of lycopene in tomato fruit, and the lycopene content at the red ripening stage is 28%-40% higher than that of wild type.

[0007] However, the aforementioned existing technologies all focus on the herbaceous model plant, tomato. As persimmons are perennial woody fruit trees, the transcriptional regulatory network of lycopene metabolism in them remains largely unknown. Persimmons and tomatoes belong to different families and genera in plant taxonomy; persimmons are woody plants belonging to the Ebenaceae family and the Solanaceae family, while tomatoes are herbaceous plants belonging to the Solanaceae family and the Solanum genus. They differ significantly in fruit development patterns, ripening mechanisms, genetic background, and genomic characteristics. Tomato fruits are berries, and their ripening process is accompanied by a significant respiratory climacteric and ethylene release peak. Persimmon fruits, on the other hand, are persimmons, and their ripening process is synergistically regulated by multiple hormones, including ethylene and abscisic acid, with significant differences in astringency removal characteristics among different varieties. Therefore, it is unclear whether regulatory factors in tomatoes (such as LAT61 and SlWRKY40) are applicable to persimmons, and thus, usable gene resources cannot be directly provided for improving the color of persimmon fruits.

[0008] Meanwhile, research on persimmon plants faces unique technical challenges. Persimmon is a perennial woody fruit tree with a long juvenile period (usually 3-5 years), a complex genetic background (mostly hexaploid), immature genetic transformation systems, and difficulties in tissue culture regeneration, leading to significant delays in gene function verification. Currently, no MADS-box transcription factors cloned and functionally verified from persimmon plants have been reported for regulating lycopene synthesis, and there is also a lack of rapid gene function verification systems suitable for persimmon fruits. Although a transient transformation system for persimmon fruits has been established, its transformation efficiency is low, reproducibility is poor, and browning of the pulp tissue is severe, requiring high levels of experimental technique. These technical bottlenecks restrict research on the molecular mechanisms of targeted improvement of persimmon fruit color and quality, as well as their application in breeding.

[0009] Therefore, identifying key lycopene regulatory factors unique to the genus *Persimmon*, elucidating their molecular regulatory mechanisms, and establishing gene function verification methods applicable to persimmon fruits are of great value in filling the research gap in the transcriptional regulation of carotenoids in persimmon fruits and developing technologies for improving persimmon fruit color. There is an urgent need in this field to systematically identify key transcription factors regulating lycopene synthesis and analyze their regulatory networks, starting from the *Persimmon* genus itself and utilizing techniques such as comparative transcriptomics, yeast one-hybrid analysis, and transient transformation, to provide excellent gene resources and effective technical targets for persimmon molecular breeding. Summary of the Invention

[0010] The first aspect of the present invention provides a product for regulating the lycopene content of persimmon fruit, said product comprising at least one of the following: (1) The nucleic acid molecule encoding DkMADS52; (2) DkMADS52 protein or its functional fragments; (3) Compounds that can upregulate the expression level of DkMADS52 or enhance its biological activity.

[0011] Specifically, the nucleic acid molecule encoding DkMADS52 has a nucleotide sequence as shown in SEQ ID NO.1, or a nucleotide sequence that has at least 90% sequence identity with it and can positively regulate the synthesis and accumulation of lycopene in persimmon fruit.

[0012] SEQ ID NO.1: ATGGGGAGAGGAAAGGTGCAGCTGAGGCGCATAGAGAACAAAATCAACAGGCAGGTGACCTTCTCCAAGAGGAGGGCTGGGCTGCTGAAGAAAGCTCATGAGATCTCCGTCTTGTGCGATGCAGAAGTGGCCTTAATTGTCTTCTCTCACAAAGGGAAGCTCTTCGAGTACTCCACCGATTCATGCATGGAAAAGATCCTAGAGCGATATGAAAGATACTCATATGCTGAAAGACAGTTGATTGCCGATCCACAAACCCCGGGAAACTGGTCCCTGGAGTGCACTAGACTAAGGTCTAAGATTGAGCTTCTACAGAGGAACCATAGGCACTATATGGGACATGATCTGGACTCCTTGACGCTGAAAGAGCTGCAAAATCTGGAGCAACAGCTTGACACTGCTCTCAAACACATTCGCTTCCAGAAAAGTAACACATCCACAAACCAACTCATGTACGAGTCCATCTCGGAGCTCCAGAAAAAGGAGAGGGCAATACAAGAGCAGAATAACATGCTGGCAAAGGAGATAAAGGAAAAGGAGAAGACACTTGCAGAGCACTCCCAGTGGCAGCAGCAGAACCAGGCTCCAAACCCATCTCCATTTCTCCTGCCTCAGCAGCTTCCCTGCCTTAACATTGGTGGAAGTTACCAAGGAGAGGAGCCAGCAAGGAGGAATGAGCTTGACCTGACTTTGGAGCCCTTATTTTCATGCAACCTTGGATGCTTTGCCGCATGA。

[0013] The term "nucleic acid molecule" can be in the form of RNA or DNA, including cDNA, genomic DNA, and synthetic DNA. Nucleic acid molecules can consist of naturally occurring nucleotides (e.g., deoxyribonucleotides and ribonucleotides), analogs of naturally occurring nucleotides (e.g., α-enantiomers of naturally occurring nucleotides), or combinations of both. Modified nucleotides can have modifications or substitutions in the sugar moiety or pyrimidine or purine base moiety. Nucleic acid monomers can be linked by phosphodiester bonds or analogs of such bonds. Analogs of phosphodiester bonds include thiophosphates, dithiophosphates, selenophosphates, diselenophosphates, aniline thiophosphates, aniline phosphates, aminophosphates, etc. Nucleic acid molecules can be double-stranded or single-stranded, and if single-stranded, can be either a coding strand or a non-coding strand (antisense strand). Coding molecules can have the same coding sequence as those known in the art, or can have different coding sequences, and may encode the same polypeptide due to redundancy or degeneracy of the genetic code, or through splicing.

[0014] The percentage of identity is a function of the number of common positions shared by the sequences (i.e., %identity = number of common positions / total number of positions × 100), taking into account the number of gaps and the length of each gap that needs to be introduced to optimize the alignment of two or more sequences. The comparison of sequences and the determination of the percentage of identity between two or more sequences can be accomplished using mathematical algorithms, such as the BLAST and Gapped BLAST programs at their default parameters (e.g., Altschul et al., J BiolChem., 2013, 6: 12 3-4).

[0015] More specifically, the product also includes an expression vector containing a nucleic acid molecule encoding DkMADS52 and a promoter driving its expression.

[0016] The term "expression vector" is a vector that, when present in a suitable environment, can direct the expression of one or more transgenic proteins carried by the vector.

[0017] Optionally, the expression vector is a eukaryotic expression vector or a prokaryotic expression vector; the eukaryotic expression vector includes: pGADT7, pFastBac, pEGFP-N1, pcDNA3.1 and pLVX; the prokaryotic expression vector includes: pET28a, pET32a, pGEX-4T, pMAL-p2x and pMAL-c2X.

[0018] More specifically, the product also includes recombinant bacteria containing a nucleic acid molecule encoding DkMADS52.

[0019] The term "recombinant" refers to an organism, microorganism, cell, nucleic acid molecule, or vector that has been modified by introducing a heterologous nucleic acid molecule, or to a cell or microorganism that has been genetically engineered through human intervention, i.e., by introducing a heterologous nucleic acid molecule, or to a microorganism whose expression of endogenous nucleic acid molecules or genes has been altered to the point that it is controlled, dysregulated, or constitutive, and such alterations or modifications can be introduced through genetic engineering.

[0020] Optionally, the recombinant bacteria include Agrobacterium and Escherichia coli.

[0021] Further optionally, the Agrobacterium includes GV3101 and psoupGV3101.

[0022] A second aspect of the present invention provides a method for regulating the lycopene content of persimmon fruit, wherein the method regulates the synthesis and accumulation of lycopene by regulating the expression level of the DkMADS52 gene.

[0023] Specifically, the method for regulating the expression level of the DkMADS52 gene includes: (a) Transient overexpression or stable expression of the exogenous DkMADS52 gene; (b) Administering compounds that can upregulate the expression level of DkMADS52 or enhance its biological activity.

[0024] Specifically, the DkMADS52 activates its transcription by specifically binding to the DkPSY1 promoter, which has the nucleotide sequence shown in SEQ ID NO.2, or a truncated or variant promoter that has at least 85% sequence identity with the DkMADS52 promoter and retains the binding activity of the DkMADS52 promoter.

[0025] SEQ ID NO.2:

[0026] The third aspect of the present invention provides the application of DkMADS52 protein and its regulator in regulating the expression of downstream target genes and thereby promoting the coloring process of persimmons with high lycopene content.

[0027] Compared with the prior art, the present invention has the following beneficial effects: 1. For the first time, the key MADS transcription factor DkMADS52, which regulates lycopene synthesis, was identified in persimmon plants, filling the gap in the study of carotenoid transcriptional regulation in persimmon fruit and providing an effective technical means for improving fruit quality. 2. It provides excellent target genes for molecular marker-assisted breeding and transgenic breeding, which helps to shorten the breeding cycle of persimmon fruit color and cultivate new varieties of red fruit with high nutritional quality. Attached Figure Description

[0028] Figure 1 The changes in peel color phenotypic pattern during the ripening process of ZS7 and ZS6 fruits.

[0029] Figure 2 The lycopene content was detected in Example 1. Indicates t-test P A significant difference of <0.05.

[0030] Figure 3 for Figure 1 The content of α-carotene detected in the sample, This indicates a two-way ANOVA test. P A significant difference of <0.05.

[0031] Figure 4 for Figure 1 The β-carotene content detected in the sample This indicates a two-way ANOVA test. P A significant difference of <0.05.

[0032] Figure 5 for Figure 1 The content of β-cryptoxanthin detected in the sample, This indicates a two-way ANOVA test. P A significant difference of <0.05.

[0033] Figure 6 for Figure 1 The content of zeaxanthin in the tested zeaxanthin This indicates a two-way ANOVA test. P A significant difference of <0.05.

[0034] Figure 7 PCA analysis of 11,935 DEGs.

[0035] Figure 8 Enrichment of KEGG pathways at different time periods.

[0036] Figure 9 A heatmap showing the expression of differentially expressed genes that are significantly enriched in carotenoid metabolism.

[0037] Figure 10 A heatmap showing the association between WGCNA-based ZS6 and ZS7 gene modules and lycopene content (red → blue: +1 to -1).

[0038] Figure 11 This study investigates the association between the MEbrown module based on WGCNA and upstream regulatory factors of DkPSY1.

[0039] Figure 12 Heatmap of expression levels of 47 overlapping genes.

[0040] Figure 13 To verify the expression levels of transcription factors in overlapping genes.

[0041] Figure 14 For DkMADS52 and DkPSY1 Validation of promoter-specific binding in yeast one-hybrid (Y1H) (empty AD is the negative control).

[0042] Figure 15 To verify the activation effect of DkMADS52 on the transcriptional activity of the DkPSY1 promoter in the dual-luciferase reporter gene assay for luciferase (LUC).

[0043] Figure 16 Phenotypes of empty vector and OE-DkMADS52 fruit (scale bar 1 cm).

[0044] Figure 17 The expression levels of the DkMADS52 and DkPSY1 genes are shown.

[0045] Figure 18 The content of α / β-carotene and lycopene in unloaded and OE-DkMADS52 fruits. Detailed Implementation

[0046] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0047] Example 1 Fruit pulp from ZS7 (Zhongshi No. 7, red fruit) and ZS6 (Zhongshi No. 6, yellow fruit) varieties at the green ripening stage (PA), color-changing stage (PB), and full ripening stage (PC) was collected. The samples were freeze-dried and then ground using a grinder (90 s, 40 hz). 50 mg of sample was precisely measured and 1.5 mL of extraction buffer (n-hexane:acetone:anhydrous ethanol = 1:1:1, containing 0.1% BHT) was added. The mixture was ultrasonically extracted for 30 min, followed by centrifugation. This extraction was repeated twice, and the supernatants were combined. 10 mL of extraction buffer (2 mL ether and 8 mL saturated NaCl solution) was added to the supernatant for further extraction. After centrifugation for 5 min, the organic phase was separated. The remaining aqueous phase was then extracted multiple times with 2 mL ether until the aqueous phase was essentially colorless. The combined organic phases were vacuum rotary evaporated to dryness, redissolved in a heavy solution (anhydrous ethanol: dichloromethane = 9:1), filtered through a 0.22 μm organic filter membrane, and introduced into a brown vial. The entire process was conducted in the dark.

[0048] The prepared samples were quantitatively analyzed by UPLC-MS. The contents of lycopene, α-carotene, β-carotene, β-cryptoxanthin, and zeaxanthin were detected by targeted metabolomics. The specific HPLC conditions were as follows: (1) Chromatographic column: C 18 Chromatographic column (150×2.1, 2.6 μm); (2) Mobile phase: Phase A: Methanol: Dichloromethane (97:3, V / V); Phase B: Water; (3) Flow rate: 0.4 mL / min; (4) Column temperature: 30 ℃; (5) Gradient elution conditions are shown in Table 1.

[0049] Table 1. Gradient elution conditions of the mobile phase

[0050] The specific mass spectrometry conditions were as follows: positive ion discharge current was 4.0 μA; auxiliary gas was set to 10Arb; and the temperatures of the ion transfer tube and vaporizer were 350℃ and 450℃, respectively.

[0051] Experimental results are as follows Figures 1-6 (Data are the mean ± standard deviation of three biological replicates) The results show that the lycopene content of ZS7 at full maturity was significantly higher than that of ZS6, and it showed an increasing trend with fruit ripening, while the lycopene content of ZS6 remained at a relatively low level at all stages.

[0052] Example 2 Differentially expressed genes (|log2FC|≥1, FDR<0.05) were screened; GO / KEGG functional enrichment analysis was performed using GOseq (corrected for transcript length bias) and clusterProfiler; WGCNA identified six co-expression modules significantly associated with lycopene content. The experimental results are as follows: Figure 7-10 As shown.

[0053] Example 3 1. Using ZS7 genomic DNA as a template, the DkPSY1 promoter fragment was amplified using primers DkPSY1pro-F (SEQ ID NO.3: 5'-GCGGCAGCCAAACTATTCC-3') and DkPSY1pro-R (SEQ ID NO.4: 5'-AATGCGAGTAGCAGAGAGGTG-3'). The purified DkPSY1 promoter fragment was cloned into the pHIS2 reporter vector and placed in... HIS3 Upstream of the reporter gene. The constructed bait vector (pHIS2- DkPSY1 After the pro was verified to be correct by sequencing, it was linearized using EcoRI and SacI restriction endonucleases, ready for use in yeast transformation.

[0054] 2. Construction and preparation of cDNA libraries Pulp tissue was collected from the ZS7 variety during its color-changing stage, and total RNA was extracted using Trizol reagent. After passing quality testing, a cDNA library was constructed using the Novizan R211-01 cDNA synthesis kit. The cDNA fragment was cloned into a pGADT7 prey vector, which carries... TRP1 Nutritional markers and GAL4 activation domain (AD).

[0055] 3. Primary screening of yeast libraries The linearized bait vector was transformed into yeast strain Y187 to obtain a yeast strain containing the reporter gene. Subsequently, the constructed cDNA library plasmid was co-transformed with Y187 competent cells containing the bait vector. The transformed mixture was plated on SD / -Trp-Leu double-silence plates and incubated at 28°C for 3-5 days to obtain single colonies.

[0056] To screen for specifically binding transcription factors, the grown colonies were photocopied or spotted onto SD / -Trp-Leu-His + 100 mM 3AT medium containing 3-amino-1,2,4-triazole (3AT, a competitive inhibitor of the HIS3 gene product) for initial screening. Positive clones that grew well on the defective medium were selected, plasmids were extracted and transformed into *E. coli* for amplification, and the inserted fragments were analyzed by PCR amplification and sequencing to identify potential transcription factor sequences.

[0057] Experimental results are as follows Figures 11-13 As shown, 47 overlapping genes exist. These genes are both co-expressed genes significantly associated with lycopene content and can directly bind to the DkPSY1 promoter. Expression verification of transcription factors among the overlapping genes revealed that the expression pattern of DkMADS52 in ZS7 is highly consistent with the lycopene accumulation trend, and it has been identified as a key candidate regulator of lycopene content.

[0058] 4. Verification of the interaction between transcription factors and promoters To verify the specific binding of candidate transcription factors (such as DkMADS52) to the DkPSY1 promoter, a one-to-one verification experiment was conducted. Using cDNA containing the DkMADS52 coding region as a template, PCR amplification was performed using primers AD-DkMADS52-F (SEQ ID NO.5: 5'-GCTCATATGGCCATGGAGGCCAGTGAATTCATGGGGAGAGGAAAGGTGCAGCTG-3') and AD-DkMADS52-R (SEQ ID NO.6: 5'-TTCATCTGCAGCTCGAGCTCGATGGATCCCTCATGCGGCAAAGCATCCAAGGTTGCA-3'). The DkMADS52 coding region sequence was cloned into the pGADT7 vector to construct the effector plasmid (DkMADS52-AD). The DkMADS52-AD effector plasmid and the pHIS2-DkPSY1pro bait plasmid were co-transformed into Y187 yeast competent cells. An empty vector (pGADT7+pHIS2-DkPSY1pro) was used as a negative control. The transformed yeast culture was serially diluted (10⁻⁶ oz). 0 10 -1 10 -2 10 -3Yeast cells were seeded onto SD / -Trp-Leu (growth control) and SD / -Trp-Leu-His + 75mM / 100mM 3AT selective medium, respectively. The cells were incubated upside down in a 28℃ incubator for 3-5 days, and the growth of yeast colonies was observed and recorded to assess the activation ability of transcription factors on reporter genes.

[0059] Experimental results are as follows Figure 14 As shown, no colony formation was observed in the negative control group on the selective medium containing 3-amino-1,2,4-triazole (3AT), while the DkMADS52-AD transformation group showed obvious colony growth, indicating that the DkMADS52 protein can specifically bind to the promoter region of the DkPSY1 gene and effectively activate the transcriptional expression of the downstream HIS3 reporter gene.

[0060] Example 4 I. Plasmid Construction Steps 1. Construction of effect plasmid (35S::DkMADS52) Using cDNA containing the DkMADS52 coding region as a template, PCR amplification was performed using primers pBinGFP2-DkMADS52-F (SEQ ID NO. 7: 5'-GGCATGGACGAGCTGTACAAGGGTACCATGGGGAGAGGAAAGGTGCAGCTG-3') and pBinGFP2-DkMADS52-R (SEQ ID NO. 8: 5'-GCGGACTCTAGTTCATCTAGAGGATCCTCATGCGGCAAAGCATCCAAGGTT-3'). The amplified product was then digested with pCAMBIA1300-35S using BamHI / SpeI double enzyme digestion. The target fragment was ligated into a linearized vector using Novizan C116 ligase and transformed into *E. coli* DH5α competent cells. After colony PCR identification and sequencing verification, endotoxin-free plasmids were extracted for later use.

[0061] 2. Construction of reporter plasmid (proDkPSY1::LUC) Using genomic DNA as a template, the DkPSY1 gene promoter sequence (approximately 2 kb) was amplified using primers pGreenII 0800-LUC-DkPSYpro-F (SEQ ID NO.9: 5'-CGACTCACTATAGGGCGAATTGGGTACCGGGCGGCAGCCAAACTATTCCGAGCA-3') and pGreenII 0800-LUC-DkPSYpro-R (SEQ ID NO.10: 5'-GTGGCGGCCGCTCTAGAACTAGTGGATCCCAATGCGAGTAGCAGAGAGGTGATA-3'). The amplified product was digested with the pGreenII 0800-LUC reporter vector using KpnI / BamHI double digestion. The promoter fragment was cloned into the multiple cloning site of the pGreenII 0800-LUC reporter vector using Novizan C116 ligase, replacing the original 35S promoter and driving the expression of the firefly luciferase (LUC) gene. Sequencing was used to verify the promoter orientation and sequence correctness.

[0062] II. Agrobacterium transformation and culture conditions 1. The constructed effect plasmid and reporter plasmid were transformed into Agrobacterium strain GV3101 (containing pSoup helper plasmid to maintain pGreen vector replication) using the freeze-thaw method, respectively. The specific steps are as follows: The constructed effect plasmid and reporter plasmid were transformed into Agrobacterium strain GV3101 (containing pSoup helper plasmid) using a freeze-thaw method. First, competent cells stored at -80℃ were partially thawed on ice. 1–2 μg of the target plasmid was added to 100 μL of cells, gently mixed, and incubated on ice for 5 min. Then, the centrifuge tubes were rapidly immersed in liquid nitrogen for 5 minutes, followed by heat shock in a 37℃ water bath for 5 minutes without shaking. After heat shock, the tubes were immediately returned to ice for 5 minutes. Next, 800 μL of antibiotic-free LB broth was added under aseptic conditions, and the cells were incubated at 28℃ and 200 rpm with shaking for 2–3 hours for recovery. Finally, the cells were harvested by centrifugation at 6000 rpm for 1 minute. Approximately 100 μL of supernatant was resuspended and evenly spread onto plates containing Kans antibiotic. The plates were incubated upside down in a 28℃ incubator for 2–3 days until single cells grew, at which point further identification was performed.

[0063] 2. Pick a single colony and inoculate it into YEB liquid medium containing kanamycin, and incubate overnight at 28°C and 200 rpm with shaking.

[0064] 3. The next day, transfer to fresh culture medium at a ratio of 1:50 and continue culturing until OD600≈0.8-1.0 (logarithmic growth phase).

[0065] 4. Centrifuge at 4000 rpm for 10 minutes to collect the bacterial cells and discard the supernatant.

[0066] III. Components of the Infiltration Buffer and Resuspension Infiltration buffer formulation: 10 mM MES (pH 5.6-5.7), 10 mM MgCl2, 150 μM Acetosyringone (AS).

[0067] Resuspend the bacterial pellet with staining buffer and adjust OD600 to 0.8-1.0.

[0068] Agrobacterium containing the effect plasmid and Agrobacterium containing the reporter plasmid were mixed at a volume ratio of 1:4 (effecton:reporter).

[0069] Incubate at room temperature in the dark for 3 hours to induce Vir gene expression and enhance T-DNA transfer efficiency.

[0070] IV. Tobacco Impregnation and Cultivation Select healthy leaves from Nicotiana benthamiana that have grown for 4-6 weeks.

[0071] Use a needleless syringe to draw up the mixed bacterial solution and slowly inject it under pressure from the back of the leaf (lower epidermis) until the infected area appears water-stained.

[0072] Mark the infected leaves, then return the plants to the greenhouse and incubate them at 24℃ / 22℃ (day / night) with 16 hours of light for 3 days (72 hours).

[0073] V. Detection of luciferase activity and calculation of activation efficiency 1. Protein extraction: Take equal-area leaf discs that have been soaked in the solution, and grind them into powder using liquid nitrogen.

[0074] Add firefly luciferase reporter gene cell lysis buffer (Beyotime, RG126M), vortex to mix, centrifuge and collect the supernatant.

[0075] 2. Activity assay: Use a dual-luciferase reporter gene assay kit (Beyotime, RG126M, RG005).

[0076] Take 20 μL of supernatant, add firefly luciferase substrate (LARII), and measure the luminescence value (LUC).

[0077] Add Stop & Glo reagent to quench the firefly signal and initiate the Renal luciferase reaction, and measure the luminescence value (REN).

[0078] 3. Calculation formula: Relative transcription activation efficiency = LUC fluorescence value / REN fluorescence value The final result is usually expressed as a "relative activation multiple" (Fold Change): Activation factor = (LUC / REN) experimental group / (LUC / REN) control group (empty vector control).

[0079] like Figure 15 As shown, compared with the empty vector control group, the LUC / REN ratio was significantly increased in the experimental group co-transformed with 35S::DkMADS52 effector plasmid and proDkPSY1::LUC reporter plasmid, indicating that DkMADS52 can enhance the expression of luciferase reporter gene driven by DkPSY1 promoter, and verifying the transcriptional activation effect of DkMADS52 on DkPSY1 promoter in plant cells.

[0080] Example 5 Since persimmon fruits turn brown after being injected with Agrobacterium-expressing bacterial solution, affecting the observation of fruit color and the determination of carotenoids, this study used the Rongli Mo method to perform disc transformation of persimmon fruits.

[0081] First, prepare the infection solution: Activate the Agrobacterium tumefaciens overexpression vector DkMADS52-CAM-EGFP and the empty CAM-EGFP vector in advance, shake, resuspend until the OD600 is 0.6-0.8, and let stand at room temperature for 2 hours. Next, prepare the fruit discs for infection: Wash the persimmon fruits thoroughly with distilled water, then soak them in a 1% sodium hypochlorite solution for 10 minutes, and wash them four times with sterile water. Cut the middle portion of the fruit pulp (removing the top and stem, avoiding the core) into 0.2 cm discs, and then punch holes in them using a 1 cm diameter punch. Finally, perform the infection and culture: Place the prepared persimmon fruit discs in 50 mL of the infection solution, seal, and incubate at 28℃ on a shaker at 100 rpm for approximately 30 minutes. After infection, spread the fruit discs (using filter paper to absorb excess bacterial solution) evenly on 1 / 2 MS medium and incubate at room temperature for 2 days. The fruit discs after being soaked were flash-frozen with liquid nitrogen and stored at -80°C.

[0082] Quantitative fluorescence primers for functional genes are listed in the appendix; quantitative fluorescence primers for transcription factors were designed using NCBI tools. Using empty vectors and transient overexpression of persimmon fruit disc cDNA as templates, the system was prepared according to the SYBR MIX reagent instructions and amplified using a quantitative fluorescence PCR instrument (Bio-Rad CFX96). Each analysis included three biological replicates. Relative quantification of gene expression was calculated based on the cycle threshold (Ct) using 2... ( ΔΔCt)The expression levels of DkPSY1 and DkMADS52 were detected using GAPDH as the reference gene and primer sequences are shown in Table 2. The method for detecting carotenoid components was the same as in Example 1.

[0083] Table 2 Primer Sequences for Quantitative Real-Time PCR

[0084] like Figure 16-18 As shown, transient overexpression in persimmon fruit DkMADS52 The expression level of DkMADS52 was 2.24 times that of the empty control, and the expression level of DkPSY1 was 6.7 times that of the empty control. To further verify the effect of DkMADS52 overexpression on the content of major carotenoid components, we used UPLC-MS to quantitatively analyze the contents of α-carotene, β-carotene, β-cryptoxanthin, trans-hydrophytopenic acid, zeaxanthin, and lycopene in transiently overexpressed DkMADS52 and empty control. The results showed that α-carotene, β-carotene, β-cryptoxanthin, trans-hydrophytopenic acid, zeaxanthin, and lycopene were significantly higher than those in the empty control, and the lycopene content showed the largest fold change.

[0085] The above description represents the preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A product for regulating the lycopene content of persimmon fruit, characterized in that, The product includes at least one of the following: (1) The nucleic acid molecule encoding DkMADS52; (2) DkMADS52 protein or its functional fragments; (3) Compounds that can upregulate the expression level of DkMADS52 or enhance its biological activity.

2. The product according to claim 1, characterized in that, The nucleic acid molecule encoding DkMADS52 has a nucleotide sequence as shown in SEQ ID NO.1, or a nucleotide sequence that has at least 90% sequence identity with it and can positively regulate the synthesis and accumulation of lycopene in persimmon fruit.

3. The product according to claim 2, characterized in that, The product also includes an expression vector containing a nucleic acid molecule encoding DkMADS52 and a promoter that drives its expression.

4. The product according to claim 3, characterized in that, The expression vector is a eukaryotic expression vector or a prokaryotic expression vector; the eukaryotic expression vector includes: pGADT7, pFastBac, pEGFP-N1, pcDNA3.1 and pLVX; the prokaryotic expression vector includes: pET28a, pET32a, pGEX-4T, pMAL-p2x and pMAL-c2X.

5. The product according to claim 2, characterized in that, The product also includes recombinant bacteria containing a nucleic acid molecule encoding DkMADS52.

6. The product according to claim 5, characterized in that, The recombinant bacteria include Agrobacterium and Escherichia coli.

7. The product according to claim 6, characterized in that, The Agrobacterium species include GV3101 and psoupGV3101.

8. A method for regulating the lycopene content of persimmon fruit, characterized in that, The method regulates the synthesis and accumulation of lycopene by modulating the expression level of the DkMADS52 gene.

9. The method according to claim 8, characterized in that, The method for regulating the expression level of the DkMADS52 gene includes: (a) Transient overexpression or stable expression of the exogenous DkMADS52 gene; (b) Administering compounds that can upregulate the expression level of DkMADS52 or enhance its biological activity.

10. Application of DkMADS52 and its regulators in the preparation of products that promote the formation of high-lycopene persimmon red fruit.

Images