A high-efficiency lanthanum ion adsorbing surface-displayed neurospora crassa and application thereof

Abstract

The application discloses a surface-displayed Neurospora crassa capable of efficiently adsorbing lanthanum ions and application thereof. 3+ The application firstly constructs a surface display verification system of an anchor protein and green fluorescent protein (eGFP), integrates the anchor protein and the eGFP gene into the Neurospora crassa genome, and verifies that the eGFP is successfully displayed on the surface of the bacteria. 3+ Then, the eGFP gene sequence is replaced by a metal binding protein sequence and integrated into the genome to obtain the engineering bacteria displaying the metal binding protein on the surface. The anchor protein anchors and expresses the metal binding protein on the cell surface, improves the selectivity and adsorption of the Neurospora crassa to La 3+ Compared with the wild-type strain, the adsorption capacity of the engineering bacteria to La is increased by 2.62 times.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and rare earth element adsorption and recycling technology, and in particular to a surface-displaying Neurospora rhabdominis bacterium that efficiently adsorbs lanthanum ions and its applications. Background Technology

[0002] Rare earth elements are known as "industrial vitamins" and are widely used in defense, aerospace, special materials, metallurgy, energy and agriculture.

[0005] In recent years, many researchers at home and abroad have taken advantage of the large specific surface area and abundant functional groups on the cell surface of microorganisms, which enable them to adsorb and recover metal ions in solution, and applied microorganisms to the adsorption and recovery of various metal ions.

[0006] However, microorganisms have low adsorption capacity and lack selectivity for rare earth ions, so there are few reports on the recovery of rare earth ions through microbial technology.

[0007] To enhance the adsorption capacity of microorganisms for rare earth ions, genetic engineering techniques are typically used to introduce protein genes with specific binding functions to rare earth ions into microorganisms for expression, thereby improving the selectivity and adsorption capacity of microorganisms for rare earth ions. Chinese Patent 201711439270.2 discloses a surface-displaying metal-binding protein gene and its application in the recovery of platinum and palladium metals. It obtains recombinant engineered bacteria by introducing a metal-binding protein into an Escherichia coli receptor, thereby improving the adsorption capacity of E. coli for platinum group metals. However, when using single-celled microorganisms to recover metal ions, subsequent solid-liquid separation by methods such as centrifugation or filtration is still unavoidable, which increases the difficulty and cost of industrial application of biological methods.

[0008] Therefore, in order to solve the above-mentioned technical problems, developing an easily separable multicellular microorganism (Neurospora crassa) surface display system and improving the adsorption potential of microorganisms for rare earth ions is a technical problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0009] In view of this, the present invention provides a highly efficient recombinant Neurospora crassa with surface display for adsorbing lanthanum ions and its application. The present invention links the anchoring protein (Mp1) gene and the green fluorescent protein (eGFP) gene together using the expression vector PV2 to obtain the recombinant plasmid Mp1-eGFP. A large number of surface display elements are obtained by PCR amplification, and then the surface display elements are introduced into the Neurospora crassa genome by electroporation. Fluorescence observation confirms successful expression of the Mp1 gene on the bacterial surface. Secondly, the anchoring protein (Mp1) gene and the metal-binding protein (MT) gene are linked together using the expression vector PV2 to obtain the recombinant plasmid Mp1-MT. A large number of surface display elements are obtained by PCR amplification, and then the surface display elements are introduced into the Neurospora crassa genome by electroporation to obtain an engineered bacterium displaying the metal-binding protein on its surface.

[0010] To solve the above-mentioned technical problems, the present invention adopts the following technical solution: An anchoring protein gene expressed on the surface of bacteria, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0011] Nine metal-binding protein genes for surface display have nucleotide sequences shown in SEQ ID NO.2 to SEQ ID NO.10, respectively.

[0012] Ten recombinant expression plasmids, namely Mp1-eGFP, Mp1-MT1, Mp1-MT2, Mp1-MT3, Mp1-MT4, Mp1-MT5, Mp1-MT6, Mp1-MT7, Mp1-REE and Mp1-2xdREE, contain the nucleotide sequence of the anchoring protein gene and the corresponding nucleotide sequence of the surface-displaying metal-binding protein gene.

[0013] A method for preparing a recombinant genetically engineered bacterium containing genes for anchoring proteins and surface metal-binding proteins includes the following steps: 1) Artificially synthesized the anchoring protein gene shown in SEQ ID NO.1 and the metal-binding protein genes shown in SEQ ID NO.2 to SEQ ID NO.10; 2) The anchoring protein gene synthesized in step 1) is linked to the eGFP gene in the PV2 expression vector to construct the recombinant expression plasmid Mp1-eGFP; 3) The surface display element of the recombinant plasmid in step 2) was introduced into the genome of Neurospora crassa. After observing with a confocal microscope, it was confirmed that the anchoring protein successfully anchored and expressed the green fluorescent protein on the cell surface, and a successful surface display engineered bacterium was obtained. 4) The anchoring protein gene and the nine metal-binding protein genes synthesized in step 1) were respectively linked into the PV2 expression vector to construct recombinant expression plasmids Mp1-MT1, Mp1-MT2, Mp1-MT3, Mp1-MT4, Mp1-MT5, Mp1-MT6, Mp1-MT7, Mp1-REE, and Mp1-2xdREE; 5) The surface display elements of the nine recombinant plasmids from step 4) were introduced into the genome of Neurospora crassa. After confirming the successful introduction of the target gene by PCR and electrophoresis, recombinant genetically engineered bacteria were obtained.

[0014] Preferably, in steps 2) and 4), the gene is ligated to the PV2 vector using the Gibson assembly method.

[0015] The application of the recombinant genetically engineered bacteria in the recovery of La ions.

[0016] The present invention achieves the following technical effects compared to the prior art: This invention utilizes the surface display properties of anchoring proteins. The anchoring protein gene and the metal-binding protein gene are linked together via the expression vector PV2 and introduced into competent spores of *Neurospora crassa* for recombinant expression. During recombinant expression, the anchoring protein expresses and immobilizes the metal-binding protein on the surface of *Neurospora crassa* cells, thereby enhancing the selectivity and adsorption capacity of *Neurospora crassa* for La ions; the adsorption capacity of the recombinant engineered bacteria for La ions increases by 2.62 times.

[0017] In addition, this recombinant engineered bacteria has the advantages of simple preparation, low cost and no secondary pollution, thus playing a positive role in promoting the recycling of rare earth resources. Attached Figure Description

[0018] Figure 1 This is a diagram showing the results of the electroconversion experiment in Embodiment 1 of the present invention; Figure 2 This is a diagram showing the results of verifying the expression of the anchoring protein using eGFP (green fluorescent protein) in Example 1 of this invention. In the images, a and b are bright-field and fluorescent images of wild-type Neurospora crassa. c and d are bright-field and fluorescent images of the Mp1-eGFP engineered strain. e and f are bright-field and fluorescent images of the Mp1-eGFP engineered strain after treatment with proteinase K. g and h are bright-field and fluorescent images of wild-type Neurospora crassa after treatment with proteinase K. Figure 3 In Example 2 of this invention, multiple strains of Mp1-MT engineered bacteria were used to target La... 3+ Adsorption effect diagram; Figure 4 The Mp1-MT4 engineered bacteria in Example 2 of this invention are used to treat different concentrations of La 3+The adsorption effect diagram. Detailed Implementation

[0019] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0020] This invention discloses an anchoring protein gene expressed on the surface of bacteria, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0021] Nine surface-displayed metal-binding protein genes were also disclosed, with their nucleotide sequences shown in SEQ ID NO.2 to SEQ ID NO.10, respectively.

[0022] Ten recombinant expression plasmids were also disclosed, namely Mp1-eGFP, Mp1-MT1, Mp1-MT2, Mp1-MT3, Mp1-MT4, Mp1-MT5, Mp1-MT6, Mp1-MT7, Mp1-REE and Mp1-2xdREE, which contain the nucleotide sequences of anchoring protein genes and the corresponding nucleotide sequences of surface-displaying metal-binding protein genes.

[0023] A method for preparing recombinant genetically engineered bacteria containing genes for anchoring proteins and surface metal-binding proteins is also disclosed, comprising the following steps: 1) Artificially synthesized the anchoring protein gene shown in SEQ ID NO.1 and the metal-binding protein genes shown in SEQ ID NO.2 to SEQ ID NO.10; 2) The anchoring protein gene and eGFP gene synthesized in step 1) are linked into the PV2 expression vector to construct the recombinant expression plasmid Mp1-eGFP; 3) The surface display element of the recombinant plasmid in step 2) was introduced into the genome of Neurospora crassa. After observing with a confocal microscope, it was confirmed that the anchoring protein successfully anchored and expressed the green fluorescent protein on the cell surface, and a successful surface display engineered bacterium was obtained. 4) The anchoring protein gene and the nine metal-binding protein genes synthesized in step 1) were respectively linked into the PV2 expression vector to construct recombinant expression plasmids Mp1-MT1, Mp1-MT2, Mp1-MT3, Mp1-MT4, Mp1-MT5, Mp1-MT6, Mp1-MT7, Mp1-REE, and Mp1-2xdREE; 5) The surface display elements of the nine recombinant plasmids from step 4) were introduced into the genome of Neurospora crassa. After confirming the successful introduction of the target gene by PCR and electrophoresis, recombinant genetically engineered bacteria were obtained.

[0024] In steps 2) and 4), the gene is ligated to the PV2 vector using the Gibson assembly method.

[0025] The recombinant genetically engineered bacteria in step 5) were also disclosed in the recovery of La 3+ Applications in [the context of the text]. Example

[0026] (1) Synthesis and construction of surface display plasmids for anchoring protein and metal-binding protein genes The gene sequences of the anchoring protein and nine metal-binding proteins were sent to a biotechnology company for synthesis and optimization to make them suitable for expression in Neurospora crassa. The synthesized anchoring protein and eGFP protein genes were ligated into the PV2 plasmid using the Gibson method to construct the surface display plasmid Mp1-eGFP.

[0027] (2) The surface display plasmid Mp1-eGFP was transformed into E. coli DH5α competent cells and a large number of surface display plasmids were extracted to prepare surface display elements. ① Take 100 μL of E. coli DH5α competent cells and put them into a centrifuge tube. Place the tube on ice and add 10 μL of Mp1-eGFP. Gently tap to mix and continue to incubate on ice for 30 min.

[0028] ② Place the centrifuge tubes in a 42°C water bath for heat shock and let them stand for 90 seconds, then quickly transfer them to an ice bath to cool for 3 minutes, avoiding shaking during this period.

[0029] ③ Add 900 μL of antibiotic-free LB medium to the centrifuge tube, repeatedly pipette until well mixed, and place in a 37℃ shaker at 220 rpm for 1 h to allow the cells to recover.

[0030] ④ Mix the bacterial culture in the centrifuge tube, take 100 μL of the transformed competent cells, add them to the ampicillin-resistant LB solid medium, spread them evenly with a sterile glass spreader, and after the liquid is completely absorbed, invert the plate and incubate it in a 37℃ constant temperature incubator for 18 h, and observe the transformed single colonies.

[0031] ⑤ Single colonies from the plates were verified by PCR and electrophoresis to screen for successfully introduced Mp1-eGFP E. coli. These E. coli were then inoculated into 10 mL LB liquid medium and cultured at 37°C with shaking at 220 rpm for 18 h.

[0032] ⑥ The surface display plasmid Mp1-eGFP was extracted from the bacterial culture and amplified by PCR to obtain a large number of surface display elements.

[0033] (3) Electroconversion experiment ① To cultivate *Neurospora crassa* spores at 4-5 days spore age, add 4 mL of ice-cold 1 M sorbitol solution to a 10 mL centrifuge tube to resuspend the spores. Transfer the spore suspension to a 1.5 mL centrifuge tube. Centrifuge at 600 g for 30 s and discard the supernatant. Add 1 mL of 1 M sorbitol solution to resuspend the spores, wash the spores three times and integrate them. Use a cell counting chamber to achieve a spore count of 1 × 10⁻⁶ spores in the spore suspension. 7 Aliquot 40 μL of spore suspension into 1.5 mL centrifuge tubes, add approximately 2 μg of surface display element DNA fragment, mix well, and incubate on ice for 3 h.

[0034] ② Using an electroporator, transfer 40 μL of competent spore suspension and DNA fragments to an electroporation cuvette and electroporate. Electroporation parameters: 1500 V, 600 Ω, 25 μF. Immediately after electroporation, add 1 mL of ice-cold 1 M sorbitol solution to the electroporation cuvette, mix well, and then pipette the liquid back into a 1.5 mL centrifuge tube. Incubate the electroporated spore suspension at 30°C for 2 h to recover.

[0035] ③ Spread 200 μL of the activated spore suspension onto a selection medium containing 200 μg / mL hygromycin. Observe the colony status on the plate regularly. After single colonies appear, select single colonies and culture them on sucrose medium containing 200 μg / mL hygromycin. After hyphae grow from the single colonies on the medium, scrape a small amount of Neurospora crassa hyphae tips with a bamboo stick into 50 μL of lysis buffer and crush them. Place the mixture on a float and boil at 100℃ for 20 min. Centrifuge at 5000 rpm for 3 min, and use the upper part of the liquid as a DNA template for PCR verification.

[0036] ④PCR system: raw materials - 5 μL, primer F - 0.5 μL, primer R - 0.5 μL, ddH2O - 3.25 μL, template - 0.5 μL.

[0037] The PCR procedure is shown in Table 1; Table 1:

[0038] ⑤ Add 1 g of agarose to a conical flask for gel preparation, then add 98 mL of ddH2O, and finally add 2 mL of 50×TAE Buffer. Place the conical flask in a microwave oven and heat for 1 min. After the agarose dissolves, add 10 μL of 10000×goldview and shake well.

[0039] Select an appropriate gel casting mold and comb, assemble them, and pour the prepared agarose gel solution onto the mold. After the agarose gel solidifies, vertically remove the comb from above, remove the agarose gel, and place it into an electrophoresis tank containing 1×TAE buffer, with the sample wells positioned near the negative electrode. Add 10 μL of the PCR system to be tested vertically to each sample well in sequence, and finally add the DNA marker.

[0040] Cover the electrophoresis tank, turn on the electrophoresis apparatus, and adjust the parameters of the electrophoresis apparatus to 120V, 120A, and 30 min.

[0041] Experimental results are as follows Figure 1 As shown, the Mp1 gene and hygromycin Hgy gene were detected in the engineered bacteria, thus the surface display element was successfully introduced into Neurospora crassa.

[0042] (3) Use eGFP (green fluorescent protein) to verify the surface expression of the anchored protein. ① The engineered bacteria that successfully expressed the display element were inoculated into sucrose liquid medium and cultured at 30°C for 18 h. After collecting the hyphae, they were washed twice with 1 mL of 1×PBS and the fluorescence was observed under a confocal microscope.

[0043] ② The mycelia of the positive bacteria that successfully expressed green fluorescence were washed twice with a potassium phosphate buffer system at pH 7, and then a potassium phosphate buffer system with a final concentration of proteinase K of 100 U / mL was added. The mixture was incubated at 37°C for 3 h. After incubation, the bacterial cells were washed twice with 1 mL of 1×PBS. The green fluorescence was then observed again using a confocal microscope.

[0044] Experimental results are as follows Figure 2 As shown, the Mp1-eGFP engineered bacteria successfully expressed green fluorescent protein on the cell surface. Example

[0045] After successful expression of the anchoring protein, the eGFP sequence of the surface display plasmid was replaced with a metal-binding protein sequence. Then, an adsorption experiment for La ions was performed.

[0046] (1) Surface display plasmids for successfully expressed anchoring proteins and nine different metal-binding proteins were constructed.

[0047] ① Mp1 and nine metal-binding protein genes were ligated to plasmids using the Gibson method, resulting in nine new surface display plasmids: Mp1-MT1, Mp1-MT2, Mp1-MT3, Mp1-MT4, Mp1-MT5, Mp1-MT6, Mp1-MT7, Mp1-REE, and Mp1-2xdREE.

[0048] ② Nine surface display plasmids were transformed into E. coli DH5α competent cells and a large number of surface display plasmids were extracted to prepare surface display elements. The DNA of the surface display elements was introduced into the competent cells of Neurospora crassa spores by electroporation. Positive strains that successfully expressed the nine surface display plasmids were screened. The specific steps were the same as (2) and (3) in Example 1.

[0049] (2) Using positive engineered bacteria for the adsorption of La ions ① Preparation of microbial adsorbent: Spores of engineered and wild-type Neurospora crassa were inoculated into sterilized PDA liquid culture medium and cultured at 30℃ and 250 rpm for 20 h. After filtration, the mycelium was collected. A certain amount of wet mycelium was weighed and dissolved in water to prepare a bacterial suspension of 60 g / L.

[0050] ②Preparation of La ion stock solution: Dissolve 0.67 g LaCl3·7H2O in 400 mL of deionized water, add a certain amount of concentrated HCl to adjust the pH of the solution to 2.0, stir until the particles are completely dissolved, and dilute to 500 mL with a volumetric flask to obtain a 500 mg / L La ion stock solution. When using, dilute to the required concentration with a volumetric flask.

[0051] ③ Biosorption experiment: Prepare a 40 mg / L La ion solution. Mix 2 mL of a 60 g / L bacterial suspension with 2 mL of a 40 mg / L La ion⁺ solution (working concentration of bacterial suspension: 30 g / L; working concentration of La ion solution: 20 mg / L). Incubate at 30℃ and 200 rpm for 3 h with shaking. Then centrifuge at 10000 rpm for 2 min and determine the concentration of residual La ions in the supernatant by atomic absorption spectrometry. The experimental results are as follows: Figure 3 The modified Neurospora crassa strain showed a significantly improved adsorption capacity for La ions. Furthermore, one strain with good adsorption capacity was selected for further La ion concentration gradient adsorption.

[0052] ④ Prepare La ion solutions with concentrations of 20, 40, 60, 80, 100, and 120 mg / L. Mix 2 mL of a 60 g / L bacterial suspension with 2 mL of the above La ion solutions (the working concentration of the bacterial suspension is 30 g / L, and the working concentrations of the La ion solutions are 10, 20, 30, 40, 50, and 60 mg / L, respectively). Incubate at 30℃ and 200 rpm for 3 h with shaking for adsorption. Then centrifuge at 10000 rpm for 2 min, and determine the concentration of residual La ions in the supernatant using atomic absorption spectrometry. The experimental results are as follows: Figure 4 When the La ion concentration was 60 mg / L, the wild-type *Neurospora crassa* adsorbed only 4.79 mg / g of La ions. After genetic modification, the Mp1-MT4 engineered bacterium adsorbed 12.55 mg / g of La ions, which is 2.62 times that of the wild type. Furthermore, the adsorption process was relatively short, reaching equilibrium within 90 minutes. Therefore, this engineered bacterium can be used to adsorb and recover La ions from solutions, demonstrating potential for industrial application.

[0053] sequence list SEQ ID NO.1: Mp1: ACCCCCCTCGTTGAGCGTGCTGGTTCCTCCCCCACCGACATCATCTCCGGCATCAGCGACAAGACCGATGCTCTCGACTCCGCCATCAAGGCTTACAACGGTGGTGACCCCTCCAAGGTTGAGTCCGCCTCCGCTGACTTGATCTCGACCATCACCAAGGGCACTGATGCCATCAAGAGCGGTGATGATATCAGCACCACCGATGCTCTTGCTCTGCCTGAGCCCGTCCAGGCTTTGACCAAGAAGGTCGAGCAGGCTATCGATGACATTATCGCCAAGAAGGACAAGTTCGTCGAGGCTGGCGCTGGCGGCAAGGTCAAGGACTCCCTGAACCAGCAGAAGTCCGCTGCCGATGGTCTCGCCTCTGCCATCACCTCCAAGGTCCCTGAGTCTCTCAAGGAGATTGCCCAGAGCCTCTCCGCTGGTATCAGCACCGCTATCCAGAAGGGTGTCGATGCGTACAAGGACGTTTCCGACTCCGTCCCCTCTTCCAGCGCTGGCTCCTCCGCGAGCGCCACTGCCACCGGCAGCGCTTCTGAGACCGGCAGCGCCTCTACTACCGGTTCTGCCTCCGCCACCTCCAGCTCCGTGATCCCCACCTCCTCCGGTGCTGCCAGCTCCTCTGCTGCCCCCTCCGGCTCCAGCACCCCCACTGGCTCCGGCTCTGCCTCCGCCACCTCTCCTCCCTTGGCCACCGGTGCTGCCAACAAGGCCACCATCGGCTACTCCCTTGGTGCCGTCGCCATGGCCGCCATTGCCGTCGCTGTCTAA。

[0054] Met Gly Cys Asp Asp Lys Cys Gly Cys Ala Val Pro Cys Pro Gly Gly ThrGly Cys Arg Cys Thr Ser Ala Arg Ser Gly Ala Ala Gly Glu His Thr Thr CysGly Cys Gly Glu His Cys Gly Cys Asn Pro Cys Ala Cys Ala Gly Arg Pro Gly Asn Gly Arg Cys Gly Ala Ala Cys Asn Cys AlaSer Cys Gly Ser Ala Thr Ala。

[0055] SEQ ID NO.2:MT1: ATGCCAGGTCCATGTTGTAATGATAGTGTGTTTGTCAAGAGGTGGTTGTAAGGCTGGTTGTCAATGTACCTCCTGTAGATGTTCCCCATGTCAAGTGTACTTCCGTTGTAAGTGCTACTAAAGAAAGATGTTCTAAAACTTGTACCAAGCCATGTTCAATTGTTGTCCTA

[0056] Met His Leu Wing Ile Lys Ser Leu Phe Val Ser Leu Leu Gly Wing Ser ValLeu Wing。

[0057] SEQ ID NO.3:MT2: CCAGGTCCATGTTGTAAAGATAAATGTGAATGTGCTGAAGGTGGTTGTAAAACTGGTTGTAAATGTACTTCTTGTGCTCCATGTGAAAATGTACTTCAGGTTGTCCATCTAAAGATGAATGTGCTAAAACTTGTTCTAAGCCATGTAGTTGTTGTCCAACT.

[0058] Met His Leu Wing Ile Lys Ser Leu Phe Val Ser Leu Leu Gly Wing Ser ValLeu Wing。

[0059] SEQ ID NO.4:MT3: ATGGACCCTAACTGTTCTTGTGCTGCTGGTGATTCTTGTACTTGTGCTGGTTCTTGTAAATGTAAAGAATGTAAATGTACCTCCTGTAAAAAGAGTTGTTGTTCTTGTTGTCCAGTTGGTTGTGCTAAATGTGCTCAAGGTTGTATTTGTAAAGGTGCTTCTGATAAATGTAGTTGTTGTGCT。

[0060] Met His Leu Ala Ile Lys Ser Leu Phe Val Ser Leu Leu Gly Ala Ser ValLeu Ala。

[0061] SEQ ID NO.5:MT4: ATGGGTTGTGATGATAAGTGTGGTTGTGCTGTTCCTTGTCCAGGTGGTACTGGTTGTAGATGTACTTCTGCTAGATCTGGTGCTGCTGCTGGTGAACATACTACTTGTGGTTGTGGTGAACATTGTGGTTGTAATCCTTGTGCTTGTGGTAGAGAAGGTACTCCATCTGGTAGAGCTAATAGAAGAGCTAATTGTAGTTGTGGTGCTGCTTGTAACTGTGCTTCTTGTGGTAGTGCTACTGCT。

[0062] Met Gly Cys Asp Asp Lys Cys Gly Cys Ala Val Pro Cys Pro Gly Gly ThrGly Cys Arg Cys Thr Ser Ala Arg Ser Gly Ala Ala Ala Gly Glu His Thr Thr CysGly Cys Gly Glu His Cys Gly Cys Asn Pro Cys Ala Cys Gly Arg Glu Gly Thr ProSer Gly Arg Ala Asn Arg Arg Ala Asn Cys Ser Cys Gly Ala Ala Cys Asn Cys AlaSer Cys Gly Ser Ala Thr Ala。

[0063] SEQ ID NO.6: MT5: TCTGGTAAAGGTAAAGGTGAAAAGTGTACTAGTGCTTGTAGATCTGAACCTTGTCAATGTGGTTCTAAATGTCAATGTGGTGAAGGTTGTACTTGTGCTGCTTGTAAAACTTGTAATTGTACTTCAGATGGTTGTAAATGTGGTAAAGAATGTACTGGTCCTGATTCCTGTAAATGTGGTTCTTCTTGTTCTTGTAAG。

[0064] With His Leu Ala Ile Lys Ser Leu Phe Val Ser Leu Leu Gly Ala Ser ValLeu Ala。

[0065] SEQ ID NO.7: MT6: ATGACATCCACAACCTTGGTTAAATGTGCTTGTGAACCATGTTTGTGTAACGTTGATCCATCTAAAGCTATTGATAGAAATGGTTTGTACTACTGTTCCGAAGCATGTGCTGATGGTCATACAGGTGTTTTCTAAAGGTTGTGGTCATACAGGTTGTAATTGTCATGGT。

[0066] With His Leu Ala Ile Lys Ser Leu Phe Val Ser Leu Leu Gly Ala Ser ValLeu Ala。

[0067] SEQ ID NO.8: MT7: ATGTTCTCCGAATTGATTAACTTCCAAAACGAAGGTCATGAATGTCAATGTCAATGTGGTTCTTGTAAAAATAACGAACAATGTCAAAAGTCCTGTTCTTGTCCAACTGGTTGTAATTCTGATGATAAATGTCCATGTGGTAATAAAAGTGAAGAAACTAAAAAAGTCCTGTTGTAGTGGTAAA。

[0068] With His Leu Ala Ile Lys Ser Leu Phe Val Ser Leu Leu Gly Ala Ser ValLeu Ala。

[0069] SEQ ID NO.9: REE: TTCATTGATACCAACAACGATGGTTGGATTGAAGGTGATGAATTG.

[0070] Met His Leu Ala Ile Lys Ser Leu Phe Val Ser Leu Leu Gly Ala Ser ValLeu Ala.

[0071] SEQ ID NO.10: 2xdREE: TTCATTGATACCAACAACGATGGTTGGATTGAAGGTGATGAATTGTTCATTGATACCAACAACGATGGTTGGATTGAAGGTGATGAATTGGCTAGTCCGCCCGCACGGGGTGACCAGCGCGCCGGATACCCGCCCCGCCGGTTCGACGGCTAGTTTCATTGATACCAACAACGATGGTTGGATTGAAGGTGATGAATTGTTCATTGATACCAACAACGATGGTTGGATTGAAGGTGATGAATTG.

[0072] Met His Leu Ala Ile Lys Ser Leu Phe Val Ser Leu Leu Gly Ala Ser ValLeu Ala.

[0073] The above description is merely a preferred embodiment of the present invention and does not constitute any limitation on the technical scope of the present invention. Therefore, any minor modifications, equivalent changes, and alterations made to the above embodiments based on the technical essence of the present invention shall still fall within the scope of the technical solution of the present invention.

Claims

1. An anchoring protein gene expressed on the surface of bacteria, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

1.

2. Nine metal-binding protein genes for surface display, characterized in that, Their nucleotide sequences are shown in SEQ ID NO.2 to SEQ ID NO.10, respectively.

3. Ten recombinant expression plasmids, namely Mp1-eGFP, Mp1-MT1, Mp1-MT2, Mp1-MT3, Mp1-MT4, Mp1-MT5, Mp1-MT6, Mp1-MT7, Mp1-REE, and Mp1-2xdREE, characterized in that, The nucleotide sequence comprising the anchoring protein gene of claim 1, and the corresponding nucleotide sequence in the surface-displaying metal-binding protein gene of claim 2.

4. A method for preparing a recombinant genetically engineered bacterium containing genes for anchoring proteins and metal-binding proteins, characterized in that, Includes the following steps: 1) Artificially synthesized the anchoring protein gene shown in SEQ ID NO.1 and the metal-binding protein genes shown in SEQ ID NO.2-10; 2) The anchoring protein gene synthesized in step 1) is linked to the eGFP gene in the PV2 expression vector to construct the recombinant expression plasmid Mp1-eGFP; 3) The surface display element of the recombinant plasmid in step 2) was introduced into the genome of Neurospora crassa. After observing with a confocal microscope, it was confirmed that the anchoring protein successfully anchored and expressed the green fluorescent protein on the cell surface, and a successful surface display engineered bacterium was obtained. 4) The anchoring protein gene and the nine metal-binding protein genes synthesized in step 1) were respectively linked into the PV2 expression vector to construct recombinant expression plasmids Mp1-MT1, Mp1-MT2, Mp1-MT3, Mp1-MT4, Mp1-MT5, Mp1-MT6, Mp1-MT7, Mp1-REE, and Mp1-2xdREE; 5) The surface display elements of the nine recombinant plasmids from step 4) were introduced into the genome of Neurospora crassa. After confirming the successful introduction of the target gene by PCR and electrophoresis, recombinant genetically engineered bacteria were obtained.

5. The method for preparing recombinant genetically engineered bacteria containing surface-displayed metal-binding proteins according to claim 4, characterized in that, In steps 2) and 4), the gene is ligated to the PV2 vector using the Gibson assembly method.

6. The application of the recombinant genetically engineered bacteria described in step 5) of claim 4 in the recovery of lanthanum (La), cerium (Ce), praseodymium (Pr), neodymium (Nd), promethium (Pm), samarium (Sm), europium (Eu), gadolinium (Gd), terbium (Tb), dysprosium (Dy), holmium (Ho), erbium (Er), thulium (Tm), ytterbium (Yb), lutetium (Lu), scandium (Sc), and yttrium (Y).

Images