Brassica parachinensis brgh79 gene and application thereof in regulating cellulose synthesis of brassica parachinensis

Abstract

The application provides a flowering Chinese cabbage BrGH79 gene and application thereof in regulating cellulose synthesis of the flowering Chinese cabbage, and belongs to the technical field of plant genetic engineering. The application proves that the gene plays a positive regulation role in cellulose synthesis by constructing BrGH79 super-expression plants; cellulose accumulation of the silenced plants is obviously inhibited after the expression of the gene is down-regulated by using gene silencing technology, and the key role of the gene in cellulose synthesis is further verified. The BrGH79 gene provided by the application lays a theoretical foundation for further elucidating the molecular regulation mechanism of plant cellulose synthesis, and provides important gene resources for breeding of new varieties of high-quality flowering Chinese cabbage, and has a good application and development prospect.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically, it relates to the BrGH79 gene of Chinese cabbage and its application in regulating cellulose synthesis in Chinese cabbage. Background Technology

[0002] Chinese cabbage (Choy sum) is an important leafy green vegetable belonging to the Brassicaceae family and a major economic vegetable unique to southern my country. Its main edible part is the tender flower stalk, and its taste and quality are core indicators of its commercial value. Cellulose, as a key structural component of plant cell walls, directly regulates the mechanical hardness, growth status, stress resistance, and post-harvest storage quality of the Chinese cabbage flower stalk through its biosynthesis process and cell wall deposition characteristics. It is a core physicochemical factor affecting the quality formation of Chinese cabbage. During conventional cultivation and post-harvest storage and transportation, the flower stalk is prone to continuous accumulation of cellulose, leading to stem hardening and increased lignification. This results in a coarse texture, reduced tenderness, and severely damages the commercial quality of the Chinese cabbage, thus restricting its market economic benefits.

[0003] Currently, the cultivation and quality control of high-quality, soft-textured Chinese cabbage have become a key research focus in vegetable cultivation. In-depth exploration of the molecular regulatory mechanism of cellulose synthesis in the stems of Chinese cabbage can clarify the core mechanisms of stem fibrosis and quality deterioration, filling gaps in existing research on the molecular regulation of Chinese cabbage quality. This research will not only provide a solid theoretical basis for improving the quality of Chinese cabbage and innovating superior germplasm, but also offer scientific guidance for precise field cultivation management and post-harvest quality preservation technology optimization, possessing significant theoretical and practical application value for promoting the high-quality and high-yield industrialization of Chinese cabbage. Summary of the Invention

[0004] To address the aforementioned problems in the prior art, this invention provides a Chinese cabbage BrGH79 gene and its application in regulating cellulose synthesis in Chinese cabbage.

[0005] Specifically, the present invention adopts the following technical solution:

[0006] In a first aspect, the present invention provides a Chinese cabbage BrGH79 gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] Secondly, the present invention provides a protein encoded by the BrGH79 gene of the Chinese cabbage, the amino acid sequence of which is shown in SEQ ID NO.2.

[0008] Thirdly, the present invention provides an expression vector containing the BrGH79 gene of Chinese cabbage.

[0009] Fourthly, the present invention provides a host cell containing the expression vector.

[0010] Fifthly, the present invention provides a specific primer pair for amplifying the BrGH79 gene of Chinese cabbage, the primer pair comprising a forward primer as shown in SEQ ID NO.3 and a reverse primer as shown in SEQ ID NO.4.

[0011] In a sixth aspect, the present invention provides the application of the Chinese cabbage BrGH79 gene, or the protein encoded by the Chinese cabbage BrGH79 gene, or the expression vector containing the Chinese cabbage BrGH79 gene, or the host cell, or the specific primer pair in regulating the synthesis of cellulose in Chinese cabbage.

[0012] Seventhly, the present invention provides a method for reducing the amount of cellulose synthesis in Chinese cabbage or improving the tenderness of Chinese cabbage stems, which is achieved by silencing or knocking out the BrGH79 gene in Chinese cabbage.

[0013] Eighthly, the present invention provides a method for cultivating low-cellulose and / or high-tenderness Chinese cabbage plants, the method comprising the following steps:

[0014] (1) Construct a silencing expression vector for the BrGH79 gene;

[0015] (2) Transform the silent expression vector into Agrobacterium;

[0016] (3) Using 20-day-old Chinese cabbage seedlings as the infection target, plants with silent expression of the BrGH79 gene were obtained;

[0017] (4) Breed BrGH79 gene silent expression plants to obtain the low cellulose and / or high tenderness Chinese cabbage plants.

[0018] In one or more embodiments, the silencing expression vector of the BrGH79 gene in step (1) is obtained by the following method: by gene recombination exchange, the non-conserved segment of the BrGH79 gene and its complementary segment are replaced with the ccdB gene of the pK7GWIWG2(I) plasmid to obtain the silencing expression vector pK7GWIWG2(I)-BrGH79 of the BrGH79 gene; the nucleotide sequence of the non-conserved segment of the BrGH79 gene is shown in SEQ ID NO.5.

[0019] In one or more embodiments, the Agrobacterium mentioned in step (2) is Agrobacterium GV3101.

[0020] Compared with the prior art, the present invention has the following advantages:

[0021] This invention provides a gene BrGH79 that regulates cellulose synthesis in Chinese cabbage and its applications. The invention demonstrates the positive regulatory role of this gene in cellulose synthesis by constructing BrGH79 overexpression plants. Furthermore, downregulating BrGH79 expression using gene silencing technology significantly inhibits cellulose accumulation in silenced plants, further validating the gene's crucial role in cellulose synthesis. The BrGH79 gene provided by this invention lays a theoretical foundation for elucidating the molecular regulatory mechanisms of plant cellulose synthesis and provides an important gene resource for the cultivation of high-quality Chinese cabbage varieties, demonstrating promising application and development prospects. Attached Figure Description

[0022] Figure 1 This is an analysis diagram of the cis-acting elements of the BrGH79 gene in Example 1.

[0023] Figure 2 This is a comparison image of Chinese cabbage plants at different growth stages in Example 2.

[0024] Figure 3 This is a comparison chart of the cellulose content of the stems of Chinese cabbage at different growth stages in Example 2.

[0025] Figure 4 The relative expression levels of the BrGH79 gene at different growth times of Chinese cabbage in Example 2.

[0026] Figure 5 This is a map of the pEarleyGate 101 plasmid described in Example 3.

[0027] Figure 6 The results show the identification of BrGH79 gene overexpression positive plants in Example 3.

[0028] Figure 7 This is a comparison of stem hardness between the negative control and the BrGH79 gene overexpressing plant in Example 3.

[0029] Figure 8 This is a comparison of cellulose content between the negative control and the BrGH79 gene overexpressing plants in Example 3.

[0030] Figure 9 This is a comparison of the changes in the stem section of BrGH79 gene overexpressing plants and negative control plants under DCB treatment in Example 3.

[0031] Figure 10 This is a comparison of the relative expression levels of the BrGH79 gene in DCB-treated plants and negative control plants in Example 3.

[0032] Figure 11This is a comparison of stem cellulose content between BrGH79 gene overexpressing plants and negative control plants treated with DCB in Example 3.

[0033] Figure 12 The image shows the pK7GWIWG2(I) plasmid described in Example 4.

[0034] Figure 13 The results show the identification of BrGH79 gene-silenced positive plants in Example 4.

[0035] Figure 14 This is a comparison of the changes in the stem section of plants with silent BrGH79 gene expression and negative control plants in Example 4.

[0036] Figure 15 This is a comparison diagram of stem hardness analysis between plants with silent BrGH79 gene expression and negative control plants in Example 4.

[0037] Figure 16 This is a comparison diagram of the cellulose-related enzyme activity analysis between BrGH79 gene-silenced plants and negative control plants in Example 4.

[0038] Figure 17 This is a comparison of cellulose content between BrGH79 gene-silenced plants and negative control plants in Example 4. Detailed Implementation

[0039] Example

[0040] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0041] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention.

[0042] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0043] Unless otherwise specified, the techniques or conditions described in the examples shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Unless otherwise specified, the experimental materials and reagents used in the examples are all commercially available consumables and reagents.

[0044] The Chinese cabbage variety used in this example is the common Chinese cabbage variety 'Sijiu-19', which was provided by the Leafy Vegetable Research Laboratory of the Vegetable Research Institute of Hainan Academy of Agricultural Sciences.

[0045] Example 1: Cloning and Bioinformatics Analysis of the BrGH79 Gene

[0046] Using the Unigene (FX698775.1) sequence obtained from Chinese cabbage transcriptome sequencing as a reference, the full-length CDS sequence of the corresponding gene in Chinese cabbage heart was obtained through whole-genome synthesis. Subsequently, BLAST alignment analysis using NCBI and the Arabidopsis thaliana genome website, combined with transcriptome annotation results, led to the naming of this gene as Chinese cabbage heart BrGH79. The open reading frame (ORF) of this gene is 1635 bp (its nucleotide sequence is shown in SEQ ID NO.1), encoding 544 amino acid residues (its amino acid sequence is shown in SEQ ID NO.2), and the protein's molecular formula is C0. 2711 H 4210 N 730 O 787 S 22 It has a total number of atoms of 8640, a relative molecular weight of 60.33 kDa, a theoretical isoelectric point of 8.67, an aliphatic coefficient of 86.12, an average hydrophobicity of -0.208, and an instability coefficient of 34.82.

[0047] The cis-regulatory elements (such as...) of the BrGH79 gene were analyzed using the online tool PlantCAR (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ). Figure 1 As shown, it was found that it contains multiple response elements related to cellulose synthesis, including hormone response (P-box, TGACG-motif, ABRE, TCA-element, CGTCA-motif, TGA-element, AuxRR-core), light response (ATC-motif, chs-CMA2a, GT1-motif, TCT-motif, G-box, Sp1, chs-CMA1a), abiotic stress response (LTR, MBS), and growth and development (MSA-like).

[0048] Example 2: The relationship between the BrGH79 gene in Chinese cabbage and cellulose synthesis in stems

[0049] Chinese cabbage seedlings were cultivated in plug trays. When the seedlings reached the three-leaf-one-heart stage, vigorous plants with uniform growth were selected and transplanted into nutrient pots, which were then placed in an artificial climate chamber for cultivation. The environmental parameters of the climate chamber were set as follows: day / night temperature 25°C / 18°C, photoperiod 16 h / 8 h (day / night), and relative humidity 75%. The flower stalks of the Chinese cabbage plants were collected on days 20, 30, and 40 after transplanting. After sampling, the samples were immediately flash-frozen in liquid nitrogen and then transferred to an ultra-low temperature freezer at -80°C for storage for subsequent parameter determination. Each treatment was performed in triplicate, with three plants randomly selected from each replicate.

[0050] Cellulose content was determined by the sulfuric acid-anthrone colorimetric method, and the specific operation was carried out according to the method in Li Hesheng (2000) "Principles and Techniques of Plant Physiological and Biochemical Experiments".

[0051] The expression level of the BrGH79 gene was detected using real-time quantitative PCR (RT-qPCR). Total RNA was extracted using an RNA extraction kit (Tiangen, Beijing, China); cDNA was obtained by reverse transcription using the Prime Script RT kit (Takara, Dalian, China) according to the instructions. RT-qPCR was performed according to the instructions of the TB Green® Premix Ex Taq™ II FAST qPCR kit (Takara, Dalian, China). The reaction system consisted of 20 μL of TB Green Premix Ex Taq Ⅱ Fast qPCR kit (10 μL), 0.4 μL each of forward and reverse primers, 2 μL of cDNA template, and 7.2 μL of ddH2O. The reaction program was: 95 °C pre-denaturation for 30 s, 95 °C denaturation for 10 s, 60 °C extension for 30 s, for 40 cycles. The expression levels of differentially expressed genes were calculated using a method with three biological replicates and three technical replicates per experiment. GAPDH was selected as the internal reference gene (Xinmin H, Yuling L, Hongling G, et al. Transcriptomic analysis of the regulation of stalk development in flowering Chinese cabbage (Brassica campestris) by RNA sequencing.[J]. Scientific reports,2017,7(1-4):15517.). Primers were designed using Primer 3.0, and the primers for amplifying the expression of the BrGH79 gene were:

[0052] F:GACGAGCTCCACAGCTTCCT (SEQ ID NO.3);

[0053] R: CCACGCATTGAGCTGCTTCT (SEQ ID NO. 4).

[0054] Phenotypic observation results showed that the growth height of Chinese cabbage plants increased significantly with the extension of the growth period, and the plants were taller at 40 days than at 20 days and 30 days. Figure 2 Further analysis of the cellulose content in the stems of Chinese purslane at 20, 30, and 40 days showed that the cellulose content in the stems at 40 days was higher than that at 30 and 20 days. Figure 3 Meanwhile, the expression level of the BrGH79 gene showed a similar trend to that of cellulose content; the relative expression level of the BrGH79 gene in the stem at 40 days was significantly higher than that at 30 days and 20 days. Figure 4 Correlation analysis showed that the relative expression level of the BrGH79 gene was significantly positively correlated with cellulose content (Table 1). Based on the above results, it is speculated that the BrGH79 gene may be a key candidate gene regulating cellulose synthesis in Chinese flowering cabbage stems.

[0055] Table 1. Correlation analysis between BrGH79 gene expression level and cellulose content.

[0056]

[0057] Highly significant correlation at the 0.05 level.

[0058] Example 3: Construction and Functional Analysis of BrGH79 Gene Overexpression Vector

[0059] Using homologous recombination, the full-length CDS sequence of the BrGH79 gene was used to replace the pEarleyGate 101 plasmid (its map is shown below). Figure 5 (As shown) The ccdB gene between attR1 and attR2 after the 35S promoter was used to obtain the BrGH79 gene overexpression vector pEarleyGate 101-BrGH79.

[0060] The vector pEarleyGate 101-BrGH79 was transformed into Agrobacterium GV3101, and then cultured upside down on LB solid medium containing 50 µg / mL kanamycin and 50 µg / mL rifampin for 48 h. Positive colonies were picked and expanded. After shaking, centrifugation, and resuspending the bacterial cells, acetylsyl syringone was added to a final concentration of 200 μmol / L and incubated at room temperature for 3 h. An equal volume of the incubated bacterial solution was injected into the main vein of the underside of the leaves of 20-day-old Chinese cabbage seedlings to obtain transgenic plants, which were then identified as positive. The BrGH79 gene overexpression positive plants and negative control plants (containing the empty vector pEarleyGate 101) were transferred to an artificial climate chamber for culture (same as in Example 2). The plant culture, sampling, cellulose content determination, and gene expression analysis methods were all the same as in Example 2. Stem hardness was determined using a TA-XT plus texture analyzer.

[0061] In addition, BrGH79 gene overexpressing plants that have grown to 20 days and negative control plants were irrigated with a single dose of 60 μmol / L cellulose synthesis inhibitor DCB at the root to observe its effect on stem cellulose content and relative expression of BrGH79 gene.

[0062] Positive identification test results such as Figure 6 As shown, the relative expression level of the BrGH79 gene in the BrGH79 gene overexpression plants was significantly higher than that in the negative control plants, indicating that the BrGH79 gene overexpression system was successfully constructed. The results of the hardness and cellulose content measurements are as follows: Figure 7 and Figure 8 The results showed that the stem hardness and cellulose content of both the negative control plants and the BrGH79 gene overexpressing plants gradually increased with the extension of growth time, and the stem hardness and cellulose content of the BrGH79 gene overexpressing plants were significantly higher than those of the negative control at the same time point.

[0063] Phenotypic observation results are as follows Figure 9 As shown, at 30 days of growth, the negative control plants gradually developed white cores on the cut surface of their stems; while the BrGH79 gene overexpressing plants already showed hollow cores on the cut surface at the same time, and the hollow core degree was further aggravated by 40 days. No significant relief was observed in the above phenotypes after DCB treatment.

[0064] Expression analysis results as follows Figure 10As shown, after DCB treatment, the relative expression level of BrGH79 in both the negative control plants and the BrGH79 gene overexpressing plants gradually increased with the growth process; however, compared with the corresponding plants without DCB treatment, there was no significant difference in expression level at the same time point, indicating that the expression of the BrGH79 gene is not regulated by DCB treatment. Similarly, the cellulose content of the above two types of plants also continued to accumulate with the extension of the growth period, and there was no significant change compared with the untreated group. Figure 11 This indicates that the cellulose synthesis process was not affected by DCB treatment.

[0065] In summary, overexpression of the BrGH79 gene leads to an increase in the cellulose content of Chinese cabbage stems, indicating that this gene can positively regulate cellulose synthesis in Chinese cabbage.

[0066] Example 4: Construction and Functional Analysis of BrGH79 Gene Silencing Vector

[0067] By means of gene recombination and exchange, a 272bp nonconserved region of the BrGH79 gene (CDS1226-1497bp, as shown in SEQ ID NO.5) and its complementary fragment were used to replace the pK7GWIWG2(I) plasmid (purchased from Shanghai Zeye Biotechnology Co., Ltd., its map is shown in Figure 1). Figure 12 The ccdB gene (as shown) was used to obtain the BrGH79 gene silencing expression vector pK7GWIWG2(I)-BrGH79. The pK7GWIWG2(I)-BrGH79 gene silencing expression vector was transformed into Agrobacterium GV3101. After culturing, centrifuging, resuspending, and inoculating, 20-day-old seedlings were used as the infection target to obtain BrGH79 gene-silencing expression plants, which were then identified as positive.

[0068] Then, BrGH79 gene-silenced positive plants and their negative control plants (containing the empty vector pK7GWIWG2(I)) were cultured in an artificial climate chamber. Plant culture, sampling, cellulose content determination, and gene expression were the same as in Example 2. Other indicators: stem hardness was determined using a TA-XT plus texture analyzer; cellulose synthase (CesA), sucrose synthase (SS), cellulase (CE), and KOR enzyme activities were determined using a double antibody sandwich method. Specifically, a solid-phase coated microplate was prepared with purified antibody, and the test sample and HRP-labeled detection antibody were added sequentially to form a solid-phase antibody-antigen-enzyme-labeled antibody complex. After thorough washing, the substrate TMB was added for color development, and the color changed from blue to yellow under HRP catalysis (acid addition terminated). The color depth was directly proportional to the plant cellulose synthase content in the sample. The OD value was measured at 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader, and the target enzyme content in the sample was quantified using a standard curve. The kits were from Shanghai Enzyme-Link Biotechnology Co., Ltd. All the above indicators were measured in triplicate.

[0069] Positive identification test results such as Figure 13 As shown, the expression level of the BrGH79 gene in the silenced plants was significantly lower than that in the negative control plants, indicating that the BrGH79 gene silencing system was successfully constructed.

[0070] Phenotypic observation results are as follows Figure 14 As shown, the stems of the negative control plants developed white cores on the cut surface at 30 days and became hollow at 40 days; while the BrGH79 gene-silenced plants did not show white cores or hollow cores at the same time points.

[0071] Hardness test results are as follows Figure 15 As shown, the stem hardness of the negative control plants gradually increased with the extension of growth time, while the hardness of the silent plants did not change significantly at any time point, and was significantly lower than that of the negative control at 30 days and 40 days.

[0072] Enzyme activity and cellulose content determination, such as Figure 16 and Figure 17 As shown, in negative control plants, the activities of CesA, SS, and KOR enzymes gradually increased with prolonged growth time, and the cellulose content increased synchronously; while in BrGH79 gene-silenced plants, the activities of the above enzymes and the cellulose content did not change significantly at any time point. In addition, CE enzyme activity did not change significantly in BrGH79 gene-silenced plants, but showed a gradual decreasing trend in negative control plants.

[0073] Based on the above results, silencing the BrGH79 gene can lead to a decrease in the cellulose content of Chinese cabbage stems, indicating that this gene positively regulates cellulose synthesis.

[0074] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above description. Therefore, the scope of protection of the present invention should be defined by the appended claims.

Claims

1. A BrGH79 gene for Chinese cabbage, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

1.

2. The protein encoded by the BrGH79 gene of Chinese cabbage as described in claim 1, characterized in that, Its amino acid sequence is shown in SEQ ID NO.

2.

3. An expression vector containing the Chinese cabbage BrGH79 gene as described in claim 1.

4. A host cell containing the expression vector as described in claim 3.

5. A specific primer pair for amplifying the Chinese cabbage BrGH79 gene as described in claim 1, characterized in that, The primer pair includes a forward primer as shown in SEQ ID NO.3 and a reverse primer as shown in SEQ ID NO.

4.

6. The application of the Chinese cabbage BrGH79 gene of claim 1, the protein encoded by the Chinese cabbage BrGH79 gene of claim 2, the expression vector containing the Chinese cabbage BrGH79 gene of claim 3, the host cell of claim 4, or the specific primer pair of claim 5 in regulating the synthesis of cellulose in Chinese cabbage.

7. A method for reducing the amount of cellulose synthesized in Chinese cabbage or improving the tenderness of Chinese cabbage stems, characterized in that, This was achieved by silencing or knocking out the BrGH79 gene in Chinese cabbage.

8. A method for cultivating low-cellulose and / or high-tenderness Chinese cabbage plants, characterized in that, The method includes the following steps: (1) Construct a silencing expression vector for the BrGH79 gene; (2) Transform the silent expression vector into Agrobacterium; (3) Using 20-day-old Chinese cabbage seedlings as the infection target, plants with silent expression of the BrGH79 gene were obtained; (4) Breed BrGH79 gene silent expression plants to obtain the low cellulose and / or high tenderness Chinese cabbage plants.

9. The method as described in claim 8, characterized in that, The silencing expression vector of the BrGH79 gene in step (1) is obtained by the following method: by gene recombination exchange, the non-conserved segment of the BrGH79 gene and its complementary segment are used to replace the ccdB gene of the pK7GWIWG2(I) plasmid to obtain the silencing expression vector pK7GWIWG2(I)-BrGH79 of the BrGH79 gene; the nucleotide sequence of the non-conserved segment of the BrGH79 gene is shown in SEQ ID NO.

5.

10. The method as described in claim 8, characterized in that, The Agrobacterium mentioned in step (2) is Agrobacterium GV3101.

Images