A novel potassium ion transporter gene and application thereof in promoting potassium ion absorption of citrus plants

Abstract

The application discloses a novel potassium ion transporter gene and application thereof in promoting potassium ion absorption of citrus plants, and relates to the technical field of biotechnology.The nucleotide sequence of the coding region of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2. PtPIT The overexpression of the gene in a citrus common rootstock trifoliate orange directly proves that the gene can significantly increase the potassium ion content in roots and leaves, and the significant performance is achieved under normal potassium and low potassium conditions, and direct functional evidence in the citrus system is provided.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a novel potassium ion transporter gene and its application in promoting potassium ion absorption in citrus plants. Background Technology

[0002] Potassium is an essential macronutrient for plant growth and development, playing an irreplaceable role in maintaining cell osmotic potential, regulating stomatal movement, activating intracellular enzyme activity, promoting the transport of photosynthetic products, and enhancing plant stress resistance. Citrus, as a globally important economic fruit tree, has its yield and fruit quality closely related to potassium nutrition status. Insufficient potassium supply leads to stunted growth, yellowing and scorching of leaves, smaller fruits, increased acidity, and a significant decline in quality, potentially causing yield reduction and tree vigor decline. Therefore, in-depth analysis of the molecular mechanisms of potassium ion absorption in citrus and the discovery and utilization of key gene resources that promote potassium ion absorption are of great significance for breeding potassium-efficient citrus rootstock varieties, improving potassium fertilizer utilization efficiency, and reducing production costs.

[0003] Plant root absorption and distribution of potassium ions primarily rely on potassium channel proteins and transport proteins on the cell membrane. Currently identified plant potassium channel proteins mainly include the Shaker family of voltage-gated potassium channels and the TPK family of potassium channels; identified plant potassium transport proteins mainly include the KT / HAK / KUP, HKT, KEA, and CHX families. Among them, the KT / HAK / KUP family is the largest potassium transport protein family in plants, mediating the uptake of high-affinity potassium ions under low potassium stress conditions. In the model plant Arabidopsis thaliana (… Arabidopsis thaliana )middle, AtHAK5 Members have been shown to play a key role in the low potassium response.

[0004] In recent years, research on potassium ion transporters in citrus plants has made some progress. For example, sweet orange ( Citrus sinensis ) CsKT1 Belongs to the Shaker family of potassium ion channels, and is associated with Arabidopsis thaliana. AtAKT1 Highest homology; trifoliate orange PtKUP10 The function was verified by heterologous expression in Arabidopsis. However, the existing technology still has the following obvious shortcomings: (1) The known types of citrus potassium transporter proteins and channel proteins are limited, and the functional verification is mostly limited to heterologous systems (such as yeast, Arabidopsis, etc.), lacking direct functional evidence in the commonly used citrus rootstock, trifoliate orange; (2) The potassium transporter proteins and channel proteins identified so far are all homologs of the above-mentioned known family members, and there are no reports of new potassium transporter proteins that are evolutionarily independent of the known families and have a completely new spatial conformation; (3) Gene resources that can be directly applied to trifoliate orange rootstock and clearly improve the potassium content of roots and leaves are still scarce.

[0005] Therefore, this invention aims to discover transport protein genes with novel structures and significant potassium ion absorption functions in plants. This has important scientific significance and application value for filling the gaps in existing technologies and enriching the gene resources for improving potassium nutrition molecules in citrus plants. Summary of the Invention

[0006] The purpose of this invention is to provide a novel potassium ion transporter gene and its application in promoting potassium ion absorption in citrus plants, thereby addressing the problems existing in the prior art. This invention has found that overexpression of the gene encoding this potassium ion transporter protein can effectively promote potassium ion absorption in citrus plants.

[0007] To achieve the above objectives, the present invention provides the following solution: This invention provides a gene encoding a potassium ion transporter, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] The present invention also provides a potassium ion transporter protein, the amino acid sequence of which is shown in SEQ ID NO.2.

[0009] The present invention also provides a gene expression cassette, comprising the above-described encoding gene.

[0010] The present invention also provides a recombinant expression vector comprising the gene expression cassette described above.

[0011] The present invention also provides a recombinant host cell comprising the above-described recombinant expression vector.

[0012] Furthermore, the recombinant host cell is recombinant Agrobacterium.

[0013] The present invention also provides the application of the above-mentioned encoding gene in promoting potassium ion absorption in citrus plants.

[0014] The present invention also provides the application of the above-mentioned gene expression cassette, recombinant expression vector or recombinant host cell in promoting potassium ion absorption in citrus plants.

[0015] The present invention also provides a method for promoting potassium ion absorption in citrus plants, comprising the step of transferring the above-mentioned coding gene into citrus plants to construct transgenic plants that overexpress the coding gene.

[0016] Furthermore, the coding gene was transferred into citrus plants using Agrobacterium-mediated transformation.

[0017] The present invention discloses the following technical effects: This invention provides a novel potassium ion transporter gene resource— PtPIT Gene.

[0018] This invention directly verified the potassium ion transport function in a yeast system. Through the yeast potassium ion absorption defect mutant filler-up experiment, it directly confirmed that PtPIT has potassium ion transport ability, providing the most direct functional evidence.

[0019] This invention has also verified its application effect on the citrus rootstock trifoliate orange, achieving [its effectiveness] on the commonly used citrus rootstock trifoliate orange. PtPIT Overexpression of the gene directly confirmed that it can significantly increase the potassium ion content in roots and leaves, showing significant effects under both normal and low potassium conditions, providing direct functional evidence in the citrus system.

[0020] While PtPIT is phylogenetically classified as a potassium ion transporter, it has formed an independent branch, exhibiting significant differences in its amino acid sequence compared to previously reported potassium channel proteins and transporters. Using AlphaFold3 to predict its three-dimensional structure, the root mean square deviation (RMSD) of PtPIT from nine known major types of potassium channel proteins and transporters (AtAKT1, AtKAT1, AtSKOR, AtTPK4, AtHAK5, AtKUP7, AtHKT1, AtKEA3, and AtCHX14) ranges from 12.7 to 28.4 Å, significantly exceeding the 2–5 Å similarity folding threshold, demonstrating a novel spatial conformation.

[0021] The present invention provides PtPIT Gene and transgenic technologies can be directly applied to cultivate new citrus rootstock varieties with high potassium absorption efficiency, reducing potassium fertilizer application and lowering production costs. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 Figure showing the results of the fill-in experiment for yeast potassium ion absorption defect mutant; Figure 2 Wild type (WT) of trifoliate orange and PtPIT In the roots (A) and leaves (B) of overexpressing plants (OX) PtPIT Figure showing the results of qRT-PCR detection of gene expression levels; Figure 3 Wild type (WT) of trifoliate orange and PtPIT The results of potassium ion content detection in the roots (A) and leaves (B) of overexpressing plants (OX); Figure 4 Phylogenetic tree of PtPIT with 61 known potassium ion channel proteins and transporters; Figure 5 This is a comparison diagram of the three-dimensional structures of PtPIT with those of nine known potassium ion channel proteins and transport proteins. Detailed Implementation

[0024] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0025] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0026] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0027] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0028] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0029] The present invention relates to PtPIT The nucleotide sequence of the coding region of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO.2.

[0030] SEQ ID NO.1:

[0031] SEQ ID NO.2: *

[0032] Example 1 PtPIT Cloning of genes 1. Plant materials Citrus aurantium seedlings were used as the material. The plant material was grown in a growth chamber with a light cycle of 16 hours of light / 8 hours of darkness, a temperature of 25℃, and a relative humidity of 65%.

[0033] 2. Total RNA extraction and cDNA synthesis Young roots of the above-mentioned *Citrus aurantium* were collected, and total RNA was extracted using the TRIzol method. The concentration and integrity of RNA were detected by spectrophotometry and 1% agarose gel electrophoresis. 1 μg of total RNA was used to synthesize cDNA using a reverse transcription kit (Vazyme).

[0034] 3. PtPIT Cloning of genes According to the Citrus Genome Database PtPIT Based on the nucleotide sequence of the gene reference coding region, specific primers were designed as follows: Upstream primer PtPIT-F: ATGGCAGCGGCGGC (SEQ ID NO.3); Downstream primer PtPIT-R: TCAGCAGTTTCTTCGTGAGCATG (SEQ ID NO.4).

[0035] Using cDNA obtained from reverse transcription as a template, PCR amplification was performed using high-fidelity DNA polymerase (Vazyme). The PCR reaction conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 sec, 56℃ annealing for 15 sec, 72℃ extension for 2 min, for a total of 35 cycles; and a final extension at 72℃ for 5 min. The PCR products were separated by 1% agarose gel electrophoresis, and the target fragment (approximately 1647 bp) was recovered and purified.

[0036] 4. Construction of recombinant vectors The target fragment was ligated into the TOPO vector (purchased from Shanghai Weidi Biotechnology Co., Ltd.), transformed into E. coli F-DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), and positive clones were screened for sequencing verification. After successful sequencing verification, the obtained recombinant vector was named PtPIT-TOPO.

[0037] Example 2 Complementation Experiment of Yeast Potassium Ion Absorption Defect Mutant 1. Construction of yeast transformation vector Design will PtPIT The primers used to construct the coding region sequence of the gene into the yeast expression vector p416 are as follows: Upstream primer PtPIT-p416-F: TAGTTTCGACGGATTCTAGAATGGCAGCGGCGGC (SEQ ID NO.5); Downstream primer PtPIT-p416-R: TTACATGACTCGAGGTCGACTCAAGCAGTTTCTTCGTGAGCATG (SEQ ID NO.6).

[0038] Using PtPIT-TOPO as a template, PtPIT-p416-F / R was amplified by PCR. The amplified product was ligated into the p416 vector via homologous recombination, transformed into E. coli F-DH5α competent cells, and positive clones were screened for sequencing verification. After successful sequencing verification, the obtained recombinant yeast expression vector was named PtPIT-p416.

[0039] 2. Yeast Transformation Experiment To directly verify whether PtPIT possesses potassium ion transport function, a heterologous functional recovery experiment was conducted using the yeast potassium ion absorption-deficient mutant strain R5421 (purchased from Shanghai Weidi Biotechnology Co., Ltd.). This mutant strain, lacking the endogenous high-affinity potassium ion transport proteins TRK1 and TRK2, could not grow normally on low-potassium medium.

[0040] Will PtPIT The coding region nucleotide sequence was cloned into the yeast expression vector p416 to obtain the recombinant vector PtPIT-p416, which was verified to be correct by sequencing. Empty vector p416 was used as a negative control, and the Arabidopsis potassium ion channel AtAKT1 was used as a positive control. The recombinant vector PtPIT-p416 was transformed into yeast strain R5421 competent cells, and transformants were screened on SD-Ura-deficient medium. Single colonies of each transformant were picked and the OD was adjusted with sterile water. 600 The concentration was increased to 1.0, and then serially diluted 10-fold. 5 μL of each gradient bacterial solution was inoculated onto culture media containing different potassium ion concentrations (10 mM, 5 mM, 1 mM, 0.5 mM KCl) and cultured at 28℃ for 5 days. The growth status of each strain was then observed.

[0041] The results are as follows Figure 1 As shown, all transformants grew normally under 10 mM and 5 mM potassium ion conditions, indicating that normal potassium ion concentration can compensate for the potassium ion uptake defect in mutants. Under low potassium ion conditions of 1 mM and 0.5 mM, the negative control strain carrying the empty vector p416 could not grow normally, while the strain expressing PtPIT could significantly recover its growth ability on low potassium medium, and its growth was comparable to that of the positive control strain expressing AtAKT1. This result directly proves that the PtPIT protein has potassium ion transport activity and can compensate for the functional loss in yeast potassium ion uptake defect mutants.

[0042] Example 3 PtPIT Overexpression experiment in trifoliate orange 1. Construction of overexpression vector for trifoliate orange Design will PtPITThe primers used to construct the nucleotide sequence of the gene's coding region into the plant overexpression vector PAGM243-Kg2E-35SA-FLAG (published in the following literature: Chen S, Fan Z, Peng J, et al. The PtARF6 / PtARF8-PtGH3.1 transcriptional module regulates auxin homeostasis and dwarfism incitrus[J]. Plant Physiology, 2026: kiag561.) are as follows: Upstream primer PtPIT-35SA-F: TGTGGTCTCAAATGGCAGCGGCGGC (SEQ ID NO.7); Downstream primer PtPIT-35SA-R: TGTGGTCTCACGAACCAGCAGTTTCTTCGTGAGCATG (SEQ ID NO.8).

[0043] Using PtPIT-TOPO as a template, PCR amplification was performed using primers PtPIT-35SA-F / R. The amplified product was ligated into the PAGM243-Kg2E-35SA-FLAG vector via a Golden Gate reaction, transformed into E. coli F-DH5α competent cells, and positive clones were screened for sequencing verification. After successful sequencing verification, the obtained recombinant plant expression vector was named p35S::PtPIT. This vector contains a CaMV 35S constitutive promoter and a GFP fluorescent selection marker.

[0044] 2. Agrobacterium-mediated transformation The recombinant plant expression vector p35S::PtPIT was transformed into Agrobacterium tumefaciens (…). Agrobacterium tumefaciens Positive monoclonal strains of strain EHA105 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) were selected by spectinomycin resistance plate screening and used for subsequent genetic transformation of trifoliate orange.

[0045] 3. Agrobacterium-mediated genetic transformation of epicotyl in trifoliate orange Take the orange ( Citrus sinensis 'Washington' sweet orange × Poncirus trifoliataSeeds were soaked in 1 M NaOH for 15 min to remove pectin, sterilized with 2% sodium hypochlorite for 20 min, and rinsed three times with sterile water. The seed coat was then removed, and the embryos were inoculated onto MT solid medium and cultured in the dark at 25°C for 40 days, followed by 8 days of light culture for later use. The constructed Agrobacterium strain EHA105 carrying the recombinant expression vector p35S::PtPIT was streaked onto LB medium containing 50 mg / L kanamycin and 25 mg / L rifampin for activation. After dark culture at 28°C for 3 days, activated single colonies were picked and inoculated into LM liquid medium, and the OD was adjusted. 600 A concentration of 0.8-1.0 was used as the infection solution. After light culture, trifoliate orange seedlings were harvested, roots and growing points were removed, and the epicotyls were cut into stem segments approximately 1 cm long. These segments were immersed in the infection solution and shaken for 5 min, then allowed to stand for 20 min. After removal, the stem segments were placed on sterile filter paper to dry the surface bacterial solution, and then spread evenly on CM co-culture medium. The segments were incubated in the dark at 20℃ for 3 days. After the incubation period, the stem segments were washed twice with sterile water, dried, and transferred to resistant SY selection medium. The segments were then cultured under light at 28℃, subcultured every 2-3 weeks to induce the production of resistant adventitious buds (approximately 1-2 months). The resistant adventitious buds were cut off and transferred to SEM elongation medium. After approximately one month, the buds were transferred to RIM rooting medium to induce rooting, obtaining independent transgenic lines.

[0046] 4. Molecular identification of overexpressing plants (qRT-PCR) Total RNA was extracted from roots and leaves of wild-type (WT) and overexpression (OX) plants, and reverse transcribed into cDNA. (The text then abruptly shifts to a seemingly unrelated topic: "using trifoliate orange...") PtActin Genes were used as internal controls for detection via qRT-PCR. PtPIT Gene expression levels. Results are as follows: Figure 2 As shown, compared with the wild type, the roots and leaves of overexpressing plants showed increased activity. PtPIT The expression levels of both genes were significantly upregulated, indicating that the exogenous gene had been successfully integrated and transcribed efficiently.

[0047] 5. Determination of potassium ion content in roots and leaves of overexpressing plants Wild-type (WT) and overexpression (OX) plants were cultured in sand and irrigated with Hoagland's nutrient solutions containing normal potassium (5 mM) and low potassium (0.5 mM), respectively. Root and leaf samples were collected after 6 weeks. The samples were blanched at 120℃ for 15 min, dried at 65℃ to constant weight, and ground into powder. Approximately 0.05 g of each sample was weighed and digested using a digestion method. The potassium ion concentration in the digestion solution was determined using inductively coupled plasma optical emission spectrometry (ICP-OES), and the potassium ion content (mg / kg dry weight) was calculated. Results are as follows: Figure 3 As shown, the potassium ion content in the roots and leaves of the overexpressing plants was significantly higher than that in the wild type, indicating that overexpression... PtPITIt can significantly promote the absorption of potassium ions by trifoliate oranges.

[0048] Example 4: Systemic Evolution and Three-Dimensional Structure Analysis of PtPIT 1. System Evolution Analysis Using the MAFFT online database and employing the neighbor-joining method, the amino acid sequence of PtPIT was compared with 61 potassium ion channel proteins and transporter proteins from different species downloaded from the NCBI / Phytozome database. A phylogenetic tree was then constructed on the iTOL online database. The results are as follows: Figure 4 As shown, PtPIT belongs to the potassium ion transporter subgroup, but forms an independent branch, indicating its evolutionary uniqueness.

[0049] 2. Three-dimensional structure prediction and comparison The three-dimensional structures of PtPIT and nine representative potassium channel proteins and transporters (AtAKT1, AtKAT1, AtSKOR, AtTPK4, AtHAK5, AtKUP7, AtHKT1, AtKEA3, and AtCHX14) were predicted using AlphaFold3. The pairwise root mean square deviation (RMSD) between PtPIT and each representative structure was calculated using PyMOL's structure alignment algorithm. The results are as follows: Figure 5 As shown, the RMSD values ​​range from 12.7 to 28.4 Å, which is much higher than the similarity folding threshold of 2–5 Å, indicating that the three-dimensional structure of PtPIT is different from any known potassium channel protein or transporter.

[0050] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A gene encoding a potassium ion transporter, characterized in that, The nucleotide sequence of the encoding gene is shown in SEQ ID NO.

1.

2. A potassium ion transporter protein, characterized in that, Its amino acid sequence is shown in SEQ ID NO.

2.

3. A gene expression cassette, characterized in that, Includes the coding gene as described in claim 1.

4. A recombinant expression vector, characterized in that, Includes the gene expression cassette as described in claim 3.

5. A recombinant host cell, characterized in that, Includes the recombinant expression vector as described in claim 4.

6. The recombinant host cell according to claim 5, characterized in that, The recombinant host cell is recombinant Agrobacterium.

7. The application of the gene encoding as described in claim 1 in promoting potassium ion absorption in citrus plants.

8. The use of a gene expression cassette as described in claim 3, a recombinant expression vector as described in claim 4, or a recombinant host cell as described in claim 5 or 6 in promoting potassium ion absorption in citrus plants.

9. A method for promoting potassium ion absorption in citrus plants, characterized in that, The method includes the step of transferring the coding gene as described in claim 1 into a citrus plant to construct a transgenic plant that overexpresses the coding gene.

10. The method according to claim 9, characterized in that, The encoding gene was transferred into citrus plants using Agrobacterium-mediated transformation.

Images