DNA serial integration system and its application in iteratable gene editing

Abstract

The application provides a DNA continuous integration system and application thereof in iterative gene editing, and is based on Se01 integrase. attB recombination with attP a complete recognition site, and supports at least 3 rounds of iterative continuous insertion. The system is applicable to prokaryotic and eukaryotic hosts, and can realize efficient integration of small or large foreign DNA in single round and multiple rounds. The application also provides a method for carrying out systems metabolic engineering and biosynthesis gene cluster reconstruction by using the system, and solves the technical bottleneck of "single integration inactivation" of the existing site-specific recombinase.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and synthetic biology, specifically relating to a DNA sequential integration system and its application in iterative gene editing. Background Technology

[0002] Current in vivo gene integration methods mainly include nuclease-induced DNA double-strand breaks (DSB) strategies (such as the CRISPR-Cas9 system) and homologous recombination systems (such as Red / ET recombination). Although they can achieve targeted gene integration, they suffer from problems such as high cytotoxicity, limitations on DNA fragment size (usually <10 kb), and low loading capacity and efficiency in higher organisms (such as mammalian cells).

[0003] Site-specific recombinases (SSRs) are crucial tools in synthetic biology for achieving precise insertion of large DNA fragments. Among them, Cre- loxP Tyrosine recombination systems, due to their reversible recombination and cleavage bias, are primarily used for gene knockout and struggle to achieve stable integration; while serine integration systems such as phiC31 can mediate unidirectional integration, but post-recombination... attP / attB Site transformation attL / attR The recombination sites are "consumed in one go," making secondary iterations impossible. This means that existing SSR systems (such as phiC31) cannot meet the needs of multi-round, iterative gene editing.

[0004] Meanwhile, with the development of synthetic biology, applications such as the multi-gene stacking of complex metabolic pathways, the modular assembly of large biosynthetic gene clusters (BGCs), and iterative site writing in gene therapy all require multiple rounds of large-fragment, stable, and continuous insertion at the same genomic or target DNA site. However, the lack of iterative integration tools in current technologies that can achieve "site retention after integration" restricts the construction and optimization of complex gene circuits.

[0005] Therefore, there is an urgent need to develop a DNA integration system that retains the complete recognition site after recombination, can be used continuously and iteratively, has good genetic stability, and is applicable to multiple species in prokaryotes and eukaryotes, in order to overcome the technical bottleneck of existing site-specific recombination that is "inactivated after a single integration". Summary of the Invention

[0006] The purpose of this invention is to provide a DNA sequential integration system and its application in iterative gene editing.

[0007] In a first aspect of the invention, a method for continuous DNA integration / recombination in a cell is provided, comprising using SeO1 integrase to mediate integrase recognition of attachment sites ( att Site-specific integration / recombination between target DNA molecules (such as the host genome or plasmids); the recombination preserves the integrity of the target DNA molecule. attB Recognition sites enable continuous DNA integration / recombination; wherein the integrase recognition attachment sites include a first integrase recognition attachment site and a second integrase recognition attachment site, which are different and selected from: attB site, attP Site.

[0008] In one or more embodiments, the Se01 integrase has the amino acid sequence shown in SEQ ID NO:1, or a variant having at least 80%, preferably at least 90%, more preferably at least 95% sequence homology with SEQ ID NO:1 and retaining the continuous integrative activity.

[0009] In one or more embodiments, the Se01 integrase has tyrosine recombinase activity.

[0010] In one or more embodiments, the nucleic acid molecule encoding the Se01 integrase has the nucleotide sequence shown in SEQ ID NO:2.

[0011] In one or more embodiments, n rounds of continuous DNA integration / recombination are performed, where n is a positive integer ≥2.

[0012] In one or more implementations, n is a positive integer ≥3.

[0013] In one or more embodiments, n is a positive integer from 2 to 15, more specifically, for example (but not limited to) 3, 5, 8, 10, or 12.

[0014] In one or more implementations, the first-round integration / reorganization method includes: (1) Provide cells to be integrated / recombined, which may or may not contain a first integrase recognition attachment site; (2) Provide a recombinant construct, including: (i) The gene encoding Se01 integrase or its gene expression cassette. (ii) The second integrase recognizes the attachment site. (iii) An optional first integrase recognition attachment site, provided that the site exists only if (1) does not contain the first integrase recognition attachment site. (iv) Donor DNA, which carries the target gene to be integrated / recombined. Optionally, (i)-(iv) are placed in the same or different recombinant constructs; (3) The recombinant construct from (2) is introduced into the cell from (1), where site-specific recombination occurs under the catalysis of Se01 integrase. The donor DNA is integrated into the target DNA molecule (such as the host genome or plasmid), and this process preserves the integrity of the donor DNA. attB Identification site.

[0015] In one or more embodiments, the first integrase recognizes the attachment site as: attB The second integrase recognition attachment site is... attP Site.

[0016] In one or more embodiments, the first integrase recognizes attachment sites located on the host / receptor side / genome.

[0017] In one or more embodiments, the second integrase recognition attachment site is located on the donor side / plasmid.

[0018] In one or more embodiments, (1) the first integrase recognition attachment site is located in the target DNA molecule (such as the host genome or plasmid).

[0019] In one or more implementations, methods for conducting the next round of integration / reorganization include: (1') Provide cells after the previous round of integration / recombination, in which the target gene after the previous round of integration / recombination is present and the complete target gene is retained. attB Identification site; (2') Provide a recombinant construct, including: (i') The gene encoding Se01 integrase or its gene expression cassette. (ii') Second integrase recognizes attachment sites attP Identification site, (iii') Donor DNA, which carries the target gene to be integrated / recombined. Optionally, (i')-(iii') are placed in the same or different recombination constructs; (3') The recombinant construct of (2') is introduced into the cell of (1'), where donor DNA integration / recombination occurs, a process that preserves the complete attB Identification site; Preferably, the method (1')-(3') is repeated (n-1 rounds).

[0020] In one or more embodiments, the elements in (i)-(iv) or (i')-(iii') can form an operable (operational connection) integration / recombination system within the cell, thereby achieving DNA integration / recombination.

[0021] In one or more embodiments, the “at least two donor DNAs” refers to ≥2 donors, such as 2–15 donor DNAs, and more specifically, such as (but not limited to) 3, 5, 8, 10, or 12.

[0022] In one or more embodiments, the attB The nucleotide sequence of the site is shown in SEQ ID NO:3.

[0023] In one or more embodiments, the attP The nucleotide sequence of the site is shown in SEQ ID NO:4.

[0024] In one or more embodiments, the integrated / recombined gene (the target gene to be integrated / recombined) includes (but is not limited to): a gene, a gene fragment, a metabolic pathway gene module or gene cluster, a polycistronic, or an expression cassette expressing the gene, gene fragment, module or gene cluster, or polycistronic.

[0025] In one or more embodiments, the gene module or gene cluster includes a metabolic pathway gene module or gene cluster.

[0026] In one or more embodiments, the target gene to be integrated / recombined is 0.1–200 kb, for example 0.2, 0.5, 1, 1.5, 2, 5, 10, 15, 20, 30, 50, 80, 100, 120, 150, 180 kb.

[0027] In one or more embodiments, the target gene to be integrated / recombined may be the same or different in each round of integration / recombination.

[0028] In one or more embodiments, different screening markers are used in different rounds of integration / recombination to trace the target gene to be integrated / recombined in different rounds of integration / recombination.

[0029] In one or more embodiments, the screening markers include (but are not limited to): antibiotic resistance genes (such as apramycin resistance genes, kanamycin resistance genes, hygromycin B resistance genes, thiostreptococcal resistance genes, chloramphenicol resistance genes, or ampicillin resistance genes), auxotrophic complementary genes (such as... argB , pyrG or adeA ), fluorescent reporter genes (such as mCherry , EGFP or BFP ) and its combinations.

[0030] In one or more embodiments, the cells include prokaryotic cells or eukaryotic cells.

[0031] In one or more embodiments, the prokaryotic cells include (but are not limited to): Escherichia coli, Streptomyces, Polysporum spinosum (a non-patent actinomycete), or Rhodotorula gracilis.

[0032] In one or more embodiments, the eukaryotic cells include (but are not limited to): filamentous fungi or mammalian cells.

[0033] In one or more embodiments, when the cell does not contain an endogenous first integrase recognition attachment site, the first integrase recognition attachment site is introduced exogenously; preferably, the first integrase recognition attachment site and the expression cassette of the Se01 integrase coding gene are pre-integrated into the host genome to construct a cell carrying a landing pad.

[0034] In one or more embodiments, the genetic stability of the continuous DNA integration / recombination remains above 90% after multiple iterations, preferably 91.7–99.8% after 50 generations.

[0035] In another aspect of the invention, an application of SeO1 integrase is provided for continuous DNA integration / recombination in cells; said SeO1 integrase mediates... attB site and attP Site-specific integration / recombination between sites; the recombination retains integrity within the target DNA molecule (such as the host genome or plasmid). attB Identification site; wherein the continuous integration / recombination is n rounds of continuous DNA integration / recombination, where n is a positive integer ≥2.

[0036] In another aspect of the invention, a cellular DNA integration / recombination system is provided, wherein the cell may or may not contain a first integrase recognition attachment site, the system comprising: (a) Reorganization constructs used for the first round of integration / reorganization: (i) The gene encoding Se01 integrase or its gene expression cassette. (ii) The second integrase recognizes the attachment site. (iii) An optional first integrase recognition attachment site, provided that the site exists only if the cell does not contain the first integrase recognition attachment site. (iv) Donor DNA, which carries the target gene to be integrated / recombined. Optionally, (i)-(iv) are placed in the same or different recombination constructs or (i')-(iii'); (b) Reorganization constructs for further (rounds 2 to n) integration / reorganization: (i') The gene encoding Se01 integrase or its gene expression cassette. (ii') attP Identification site, (iii') Donor DNA, which carries the target gene to be integrated / recombined. Optionally, (i')-(iii') are placed in the same or different recombination constructs.

[0037] In another aspect of the invention, an application of the system is provided for continuous integration / recombination of DNA in cells; the continuous integration / recombination is performed in n rounds of continuous integration / recombination of the DNA, where n is a positive integer ≥2.

[0038] In one or more embodiments, the continuous integration / recombination of DNA in cells includes the reconstruction or modification of gene clusters (BGCs) in natural product biosynthesis, wherein the reconstruction or modification includes modular disassembly of gene clusters, analysis or optimization of synthetic pathways.

[0039] In one or more embodiments, the natural product includes spinosad, and the modification is to achieve multiple copy superposition of the spinosad biosynthetic gene cluster through multiple rounds of continuous insertion, thereby increasing the copy number of the gene cluster (e.g., from 1× to more than 2×, more than 3×, more than 4×, or more than 5×).

[0040] In another aspect of the invention, a kit is provided that includes the system described above; preferably, it also includes cells to be integrated / recombined.

[0041] In another aspect of the present invention, a method for metabolic engineering modification of spinosad systems based on continuous DNA integration is provided, comprising: continuously inserting spinosad biosynthesis gene clusters into *Polyspora spp.* using the aforementioned continuous DNA integration / recombination method, thereby increasing the copy number of the gene clusters from 1× to 2× or more (e.g., 3×, 4×, 5×, 8×, 10×, 15×, 20×); and / or, enhancing the rhamnose synthesis pathway; and / or, introducing an artificial NCM pathway to enhance the supply of short-chain -CoA precursors; optionally, combining other metabolic engineering strategies to thereby increase (preferably synergistically increase) spinosad production.

[0042] Other aspects of the invention will be apparent to those skilled in the art from the disclosure herein. Attached Figure Description

[0043] Figure 1 A schematic diagram of the construction of the pSe01 gene editing plasmid. oriT RK2 is a cis-acting element that is transferred to another component. traJ ,oriT recognizes proteins. aac(3)IV Apramycin resistance gene; ori colE1 replication origin site; xis The presumed gene encoding the excision enzyme; attP Site-specific re-attachment sites; Se01 The Se01 integrase encoding gene; lacZa Blue-white screening marker.

[0044] Figure 2 Before and after the restructuring attB / attP Consistency analysis of the core 56 bp sequence.

[0045] Figure 3 Efficiency of Se01-mediated site-specific integration. Integration efficiency of vectors containing donor DNA of different lengths.

[0046] Figure 4 Stability of Se01 integrase-mediated recombinant bacteria. Stability under continuous passage without selection pressure. Red: NHF132-pSe01-6 kb; Yellow: NHF132-pBAC-92 kb.

[0047] Figure 5 A schematic diagram of the Se01-mediated sequential insertion system. Each round of integration achieves iterative insertion by replacing the selection markers (pINT-1 to pINT-N). The att site sequence remains unchanged after recombination, providing complete identification sites for subsequent rounds. (See diagram.) att-n Indicates the complete reorganization retained after the (n-1)th round. attB The site provides an identification sequence for the next round of recombination.

[0048] Figure 6 Determination of the number of consecutive insertions in Escherichia coli. A schematic diagram of stepwise iterative insertion is shown, with multiple rounds of integration achieved by replacing the resistance marker in each round, for a total of 4 rounds of consecutive insertions (Round 0–4).

[0049] Figure 7 many att Genetic stability of recombinant strains at 2, 3, and 5 sites. att The genome retention rate of recombinant strains at the locus after 50 (white) and 100 (yellow) generations.

[0050] Figure 8Determination of the number of consecutive insertions in actinomycetes. A schematic diagram of the stepwise iterative insertion process was presented, employing the Kana→Apr→HYG resistance selection strategy, with a total of 3 rounds of consecutive insertions (Round 1–3). (A) Consecutive insertion of a 6 kb small vector (pSe01 backbone). (B) Consecutive insertion of a 92 kb large vector (BAC backbone, gene cluster).

[0051] Figure 9 The variation of successive insertion efficiency with insertion rounds in actinomycetes. (A) 6 kb small fragment. (B) 92 kb large fragment. The red bars represent the number of conjugates, and the black line represents the improvement factor relative to the first round.

[0052] Figure 10 The effect of BGC copy number on spinosad production. Using wild-type NHF132 as a control, the spinosad (spinosad A / D) production of recombinant strains containing 1–3 additional BGC copies was tested.

[0053] Figure 11 Stability of Se01 integrase-mediated BGC multicopy recombinant bacteria. Genetic stability of NHF132-3BAC (3 spinosad BGC copies, repetitive fragment approximately 300 kb) under continuous passage without antibiotic selection pressure (rounds 1–5, 10–50 days).

[0054] Figure 12 Se01-mediated iterative systems metabolic engineering enhances spinosad production. Using wild-type NHF132 as a control, the spinosad (spinosad A / D) production of recombinant strains containing 1–3 additional BGC copies (integrating rhamnose overexpression and the NCM pathway) was measured.

[0055] Figure 13 Modular reconstruction strategy of spinosad BGC based on Se01 integrase. (A) Functional partitions of spinosad BGC: PKS module (red), intramolecular C-C bond formation (gray), rhamnose synthesis (purple), rhamnose post-modification (blue), and glutamine synthesis (green). (B) Schematic diagram of stepwise reconstruction under the continuous insertion strategy.

[0056] Figure 14 Summary of LC-MS analysis of spinosad BGC reconstruction. Extracted ion chromatograms show characteristic product peaks for each strain: 1, spinosad A (… m / z 732.4681 [M+H] + 1. Retention time ~9.1 min); 2. AGL ( m / z 403.2479 [M+H] + 3. Retention time ~11.5 min); PSA ( m / z 591.3528 [M+H]+ (Retention time ~10.8 min). (i) Del14-Spn-BAC (ii) Positive control; Del14-Spn-0 (Negative control); (iii) Del14-Spn-1 (PKS module); (iv) Del14-Spn-2 (PKS and Rhamnose Module); (v) Del14-Spn-3 (Complete BGC refactoring)

[0057] Figure 15 based on attB A schematic diagram of the multi-round integration process for pre-implantation at the landing site. Pre-implantation of Se01 integrase and... attB Site strategy: First, introduce the Se01 integrase expression cassette and... attB Sites (such as Aspergillus oryzae AO-60) are then used for multiple rounds of iterative integration. Blue / purple circles represent iterative integration plasmids.

[0058] Figure 16 Verification of the integration function of Se01 integrase in Rhodotorula glutinis. (A) Screening of conjugates on NA+Apr double antibody plate after conjugation transfer (left) and single colony streak verification (right). (B) Schematic diagram of the structure of pSe01 integrated into Feature 16 site of the HY01 genome, with red arrows indicating the location of verification primers and sequencing results.

[0059] Figure 17 Validation of the integration function of Se01 integrase in Aspergillus oryzae AO-61. (A) Transformants obtained by arginine auxotrophic screening. (B) Genomic PCR validation (M: DNA molecular weight standard; 1-5: different validation primer pairs). (C) Schematic diagram of the genome structure after pYX181-ArgB integration. Red arrows indicate sequencing results. gene1 (E)-β-farnesene synthase TS4 Reporter genes.

[0060] Figure 18 Genetic stability of recombinant Aspergillus oryzae strains. AO-60 (containing 1) att (site) and AO-61 (containing 2 sites) att Genetic stability analysis of the locus (R1–R7) under no selection pressure for 7 consecutive passages (35 days).

[0061] Figure 19 A Se01-mediated, multi-round, sequential integration system of three plasmids in HEK293T cells. The first round consists of integrase expression plasmid pWA01 (containing Se01 and mCherry), donor plasmid pWA02 (containing... attP and promoterless EGFP) and receptor plasmid pWA03 (containing attBComposed of (and CMV promoter); SeO1 catalysis attP × attB Recombination resulted in the fusion plasmid pWA04, which was expressed with EGFP. Subsequent rounds used the previous round's recombination product (retaining the attB site) as the recipient plasmid, and introduced new... attP - Donor plasmids enable iterative integration.

[0062] Figure 20 Multiple rounds of sequential integration fluorescence images mediated by Se01 in HEK293T cells. (A) First round: Top, pWA01 only (Se01+mCherry); Middle, pWA02 / pWA03 only (without integrase); Bottom, co-transfected pWA01 / pWA02 / pWA03 (three plasmids). From left to right: bright field, GFP, mCherry, and merged channel. Green fluorescence indicates integration events, and red fluorescence indicates Se01 expression. Scale bar: 200 μm. (B) Channels and merged images of the second round three-plasmid system (pWA01 / pWA04 / pWA08). (C) Channels and merged images of the third round three-plasmid system (pWA10 / pWA09 / pWA11). The second and third round control groups were set up the same as in (A), and the results were similar, so they were not shown again. Scale bar: 200 μm.

[0063] Figure 21 Efficiency of Se01-mediated multi-round continuous integration in HEK293T cells. (A) First round: GFP positivity rate 2 days after transfection. Red: pWA01 only; White: pWA02 / pWA03 only; Green: Three-plasmid system. (B) Second round: BFP positivity rate 2 days after transfection. Red: pWA01 only; Green: pWA04 / pWA08 only; Blue: Three-plasmid system. (C) Third round: mCherry positivity rate 2 days after transfection. White: pWA10 only (integrase control); Blue: pWA09 / pWA11 only; Red: Three-plasmid system. Detailed Implementation

[0064] Through in-depth research, the inventors have revealed a method for continuous DNA integration based on Se01 integrase, overcoming the technical bottleneck of "site inactivation after single integration" in existing technologies. This method enables multi-round, large-fragment, and efficient iterative insertion of the same target DNA molecule (such as the host genome or plasmid) at multiple sites. The invention also provides examples of applying this method to the efficient synthesis of target compounds and the modular reconstruction of large biosynthetic gene clusters (BGCs).

[0065] As used herein, “operationally linked” or “operationally linked” refers to the functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences.

[0066] As used herein, an "expression cassette" or "gene expression cassette" refers to a gene expression system containing all the necessary elements required to express a target protein. Typically, it includes the following elements: a promoter, a gene sequence encoding the protein, and a terminator; additionally, it may optionally include a signal peptide coding sequence, etc.; these elements are operatively linked.

[0067] As used herein, an "expression construct" or "expression building block" refers to a recombinant DNA molecule containing a desired nucleic acid coding sequence, which may contain one or more gene expression cassettes. These "constructs" are typically contained within an expression vector.

[0068] As used herein, "exogenous" or "heterogeneous" refers to the relationship between two or more nucleic acid or protein (protein) sequences from different sources, or the relationship between nucleic acids or proteins from different sources and host cells. For example, if the combination of nucleic acid / protein with a host cell is not typically native, then the nucleic acid is exogenous to that host cell. A particular sequence is "exogenous" to the cell or organism in which it is inserted.

[0069] As used herein, the "integrase recognition attachment site" is a DNA sequence with a specific structure, usually a short, asymmetric but partially homologous sequence (dozens of base pairs), which is the target site for recognition and catalysis by the site-specific recombinase—integrase.

[0070] In this invention, the Se01 integrase has the amino acid sequence shown in SEQ ID NO:1, and also includes its variants, particularly its conserved variant proteins. A “conserved variant protein” is a protein that substantially retains the same biological function or activity as the protein described herein. The “conserved variant protein” may be (i) a protein in which one or more conserved or non-conserved amino acid residues (preferably conserved amino acid residues) are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code; or (ii) a protein having substituent groups in one or more amino acid residues; or (iii) a protein formed by fusing a mature protein with another compound (e.g., a compound that extends the protein's half-life, such as polyethylene glycol); or (iv) a protein formed by fusing an additional amino acid sequence to this protein sequence (e.g., a leader sequence, secreted sequence, or sequence used to purify this protein, or the proteoprotein sequence). Based on the teachings herein, these fragments, derivatives, and analogs are within the scope well known to those skilled in the art.

[0071] The Se01 integrase of the present invention can be a recombinant protein, a natural protein, or a synthetic protein. It can be a naturally purified product, a chemically synthesized product, or a product produced from a prokaryotic or eukaryotic host (e.g., bacteria, yeast, higher plants) using recombinant technology.

[0072] The nucleic acid encoding the Se01 integrase of the present invention may include a coding strand or a non-coding strand. The term "polynucleotide encoding a protein" may include a polynucleotide encoding this protein, or it may include a polynucleotide with additional coding and / or non-coding sequences.

[0073] This invention also relates to vectors containing Se01 integrase encoding nucleic acids or expression cassettes, host cells genetically engineered using the vectors or protein-coding sequences of this invention, and methods for generating the proteins described in this invention via recombinant technology. The expression vectors (expression constructs) can be established using techniques familiar to those skilled in the art. Once the desired enzyme and the desired cell system for expression are known, those skilled in the art can establish the expression constructs. Gene sequences can be inserted into different expression constructs (such as expression vectors) or into the same expression construct, as long as the encoded protein can be effectively expressed and exert its activity after being transformed into cells.

[0074] In a preferred embodiment of the present invention, the cell (host cell) may be a prokaryotic cell, preferably including (but not limited to) Escherichia coli, Streptomyces, Polysporum spp. (a non-model actinomycete) or Rhodotorula spp.

[0075] In a preferred embodiment of the invention, the cell (host cell) may be a eukaryotic cell, and preferably may include (but is not limited to) filamentous fungi or mammalian cells.

[0076] Host cells are a production tool, and those skilled in the art can modify various host cells using various technical means to suit the technical solutions of this invention. The resulting recombinant cells and their preparation methods should also be included in this invention. For example, the optimization and establishment of optimized engineered cells using methods known in the art, such as codon optimization, protein variant screening, and enzyme activity enhancement methods, are also included in this invention.

[0077] Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. The resulting transformants can be cultured using conventional methods, and the culture medium used can be well known in the art, under conditions suitable for cell growth.

[0078] In a preferred embodiment of the present invention, a cellular DNA integration / recombination system is provided, wherein the cell may or may not contain a first integrase recognition attachment site, the system comprising: (a) a recombinant construct for first-round integration / recombination: (i) a gene encoding SeO1 integrase or a gene expression cassette, (ii) a second integrase recognition attachment site, (iii) an optional first integrase recognition attachment site, provided that the site is present only if the cell does not contain the first integrase recognition attachment site, (iv) donor DNA carrying the target gene to be integrated / recombined, optionally, (i)-(iv) being placed in the same or different recombinant constructs; and (b) a recombinant construct for further (second to nth rounds) integration / recombination: (i') a gene encoding SeO1 integrase or a gene expression cassette, (ii') attP Recognition site, (iii') donor DNA, which carries the target gene to be integrated / recombined, optionally, (i')-(iii') are placed in the same or different recombinant constructs.

[0079] In this invention, the integrase recognizes attachment sites ( att )for attB site, attP Site. attB site and attP The sites are two core DNA sequences in a site-specific recombination system. According to... attB site, attP The characteristics of the site, when designing integration / recombination systems attB site, attP The site is set at an operable location, as would be known to those skilled in the art.

[0080] In a more preferred embodiment, the three-plasmid system is used for DNA integration / recombination, comprising: an expression vector containing a gene encoding the SeO1 integrase and a first selection marker; and a donor plasmid containing the... attP Site, the foreign DNA fragment to be inserted, and a second selection marker; recipient plasmid or host genome, containing the aforementioned... attB Loci and third screening markers.

[0081] In a more preferred embodiment, the Se01 integrase and the reporter gene are expressed by fusion via the self-cleaving peptide P2A, wherein the reporter gene is selected from mCherry, EGFP, or BFP.

[0082] In a preferred embodiment of the present invention, the plasmid system is introduced into a host cell to induce SeO1 integrase-mediated... attB and attPRecombination involves integrating a foreign DNA fragment into a target DNA molecule (such as a host genome or plasmid) to obtain a first-generation recombinant; using the first-generation recombinant as a host, step (a) is repeated to introduce a new donor plasmid for a second round of integration; optionally, the above steps are repeated for an nth round of integration, where n≥2, preferably n≥3.

[0083] The beneficial effects of the technical solution of the present invention include: (1) Site iterability: Unlike traditional integration systems such as phiC31 (where the site disappears after one integration), Se01 retains the complete site after integration. att The site can achieve at least 3 consecutive insertions in the same host, with a single insertion capacity of 6–137 kb.

[0084] (2) Increasing efficiency: As the number of iterations increases, the integration efficiency is significantly improved (e.g., the efficiency of the 3rd round is higher than that of the 1st round), overcoming the limitation of low efficiency of direct conversion of large DNA fragments.

[0085] (3) Genetic stability: After multiple rounds of insertion, the strain was continuously passaged for 60 days (prokaryotic) or 30 days (fungal) without selection pressure, and the inserted fragment remained 100% stable with no off-target amplification.

[0086] (4) Cross-species universality: complete iteration is achieved in prokaryotes (Escherichia coli, Actinomycetes); efficient single-round integration (positive rate 30%) is achieved in fungi (Aspergillus oryzae); and continuous insertion is achieved in mammalian cells (HEK293T) under a 2–3 round transient transfection system.

[0087] The invention will be better understood from the following examples. However, those skilled in the art will understand that the specific methods and results are merely for illustrating the invention and not for limiting it. Experimental methods in the following examples that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Science Press, or according to the manufacturer's recommendations.

[0088] I. Materials and Methods

[0089] 1. Strains, cells, and culture conditions

[0090] Bacterial strains are listed in Table 1. Escherichia coli was cultured on LB medium at 37°C. Sa. spinosa The strain was cultured in 2CMC medium (10 g soluble starch, 1 g NaCl, 2 g tryptone, 2 g casein amino acids, 2 g (NH4)2SO4, 1 g K2HPO4, 2 g MgSO4, 1 mg FeSO4). 7H2O, 1 mg ZnSO4 Dissolve 7H2O, 2 g CaCO3 and 20 g agar in 1 L distilled water (pH 7.2) and incubate at 30℃. S. albidoflavus Cultured on MS medium at 30°C. Rhodotorula glutinis were cultured on seed culture medium or TSB medium at 32°C; Aspergillus oryzae were cultured on DPY medium at 30°C; HEK293T cells were cultured on DMEM medium containing 10% fetal bovine serum and 1% penicillin-streptomycin at 37°C and saturated humidity with 5% CO2.

[0091] Table 1

[0092] 2. Plasmid Construction

[0093] Key plasmids included the integrase expression and donor vectors pSe01 series (suitable for small fragments), pBAC2015 series (suitable for large gene clusters, such as spinosad BGC), and a mammalian cell three-plasmid system (pWA01, pWA02, pWA03 and their derivatives). Plasmids were constructed using conventional molecular cloning methods; primers were synthesized by a commercial company, and the constructed products were verified by sequencing. The plasmids are listed in Table 2.

[0094] Table 2

[0095] Primers used for plasmid construction and PCR validation are listed in Table 3.

[0096] Table 3

[0097] 3. Genetic manipulation methods

[0098] Actinomycetes (Saccharomyces cerevisiae, Streptomyces albopictus): Biparental conjugation transfer was employed. Recipient cells (mycelium or pre-germinating spores) were mixed with donor Escherichia coli S17-1 (carrying recombinant plasmid) in equal or appropriate proportions, spread on antibiotic-free plates, and incubated at 30°C for 16–20 h. The mixture was then covered with a selection solution containing naridinolone acid (NA) and the corresponding antibiotic, and incubated for another 5–14 days. Conjugates were verified by resistance phenotype and PCR.

[0099] Rhodopseudomonas aeruginosa: Transfer was performed using biparental conjugation. Recipient cultured to OD... 700 The value was 1.0, and the donor E. coli S17-1 was cultured to OD. 600 The donor and recipient ratio was 0.5, and the mixture was prepared at a ratio of 1:3. After assisted conjugation via a filter membrane, the mixture was spread on a seed solid medium containing kanamycin (50 μg / mL) and NA (5 μg / mL) for screening. Double exchangers were enriched by antibiotic resistance plates and sucrose reverse screening.

[0100] Aspergillus oryzae: Protoplast-PEG conversion method was used. Mycelia were hydrolyzed with lyase and yatalase for 3 h to prepare protoplasts (10... 8 -10 9 After incubating plasmid DNA (10–15 μg) on ​​ice for 1 h, the cells were transformed using PEG4000, plated on the corresponding auxotrophic medium for screening, and verified by colony PCR and sequencing.

[0101] HEK293T cells: Transfected using the PEI method. Cells were seeded in 24-well plates (6 × 10⁶ cells / well) 18–24 h before transfection. 4 Plasmid DNA (150–500 ng) and PEI (40 kDa, 1 mg / mL) were mixed in serum-free DMEM at a mass ratio of 3:1 and allowed to stand at room temperature for 15–20 min to form a complex. The complex was then added dropwise to the culture wells and cultured at 37°C and 5% CO2 for 6 h. The culture medium was then replaced with complete medium. The integration efficiency was detected by fluorescence microscopy and flow cytometry 24–48 h after transfection.

[0102] 4. Stability test of recombinant bacteria after continuous passage

[0103] *Saccharomyces cerevisiae*: Recombinant bacteria were activated on 2CMC plates containing antibiotics, then inoculated into TSB liquid medium (containing the corresponding antibiotic) and cultured for 3 days. After serial dilution, the bacteria were plated on antibiotic-free plates, and single colonies were randomly picked and copied onto plates containing / without antibiotics to calculate the antibiotic retention rate. Simultaneously, colony PCR was used to verify the upstream and downstream interfaces of the insert fragment. The bacteria were passaged 5–6 times (approximately 50–60 days).

[0104] Escherichia coli: Recombinant bacteria were cultured overnight on antibiotic-containing LB medium (approximately 10 generations). After centrifugation and washing to remove residual antibiotics, they were transferred to antibiotic-free LB medium at an inoculum of 0.1%, and repeated 10 times (approximately 100 generations). The resistance retention rate was determined by photocopying.

[0105] 5. Fermentation and Product Detection

[0106] Recombinant strains of *Streptomyces oryzae* and *Streptomyces albopictus* were seed cultured (TSB, 30℃, 2 days) and then transferred to fermentation medium at a 10% inoculum. The cultures were incubated at 30℃ and 220 rpm for 5–8 days. The fermentation broth was extracted with acetonitrile, centrifuged, and filtered. Detection was performed using an HPLC system (Agilent 1100 series) equipped with a C18 reversed-phase column. The mobile phase was acetonitrile / 0.1% formic acid aqueous solution with gradient elution, and the detection wavelength was 245 nm. Biomass (DCW) was determined by centrifugation, washing, drying to constant weight.

[0107] 6. Aspergillus oryzae CRISPR / Cas9 gene editing system

[0108] A dual plasmid system was used: pCas9-sgRNA plasmid (containing Cas9, AMA1 replication element, pyrG selection marker and targeting sgRNA) and donor repair plasmid (containing target gene and ≥1 kb homologous arm) were co-transformed into protoplasts. Transformants were obtained by screening for uracil deficiency. After relaxation culture, AMA1 plasmid loss strains were screened by photocopying. Genotypes were verified by PCR and sequencing.

[0109] II. Examples

[0110] Example 1: Screening and bioinformatics analysis of Se01 integrase

[0111] The inventors reviewed existing site-specific integration systems, focusing on... attB / attP Sites before and after recombination attL / attR The transformation, and focusing on a single plant Saccharopolyspora endophytica YIM61095 originates from AICEs belonging to the tyrosine recombinase family. Following systematic nomenclature, this element is named Se01. Its recombinase gene coding region is 1488 bp in length and can be translated into a monomeric protein containing 495 amino acids with a molecular weight of 55.8 kDa. Se01... attP The site is 290 bp in length, with a core sequence of 56 bp (positions 103–158 in SEQ ID NO: 3), corresponding to... attB The sites are completely identical, possessing the potential for continuous integration.

[0112] Example 2: Verification of the integration function of Se01 integrase in actinomycetes

[0113] To systematically evaluate the basic functions and systemic characteristics of Se01 integrase, the inventors first used primer pair AICE-HR-F / R for PCR amplification, transferring the integrase derived from... Sa. endophytica The integrated functional module on the endogenous plasmid pCM32 (Shanghai Normal University) in YIM61095 ( xis - Se01 - attP The 2215 bp gene was cloned into the Streptomyces universal integration vector pSET152 to obtain the pSe01 gene-editing plasmid, which was used for subsequent functional verification and characterization analysis. Figure 1 ).

[0114] To further verify the basic integration function of Se01 integrase, it was applied to spinosad-producing strains. Sa. spinosa (NHF132; naturally present on the genome) attBConstruction of a genetic manipulation system (site-specific). The NHF132-pSe01 conjugate was obtained through biparental conjugation transfer between *E. coli* and *Actinomyces* species, and PCR and sequencing were performed using primer pairs 132-up-vF / R and 132-dn-vF / R for verification. The results showed that plasmid pSe01 was successfully integrated into the host genome, and that the Se01 integrase-mediated genetic manipulation... attB / attP The core 56 bp sequence remained intact after recombination, indicating that the enzyme possesses the potential for iterative integration. Figure 2 ).

[0115] To explore the editing upper limit of the Se01 integration system, the inventors constructed a series of pSe01-donor plasmids (6–137 kb, containing a backbone) carrying donor DNA fragments of different lengths. Among them, the 6 kb plasmid is a pSe01 blank vector (containing the Se01 integrase expression cassette, ... attP The 9.6 kb plasmid contains a rhamnose synthesis gene cluster (approximately 3.6 kb) inserted into the pSe01 backbone; the 13.2 kb plasmid contains a rhamnose synthesis gene cluster inserted into the pSe01 backbone. sco6196 Gene expression cassettes; a 91.2 kb plasmid containing the pBAC2015 backbone (including the Se01 expression cassette and an approximately 81 kb spinosad biosynthesis gene cluster); and a 136.6 kb plasmid containing the pBAC2015 backbone (including the Se01 expression cassette, an approximately 81 kb spinosad biosynthesis gene cluster, and flanking genes). Integration efficiency was assessed by the ratio of positive clones to the total number of actinomycete recipients via E. coli-actinomycete conjugation transfer.

[0116] The results showed that although the integration efficiency decreased slightly with the increase of exogenous fragment length, it remained at 1×10⁻⁶. -5 The above demonstrates that this system can efficiently mediate the integration of large DNA fragments ranging from 6 to 137 kb, covering the size range of most natural product biosynthetic gene clusters. Figure 3 ).

[0117] Example 3: Stability of Se01 integrase-mediated single-integration recombinant bacteria

[0118] Recombinant strains NHF132-pSe01-6 kb and NHF132-pBAC-92 kb (BAC backbone containing Se01 expression cassette and spinosad biosynthesis gene cluster) were continuously passaged without selection pressure.

[0119] The results showed that the integration of a 6 kb small fragment could be stably maintained for more than 60 days, and the integration of a 92 kb large fragment could be maintained for more than 50 days, with a genome retention rate of nearly 100%. Figure 4This indicates that the Se01 integrase-mediated recombinant bacteria have excellent stability, meeting the requirements of industrial fermentation production.

[0120] Example 4: Construction of a continuous insertion system in prokaryotes

[0121] SeO1-mediated recombination reaction preserves the integrity of the product. attB / attP Based on the characteristics of the recognition site, an iterative multi-round insertion system was designed. The core strategy of this system is: in each round of integration reaction, effective selection of transformants is achieved by replacing different selection marker genes (resistance genes or fluorescent reporter genes), while utilizing Se01 recombination... att The invariant nature of the site sequence preserves the complete identification site for the next round of insertion. Figure 5 ).

[0122] Construction of iterative insertion vectors: Based on the antibiotic susceptibility test results, a series of iterative insertion vectors containing different selection markers were constructed. The resistance selection vectors include: pSe01-Apr, pSe01-Kana, pSe01-Chl, pSe01-Amp-HYG, and pSe01-Amp-Tsr (where Amp is used for clone selection in *E. coli*). The fluorescent reporter vectors include: pGFP-Apr, pGFP-Kana, pGFP-Chl, pGFP-Amp, pGFP-Tet, and pCherry-Apr, pCherry-Kana, pCherry-Chl, pCherry-Amp, and pCherry-Tet (all containing...). attP (Location). The aforementioned vectors are used for subsequent continuous insertion efficiency testing and functional characterization.

[0123] Example 5: Continuous insertion system in Escherichia coli

[0124] First, a Se01-mediated sequential insertion system was established in *E. coli* DH10b. This was because the *E. coli* DH10b genome lacks natural... attB First, the donor plasmid pSe01-DH-HR was constructed, and the donor fragment (containing the Apr resistance gene) was amplified using the primer pair Anti-up-HR-F / R. aac(3)IV (Se01 integrase gene and its upstream and downstream homologous arms). Using Rec / ET recombination technology, the above fragment was integrated into the DH10b genome. lacZ-lacI The region was introduced with the Se01 integrase gene and attB site ( Figure 6 The artificial recombinant strain DH10b-Apr-Se01 (Round 0) was obtained as the starting strain.

[0125] Round 0 strains were prepared as competent cells and transformed into the previously constructed iterative insertion vector pSe01-Kana, resulting in the recombinant strain DH10b-Apr-Se01-pKana (Round 1). These were then sequentially transformed into pSe01-Chl, pCherry-Tet, and pGFP-Amp to obtain the recombinant strains DH-AK-Chl (Round 2), DH-AKC-Cherry (Round 3), and DH-AKC-CT-GFP (Round 4), respectively. Anti-inflammatory phenotype screening and colony PCR validation confirmed that Se01 integrase mediates multi-round iterative integration of exogenous DNA into *E. coli*.

[0126] Example 6: Stability of Se01 integrase-mediated recombinant bacteria with multiple integrations

[0127] The Round 1, Round 2, and Round 4 recombinant E. coli strains were inoculated into LB broth containing the corresponding antibiotics and cultured at 37°C with shaking at 220 rpm. After overnight incubation to saturation, the cultures were subcultured 1:1000 and passaged 10 times (approximately 100 generations). The culture was serially diluted and plated onto LB agar plates containing / without antibiotics, incubated overnight at 37°C, and colonies were counted. Single colonies were randomly selected for colony PCR verification and sequencing analysis.

[0128] The results showed that recombinant strains Round 1, Round 2, and Round 4 maintained high genetic stability (>99%) during successive passages. Figure 7 ).

[0129] The above results indicate that the Se01-mediated integration system can achieve multi-site iterative editing, and the recombinant strain maintains high stability (>90%) within 50 generations, meeting the needs of short-term amplification culture of industrial strains.

[0130] Example 7: Continuous Insertion System in Actinomycetes

[0131] A Se01-mediated sequential insertion system was established in the spinosad-producing strain *Polyspora spp.* NHF132. Figure 8 Conjugation transfer of donor plasmids (pSe01 or BAC backbone) containing kanamycin (Kana), apramycin (Apr), and hygromycin B (HYG) resistance genes was performed sequentially. The Kana→Apr→HYG resistance selection sequence was used.

[0132] First, the insertion efficiency of the small donor plasmid was tested sequentially. pSe01-Kana, pSe01-Apr, and pSe01-Amp-HYG were then transferred sequentially to obtain recombinant strains NHF132-Kana, NHF132-Kana-Apr, and NHF132-Kana-Apr-HYG, respectively. Resistance phenotype screening and colony PCR verification confirmed that the Se01 integrase can mediate multiple rounds of iterative integration of exogenous DNA into *Saccharomyces cerevisiae*.

[0133] Example 8: Multi-round large fragment integration in actinomycetes

[0134] Further sequential insertion tests were conducted on large donor plasmids. Figure 8 B). Using the pBAC2015-81 kb plasmid (containing 81 kb spinosad BGC) previously constructed in the laboratory as a backbone (Nucleic Acids Research; Activating cryptic biosynthetic gene cluster through a CRISPR-Cas12a-mediated direct cloning approach; 2022), the original phiC31- was recombinated using Red / ET recombination technology. attP The integrated system was replaced with Se01- attP An integrated system was developed, and different selection markers were introduced sequentially to construct a series of iterative insertion vectors: pBAC-Spn-Kana, pBAC-Spn-HYG, and pBAC-Spn-Apr. The correctness of the vector construction was verified by resistance phenotype screening and colony PCR. Recombinant strains of NHF132-1BAC, NHF132-2BAC, and NHF132-3BAC were obtained via conjugation transfer. The results indicate that Se01 integrase can mediate the efficient and continuous integration of ultra-large DNA fragments (such as various BGCs) in actinomycetes.

[0135] In iterative continuous insertion tests, it was found that the adjoining transfer efficiency significantly improved with increasing rounds. Figure 9 When small donor plasmids are inserted consecutively, the conjugation transfer efficiency is increased by 18.5 times and 54.0 times respectively compared to the first round; when large donor plasmids are inserted consecutively, the conjugation transfer efficiency is increased by 1.4 times and 2.1 times respectively compared to the first round. This "self-reinforcing" effect gives the Se01 system a unique advantage in multi-round iterative applications, enabling highly efficient editing that "gets faster with each use."

[0136] Example 9: Se01 integrase enhances spinosad biosynthesis in actinomycetes through multiple copies of BGC.

[0137] To further investigate the upper limit of the sequential insertion capacity of Se01 integrase and evaluate the effect of multiple BGC copies on spinosad production, shake-flask fermentation was performed using NHF132 wild-type as a control, with NHF132-1BAC, NHF132-2BAC, and NHF132-3BAC as samples. The results showed that spinosad production increased in a gradient with increasing BGC copy number. Figure 10 The yields of spinosad were as follows: NHF132-1BAC reached 364.9 mg / L (30.8% higher than wild type), NHF132-2BAC reached 403.2 mg / L (+44.5%), and NHF132-3BAC reached 442.4 mg / L (+58.6%). These results indicate that the Se01-mediated BGC multi-copy strategy can effectively increase the yield of spinosad.

[0138] The recombinant strain NHF132-3BAC was subjected to continuous passage without selection pressure. The results showed that the continuously integrated strain containing three copies of spinosad BGC (repetitive fragment approximately 300 kb) could be stably maintained for more than 50 days, with a genome retention rate of nearly 100%. Figure 11 The above results demonstrate that the Se01 integrase-mediated BGC multicopy recombinant bacteria exhibit excellent stability and can meet the needs of industrial fermentation production.

[0139] Example 10: Enhancement of spinosad biosynthesis in actinomycetes by Se01 integrase through systems metabolic engineering

[0140] Based on the Se01 sequential insertion system, and building upon pBAC-Spn (containing spinosad BGC), a multi-strategy integrated donor construct was further constructed by sequentially inserting and integrating a rhamnose overexpression module and an NCM artificial pathway expression module. Recombinant strains NHF132-1BAC-Rham-NCM, NHF132-2BAC-SP43-NCM, and NHF132-3BAC-SP43-NCM were obtained sequentially via conjugation transfer. Shake-flask fermentation results showed that spinosad production significantly increased with increasing BGC copy number and the synergistic introduction of rhamnose overexpression and the artificial NCM pathway. Figure 12 The yields of NHF132-1BAC-SP43-NCM reached 1405.40 mg / L (+429.20%), NHF132-2BAC-SP43-NCM reached 1482.10 mg / L (+448.44%), and NHF132-3BAC-SP43-NCM reached 1608.66 mg / L (+495.27%).

[0141] The above results indicate that the Se01 continuous insertion system overcomes the bottleneck of iterative modification caused by single inactivation in traditional integrated systems, providing an efficient genetic manipulation platform for the rapid stacking and system optimization of multiple modules in complex natural product cell factories, and significantly improving the synthesis level of spinosad.

[0142] Example 11: Application of Se01 integrase in modular reconstructing of natural product BGC

[0143] The biosynthetic pathway of spinosad can be broadly divided into three functional modules: polyketide synthase (PKS), rhamnose synthesis, and forosamine synthase. The corresponding intermediates are glycoside (AGL) and pseudoglycoside (PSA), and the final product is spinosad A / D. To eliminate background interference, a model *Streptomyces* strain was selected. S. albus Del14 (Generation of a cluster-free Streptomyces albus chassis strains for improved heterologous expression of secondary metabolite clusters; 10.1016 / j.ymben.2018.09.004) is used as the chassis, and this approach is reconstructed step by step through the Se01 continuous insertion system. Figure 13 ).

[0144] Based on the boundaries of each module, a series of modular plasmids were constructed: p15A-PKS-FJLM (containing PKS and CC bond formation modules); pSe01-HYG-Rham (containing rhamnose synthesis and modification modules); and pSe01-Tsr-Foro (containing glutamine synthesis modules). Following the resistance sequence of Apr→HYG→Tsr, the plasmids were sequentially introduced into Del14 via three rounds of conjugation transfer to obtain Del14-Spn-1 (expected to produce AGL), Del14-Spn-2 (expected to produce PSA), and Del14-Spn-3 (expected to produce spinosad A). The pBAC-Spn-Apr strain containing intact BGC was used as a positive control (Del14-Spn-BAC), and the unmodified Del14 strain was used as a negative control (Del14-Spn-0).

[0145] The recombinant strain was fermented in shake flasks, and the product was extracted with acetonitrile, concentrated, and then detected by HPLC-QE (PDA 245 nm). The degree of glycosylation modification was negatively correlated with the retention time in reversed-phase chromatography: glycosylated AGL had the lowest polarity and the longest retention time, followed by monosaccharide PSA, and the disaccharide spinosad A had the shortest. The actual retention times were 11.48 min for AGL, 10.75 min for PSA, and 9.11 min for spinosad A, consistent with theoretical predictions. Figure 14 The corresponding expected products were detected sequentially in each module strain, confirming that the Se01 continuous insertion system can realize the modular stepwise reconstruction and functional verification of complex natural product BGC.

[0146] Example 12: Se01- att Engineering Implantation Strategy for Integrated Systems

[0147] To expand the species universality of Se01 integrase, the study investigated whether chassis strains contained natural integrase. att Two strategies were designed for the site. One strategy was for identifying naturally occurring Se01 carriers. attB Strains at specific sites (such as Streptomyces and some actinomycetes) can be directly used with... attP Insertion testing was performed on donor constructs; for those without natural... att The substrate of the site (such as E. coli and fungi) is then modified using gene editing techniques. attB Landing sites (and Se01 integrase expression cassettes, depending on host characteristics) are pre-implanted into the host genome or target DNA molecules, establishing a system based on... attB A general procedure for pre-implantation at the landing site. The method of integrase delivery is adjusted according to the host's genetic manipulation characteristics: in conjugation transfer systems, the integrase can be provided transiently by the donor bacteria; in protoplast transformation systems, the integrase expression cassette must be pre-integrated into the host genome to ensure stable expression of the integrase during recombination. Figure 15 ).

[0148] Example 13: Integration of Se01 integrase in Rhodopseudomonas cocci.

[0149] Rhodopsylloides ( R. sphaeroides HY01 does not contain the natural recognition site for Se01. In conjugation transfer systems, the Se01 integrase can be transiently provided by the donor *E. coli*, thus requiring only pre-implantation into the host genome. attB Landing site. (The text appears to be incomplete and contains several grammatical errors. A more accurate translation would require the full context.) attB Fragments from the locus and approximately 500 bp Feature 16 homologous arms flanking it were cloned into the pK18mobsacB suicide vector, and introduced into HY01 via conjugation transfer. After resistance selection and sucrose reverse selection, the double-crossover recombinant strain HY01- was obtained. attB .

[0150] will contain attP The donor construct pSe01 is introduced into HY01 via conjugation transfer. attB After screening with NA+Apr double antibodies and purification by streak, PCR amplification and sequencing verification were performed using primer pairs HY01-up-vF / 132-up-vR and 132-dn-vF / HY01-dn-vR. Figure 16 ).

[0151] The results showed that pSe01 was successfully integrated into the pre-defined genome. attB Sites, upstream and downstream sequences of the integration region and attB No mutations were found at any of the sites, indicating that Se01 integrase can mediate site-specific recombination in Rhodotorula glomerulosa.

[0152] Example 14: Integration and genetic stability of Se01 integrase in Aspergillus oryzae

[0153] To establish the Se01 integration system in Aspergillus oryzae, the first step was to integrate it into the Aspergillus oryzae AO NSAR1 ( niaD - , sC - , ΔargB, adeA - Pre-implantation at the HS801 site on chromosome 8 of the genome attB Landing site. Using CRISPR-Cas9-assisted homologous recombination, the Aspergillus oryzae codon-optimized Se01 integrase expression cassette and... attB The site (approximately 1.3 kb homologous arms on each side) was inserted into the site, and after uracil auxotrophic screening and relaxation culture to eliminate the edited plasmid, a stable chassis strain AO-60 was obtained.

[0154] Using AO-60 as the receptor, an ingredient containing... attP The donor construct pYX01-ArgB, containing the site and reporter gene, was used to obtain the recombinant strain AO-61 through arginine auxotrophic selection. PCR and sequencing verification showed that the donor construct successfully integrated into the pre-defined site. attB Sites, integration regions and attB No mutations were found at any of the sites, indicating that Se01 can mediate site-specific recombination in Aspergillus oryzae. Figure 17 ).

[0155] For AO-60 (1 unit) att (site) and AO-61 (2 sites) att The site was passaged continuously without selection pressure (for more than 35 days), with PCR verification performed at each round. Results showed that the inserted fragment was stably maintained, and no significant loss was observed. Figure 18 This indicates that Se01 possesses site-specific integration capability and excellent genetic stability in eukaryotic fungi.

[0156] Example 15: Integration and sequential insertion of Se01 integrase in mammalian cells

[0157] Since HEK293T cells lack a natural recognition site for Se01 integrase, a three-plasmid transient transfection system was established. Figure 19 The first round of integration system includes: integrase expression plasmid pWA01 (containing codon-optimized Se01 and...). mCherry Reporter gene), donor plasmid pWA02 (containing attP and promoterless EGFP) and receptor plasmid pWA03 (containing attB and CMV promoter). Se01 catalysis attP and attB Recombination resulted in the fusion plasmid pWA04, enabling EGFP to express via the CMV promoter. The results showed that the first-round insertion efficiency of the Se01 integrase was approximately 10-1. -5 Accuracy rate > 20% Figure 20 A, Figure 21 A).

[0158] To verify the sequential insertion activity, the previous integration product pWA04 (containing attB The fusion plasmid (containing the site) is a recipient plasmid, which is then introduced into the recipient plasmid. attP The donor plasmid pWA08, which lacks the promoter BFP, was co-transfected with the integrase plasmid pWA01 in two rounds. The results showed that the integration efficiency in the two rounds was approximately 10-1. -5 Accuracy rate > 15% Figure 21 B).

[0159] Further, using the second-round integration product pWA09 as the receptor plasmid, a substance containing... attP The donor plasmid pWA11 (without the promoter mCherry) and the integrase plasmid pWA10 (without a fluorescent reporter gene) were co-transfected three times. The results showed that the integration efficiency of the three rounds was approximately 10. -5 The accuracy rate is approximately 5-10%. Figure 21 C).

[0160] This example demonstrates that Se01 possesses site-specific integration and continuous insertion capabilities in eukaryotic mammalian cells. Although it is a transient transfection system, it provides proof of concept for in situ genome editing.

[0161] Sequence information

[0162] SEQ ID NO:1: Se01 integrase amino acid sequence

[0163] SEQ ID NO:2: Se01 integrase encoding gene sequence

[0164] SEQ ID NO:3: attB core sequence

[0165] GCGGAGGATACGGGATTCGAACCCGTGAGGGCTATTAACCCAACACGATTTCCAAT

[0166] SEQ ID NO:4 (where positions 103–158 are the core sequence, 56 bp)

[0167] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. A method for continuous DNA integration / recombination in cells, characterized in that, This includes using Se01 integrase to mediate integrase recognition of attachment sites ( att Site-specific integration / recombination between the target DNA molecules; the recombination preserves the integrity of the target DNA molecule. attB Identification sites enable continuous DNA integration / recombination; The integrase recognition attachment site includes a first integrase recognition attachment site and a second integrase recognition attachment site, which are different and selected from: attB site, attP Site.

2. The method as described in claim 1, characterized in that, The DNA is continuously integrated / recombined in n rounds, where n is a positive integer ≥ 2.

3. The method as described in claim 1 or 2, characterized in that, The methods for the first round of integration / restructuring include: (1) Provide cells to be integrated / recombined, which may or may not contain a first integrase recognition attachment site; (2) Provide a recombinant construct, including: (i) The gene encoding Se01 integrase or its gene expression cassette. (ii) The second integrase recognizes the attachment site. (iii) An optional first integrase recognition attachment site, provided that the site exists only if (1) does not contain the first integrase recognition attachment site. (iv) Donor DNA, which carries the target gene to be integrated / recombined. Optionally, (i)-(iv) are placed in the same or different recombinant constructs; (3) The recombinant construct from (2) is introduced into the cells of (1), where site-specific recombination occurs under the catalysis of Se01 integrase, and the donor DNA is integrated into the target DNA molecule. This process preserves the integrity of the donor DNA. attB Identification site.

4. The method as described in claim 3, characterized in that, Methods for conducting the next round of integration / restructuring include: (1') Provide cells after the previous round of integration / recombination, in which the target gene after the previous round of integration / recombination is present and the complete target gene is retained. attB Identification site; (2') Provide a recombinant construct, including: (i') The gene encoding Se01 integrase or its gene expression cassette. (ii') Second integrase recognizes attachment sites attP Identification site, (iii') Donor DNA, which carries the target gene to be integrated / recombined. Optionally, (i')-(iii') are placed in the same or different recombination constructs; (3') The recombinant construct of (2') is introduced into the cell of (1'), where donor DNA integration / recombination occurs, a process that preserves the complete attB Identification site; Preferably, the method (1')-(3') is repeated; for example, n-1 rounds.

5. The method as described in claim 3 or 4, characterized in that, The integrated / recombined genes include: genes, gene fragments, metabolic pathway gene modules or gene clusters, polycistronic molecules, or expression cassettes expressing said genes, gene fragments, modules or gene clusters, or polycistronic molecules; Preferably, the gene module or gene cluster includes a metabolic pathway gene module or gene cluster; Preferably, the target gene to be integrated / recombined is 0.1–200 kb, for example 0.2, 0.5, 1, 1.5, 2, 5, 10, 15, 20, 30, 50, 80, 100, 120, 150, 180 kb; Preferably, in each round of integration / recombination, the target gene to be integrated / recombined is the same or different; Preferably, different screening markers are used in different rounds of integration / recombination to trace the target gene to be integrated / recombined in different rounds of integration / recombination.

6. The method as described in claim 1 or 2, characterized in that, The cells include: prokaryotic cells or eukaryotic cells; Preferably, the prokaryotic cells include: Escherichia coli, Streptomyces, Polysporus spp., or Rhodotorula spp.; Preferably, the eukaryotic cells include filamentous fungi or mammalian cells.

7. Application of a SeO1 integrase for continuous DNA integration / recombination in cells; said SeO1 integrase mediates... attB site and attP Site-specific integration / recombination between sites; the recombination preserves the integrity of the target DNA molecule. attB Identification site; The continuous integration / recombination refers to performing n rounds of continuous DNA integration / recombination, where n is a positive integer ≥ 2.

8. A cellular DNA integration / recombination system, wherein the cell may or may not contain a first integrase recognition attachment site, the system comprising: (a) Reorganization constructs used for the first round of integration / reorganization: (i) The gene encoding Se01 integrase or its gene expression cassette. (ii) The second integrase recognizes the attachment site. (iii) An optional first integrase recognition attachment site, provided that the site exists only if the cell does not contain the first integrase recognition attachment site. (iv) Donor DNA, which carries the target gene to be integrated / recombined. Optionally, (i)-(iv) are placed in the same or different recombination constructs or (i')-(iii'); (b) Reorganization constructs for further (rounds 2 to n) integration / reorganization: (i') The gene encoding Se01 integrase or its gene expression cassette. (ii') attP Identification site, (iii') Donor DNA, which carries the target gene to be integrated / recombined. Optionally, (i')-(iii') are placed in the same or different recombination constructs.

9. The application of the system of claim 8, for continuous integration / recombination of DNA in cells; wherein the continuous integration / recombination is performed in n rounds of continuous integration / recombination of the DNA, where n is a positive integer ≥2; Preferably, the continuous integration / recombination of DNA in cells includes gene cluster reconstruction or modification in natural product biosynthesis, wherein the reconstruction or modification includes modular decomposition of gene clusters, analysis or optimization of synthetic pathways; More preferably, the natural product includes spinosad, and the modification is to achieve multiple copy superposition of the spinosad biosynthetic gene cluster through multiple rounds of continuous insertion, thereby increasing the copy number of the gene cluster.

10. A method for metabolic engineering modification of the spinosad system based on continuous DNA integration, comprising: Using the DNA sequential integration / recombination method according to any one of claims 1-6, spinosad biosynthesis gene clusters are sequentially inserted into *Saccharomyces cerevisiae*, increasing the gene cluster copy number from 1× to 2× or more; and / or Enhance the rhamnose synthesis pathway; and / or Introducing the NCM artificial pathway to enhance the supply of short-chain -CoA precursors; Other metabolic engineering strategies can be combined to increase spinosad production.

Images