Method for preparing recombinant human ngf using sumo fusion tag soluble expression

Abstract

The application relates to a method for preparing recombinant human NGF by using a SUMO fusion tag soluble expression, which comprises the following steps: artificially synthesizing a recombinant human nerve growth factor SUMO-NGF fusion protein gene SEQ ID NO. 1; inserting a thrombin enzyme cutting site into a seamless expression vector pET28a plasmid; transforming into escherichia coli BL21 to express, centrifuging to collect bacterial bodies and crushing the bacteria to obtain a fusion protein crude extract; using Ni chelation medium to purify the fusion protein by affinity chromatography to obtain a His6-Tag-SUMO-NGF fusion protein; fusing a tag and cutting; removing the fusion tag and purifying the enzyme to obtain rhNGF containing a small amount of impurities; purifying the rhNGF containing a small amount of impurities by a cation column to obtain rhNGF with a purity of greater than or equal to 95%. The application can efficiently and stably produce rhNGF with uniform structure and keep the accuracy of the protein structure.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a method for preparing highly active recombinant human NGF using a recombinant human nerve growth factor (NGF) gene, an E. coli expression system, a SUMO fusion tag, and soluble expression. Background Technology

[0002] Italian neurobiologist Rita Levi-Montalcini and American biochemist Stanley Cohen discovered human nerve growth factor (NGF) in the late 1940s and early 1950s, and were awarded the Nobel Prize in Physiology or Medicine in 1986. NGF's primary function is as a neurotrophic factor, promoting the survival, growth, differentiation, and repair of nerve cells after injury. It also plays a complex role in immune regulation and hair growth control.

[0003] The mature monomer of human β-NGF consists of 120 amino acids, with six crucial cysteine ​​residues in the sequence. These residues stabilize its correct folding conformation by forming three pairs of disulfide bonds within the molecule. If these disulfide bonds are incorrectly linked, NGF will lose its biological activity. An active β-NGF molecule is a homodimer formed by two of the aforementioned 120 amino acid monomers tightly bound together by non-covalent bonds. The dimer has a dumbbell shape, with the β-sheets of the two monomers stacked at the center to form a "handle," which is the main stabilizing force of the dimer. The molecular weight of each monomer is approximately 13.5 kDa, therefore the molecular weight of the entire active dimer is approximately 25 kDa. Under certain conditions, the mature monomer of correctly folded human β-NGF has the ability to autonomously assemble into a homodimer.

[0004] Based on current clinical trials and research, the core clinical applications of recombinant human nerve growth factor (rhNGF) are highly concentrated in ophthalmology, particularly in the treatment of neurotrophic keratitis, where it has shown clear efficacy. Secondly, its application in optic nerve protection, such as in optic nerve injury and glaucoma, is currently a hot topic in clinical trials. It also shows some application value in diseases such as retinitis pigmentosa and optic glioma in children. Existing patents disclose the novel use of rhNGF-containing ophthalmic preparations for the treatment of dry eye syndrome. These demands have led to a market demand for more affordable sources of rhNGF. Furthermore, rhNGF has shown application potential in a wider range of nerve injury repair and some cutting-edge fields. However, for a broader range of neurological diseases, although the theoretical basis is sufficient, its clinical translation still faces challenges such as administration methods and safety.

[0005] The discovery and clinical application of NGF faced two major challenges: sourcing and stability. Early NGF production was extremely low, primarily extracted from mouse submandibular glands, which was insufficient to meet clinical needs and posed a risk of immunogenicity from heterologous proteins. The core technological breakthrough lay in the preparation of recombinant human nerve growth factor (rhNGF). As early as 1990, related patents emerged, demonstrating a technology that used recombinant DNA to construct gene expression vectors capable of efficiently expressing mature human β-NGF in mammalian cells (such as CHO cells). This marked a new stage in NGF technology, moving from tissue extraction to genetic engineering production, paving the way for subsequent large-scale, standardized production. Currently, recombinant human nerve growth factor expression systems using genetic engineering technology include platforms such as E. coli, yeast, insect cells, and CHO cells. Among these, the E. coli-based system offers the lowest cost for rhNGF preparation; however, because rhNGF is often expressed as inclusion bodies in E. coli, preparation requires denaturation and renaturation processes to refold the protein back into naturally active rhNGF. However, due to significant losses during the refolding process, including intermolecular aggregation, misfolding and disulfide bond mismatch, low activity recovery, difficulties in process scale-up and condition optimization, and complex subsequent purification and activity detection, the refolding problem of inclusion bodies in recombinant rhNGF expression in *E. coli* remains a key bottleneck restricting the efficient industrialization of NGF. Therefore, it is necessary to develop a method for soluble expression of rhNGF using an *E. coli* expression system to facilitate large-scale preparation of fully human rhNGF. Summary of the Invention

[0006] The purpose of this invention is to provide a method for preparing recombinant human NGF using soluble expression of a SUMO fusion tag. This method addresses the key bottleneck in the existing technology of recombinant expression of rhNGF in Escherichia coli, which is difficult to refold into inclusion bodies and hinders the efficient industrialization of NGF.

[0007] The technical solution adopted by this invention to solve its technical problem is as follows: This method for preparing recombinant human NGF using soluble expression of the SUMO fusion tag includes the following steps: Step 1: Artificially synthesize the recombinant human nerve growth factor SUMO-NGF fusion protein gene, the gene sequence of which is shown in SEQ ID NO.1; Step 2: Seamlessly synthesize the thrombin restriction site for inserting into the expression vector pET28a plasmid; Step 3: Transform into Escherichia coli BL21 for expression, induce expression with IPTG at 20-25℃, collect bacterial cells and broken bacteria by centrifugation, and centrifuge the soluble fraction to obtain the crude extract of fusion protein; Step 4: Affinity chromatography was performed using Ni chelation medium to purify the fusion protein, yielding the His6-Tag-SUMO-NGF fusion protein; Step 5, Fusion Tag Digestion: Dilute the fusion protein collection solution 5-fold with pH 7.4 20mM PB solution, add 20 IU / ml of specific high-activity SUMO protease, and digest in a 30℃ water bath for 3 hours; Step 6: Removal of fusion tag and purification of enzyme: After enzyme digestion, the digested sample is loaded onto a Ni-IDA agarose resin column equilibrated with buffer. The flow-through peak is detected and collected at 280 nm, which is rhNGF containing a small amount of impurities. Step 7: Purify rhNGF containing a small amount of impurities using a cation exchange column. Detect and collect the largest protein elution peak component at 280 nm, concentrate and desalt it to obtain rhNGF with a purity ≥95%.

[0008] Step two in the above scheme specifically involves seamlessly linking the SUMO-NGF fusion protein gene and the stop codon TAA to the end of the thrombin restriction site CTGGTGCCGCGCGGCAGC sequence in the pET28a plasmid.

[0009] Step three in the above plan specifically refers to: Transformed into Escherichia coli BL21(DE3); IPTG induced expression at 20-25℃, the bacterial cells were collected by centrifugation, and the recombinant E. coli were resuspended and lysed using a buffer solution of pH 7.4, 20mM PB (20mM NaH2PO4·2H2O, 20mM Na2HPO4·7H2O), 0.5M NaCl, and 20mM imidazole. The soluble fraction was collected by high-speed centrifugation, which is the crude extract of the fusion protein.

[0010] Step four in the above scheme is specifically as follows: The crude extract was loaded onto a Ni-IDA agarose resin column and equilibrated with a buffer of pH 7.4, 20 mM PB, 0.5 M NaCl, and 20 mM imidazole. The column was then washed with a buffer of pH 7.4, 20 mM PB, 0.5 M NaCl, and 40 mM imidazole until the absorbance of the eluent at 280 nm was close to the baseline. The Ni-IDA column was then washed again with a buffer of pH 7.4, 20 mM PB, 0.5 M NaCl, and 250 mM imidazole. The protein elution peak was detected and collected at 280 nm, which was the His6-Tag-SUMO-NGF fusion protein.

[0011] Step six in the above scheme is: De-fusion tag removal and enzyme purification: After enzyme digestion, affinity chromatography was performed using Ni metal chelate media to separate and purify the His-tag-SUMO tag moiety, the His-tag-containing SUMO protease, and the NGF target protein. Liquid samples were loaded onto a Ni-IDA agarose resin column equilibrated with buffer, and the flow-through peak at 280 nm was detected and collected, which represented NGF containing a small amount of impurities.

[0012] Step seven in the above scheme is specifically as follows: NGF protein was further purified using an SP-Sepharose 4 Fast Flow column: The flow-through buffer was diluted 5-fold with pH 7.4 20mM PB solution and loaded onto an SP-Sepharose 4 Fast Flow column equilibrated with pH 7.4 20mM PB. NGF bound to the column, and elution was performed using a 0-100% continuous gradient with pH 7.4 20mM PB buffer containing 0.5M NaCl. The maximum protein elution peak was detected and collected at 280 nm. The NGF was then concentrated and desalted using a 3000MV ultrafiltration membrane to obtain high-purity NGF (15% gel SDS-PAGE results are shown in [link to SDS-PAGE]). Figure 3 Its amino sequence is shown in the sequence listing SEQ ID NO. 3). Beneficial effects

[0013] 1. This invention enables efficient and stable production of rhNGF with uniform structure while maintaining the accuracy of its protein structure. Compared with the traditional E. coli inclusion body refolding method for producing rhNGF, this invention offers better operability, more convenient extraction, and more stable product activity, making it more suitable for large-scale production of rhNGF.

[0014] 2. To facilitate the preparation and purification of human nerve growth factor NGF, this invention provides a method for preparing a non-natural human nerve growth factor NGF gene and recombinant human nerve growth factor NGF by expressing the gene in a soluble natural conformation to enhance the activity of rhNGF.

[0015] 3. This invention expresses rhNGF in a soluble manner, minimizing the generation of misfolding and mismatched variants during the downstream purification process of inclusion body refolding. This results in the correct spatial structure of rhNGF, high activity, good drug-likeness and stability, and the overall process is simple to operate and easy to scale up.

[0016] 4. SUMO, a small molecule ubiquitin-associated protein, can serve as a solubilizing molecular chaperone for recombinant protein expression. It helps exogenous proteins that are typically difficult to express solublely to fold correctly within *E. coli* cells and be expressed efficiently in a soluble form. This method involves fusing the solubilizing molecular chaperone SUMO with hNGF for co-expression, and designing a His-tag affinity label at the N-terminus of SUMO-hNGFN for rapid purification of the target protein, facilitating scale-up and large-scale production suitable for extraction processes. The development of this method is crucial for overcoming the key bottleneck of inclusion body refolding in the industrialization of NGF. Attached Figure Description

[0017] Figure 1 This diagram illustrates the seamless synthesis of the expression vector, with dashed arrows indicating the sites where the SUMO-NGF fusion protein gene is seamlessly inserted into the pET28a plasmid.

[0018] Figure 2 Figure 1 shows the results of His-tag-SUMO-NGF induction expression in Escherichia coli at 37℃ and 25℃. 1: His-tag-SUMO-NGF induction expression precipitate in E. coli at 37℃; 2: Supernatant of His-tag-SUMO-NGF induction expression in E. coli at 37℃; 3: His-tag-SUMO-NGF induction expression precipitate in E. coli at 25℃; 4: Supernatant of His-tag-SUMO-NGF induction expression in E. coli at 25℃.

[0019] Figure 3 The images show the SDS-PAGE results of SUMO digestion and purification, where 1: SUMO protease digestion results; 2: Ni column affinity chromatography results of recombinant 28kD His-tag-SUMO-NGF fusion protein; and 3: rhNGF cation exchange purification results. Detailed Implementation

[0020] The present invention will be further described below with reference to the accompanying drawings: Combination Figures 1-3As shown, this method for preparing recombinant human NGF using soluble expression of the SUMO fusion tag involves: The gene for the recombinant SUMO-NGF fusion protein, codon-optimized in *E. coli*, is a codon-optimized artificial DNA sequence, chemically synthesized. The soluble expression strategy uses the histidine tag His6-Tag and the substrate recognized by the SUMO protease as auxiliary fragments for soluble protein expression, with human β-NGF as the target fragment in the fusion expression protein. The codon-optimized SUMO-NGF gene sequence is seamlessly chemically synthesized with the vector, ensuring the amino acid encoding gene of SUMO-NGF is correctly linked to the vector in the correct reading frame. This is then transformed into *E. coli* expression strains, ultimately constructing recombinant *E. coli* expressing the His-Tag-SUMO-NGF fusion protein in a soluble manner. Recombinant bacteria were induced by IPTG under low temperature conditions, followed by cell disruption. Affinity chromatography with a metal-Ni chelate medium in the presence of imidazole was then performed to obtain a high-purity His-Tag-SUMO-NGF fusion protein in one step. The purified fusion protein was then cleaved using a highly specific and active SUMO protease to dissociate the His-Tag-SUMO tag from the target protein, human β-NGF. The His-Tag-SUMO fragment, the N-terminal His-Tag SUMO protease, and the target protein NGF were then separated using a metal-Ni chelate medium. Further purification using an SP-Sepharose 4 Fast Flow column yielded a protein with a purity of 95% and a specific activity of 6.8 × 10⁻⁶. 5 The target protein rhNGF was measured at IU / mg.

[0021] This method for preparing recombinant human NGF using soluble expression of the SUMO fusion tag specifically includes the following steps: 1) The recombinant human nerve growth factor SUMO-NGF gene was artificially synthesized, and its base sequence is shown in SEQ ID NO.1 of the sequence listing; the amino acid sequence of the recombinant human nerve growth factor SUMO-NGF is shown in SEQ ID NO.2 of the sequence listing.

[0022] 2) Seamless synthesis with the expression vector; insertion site see [link to insertion site]. Figure 1 .

[0023] 3) Transformed into E. coli for expression; when the bacterial culture OD 600When the concentration reached 0.6-0.8, 1M IPTG was added to a final concentration of 0.7-0.8mM, and expression was induced at 20-25℃ for 12-14 hours. Cell collection and bacterial disruption were performed by centrifugation: Cells were collected by centrifugation and resuspended and disrupted using pH 7.4 20mM PB (20mM NaH2PO4·2H2O, 20mM Na2HPO4·7H2O), 0.5M NaCl, and 20mM imidazole buffer. The soluble fraction was collected by high-speed centrifugation, which was the crude extract of the fusion protein (10% gel SDS-PAGE results are shown in [link to SDS-PAGE]). Figure 2 ).

[0024] 4) Affinity chromatography was used to purify the fusion protein using Ni chelation media. The crude extract was loaded onto a Ni-IDA agarose resin column equilibrated with pH 7.4 20mM PB, 0.5M NaCl, and 20mM imidazole buffer. The column was washed with a buffer containing pH 7.4 20mM PB, 0.5M NaCl, and 40mM imidazole until the absorbance of the elution at 280nm was close to the baseline. The column was then washed again with elution buffer of pH 7.4 20mM PB, 0.5M NaCl, and 250mM imidazole. The protein elution peak was detected and collected at 280nm, which was the His-Tag-SUMO-NGF fusion protein (15% gel SDS-PAGE results are shown in [link to SDS-PAGE results]). Figure 3 ).

[0025] 5) SUMO protease digestion: The fusion protein collection solution was diluted 5-fold with 20mM PB solution at pH 7.4, and 20-50 IU / mL of specific, highly active SUMO protease was added. Digestion was performed in a 30°C water bath for 3 hours (see 15% SDS-PAGE results). Figure 3 ).

[0026] 6) Removal of the fusion tag and purification of the enzyme: After enzyme digestion, affinity chromatography was performed using Ni metal chelate media to separate and purify the His-tag-SUMO tag portion, the His-tag-containing SUMO protease, and the NGF target protein. Liquid samples were loaded onto a Ni-IDA agarose resin column equilibrated with buffer, and the flow-through peak at 280 nm was detected and collected, which represents NGF containing a small amount of impurities.

[0027] 7) Further purification of NGF protein using an SP-Sepharose 4 Fast Flow column: The flow-through buffer was diluted 5-fold with pH 7.4 20mM PB solution and loaded onto an SP-Sepharose 4 Fast Flow column equilibrated with pH 7.4 20mM PB buffer. NGF bound to the column. A 0-100% continuous gradient elution was performed using pH 7.4 20mM PB buffer containing 0.5M NaCl. The maximum protein elution peak was detected and collected at 280 nm. The solution was then concentrated and desalted using a 3000MV ultrafiltration membrane to obtain high-purity NGF (15% gel SDS-PAGE results are shown in [link to SDS-PAGE]). Figure 3 Its amino sequence is shown in the sequence listing SEQ ID NO. 3).

[0028] SEQ ID NO.1 SUMO-NGF artificial DNA sequence: 663 bp 1 GCATCCATGT CTGACTCTGA AGTTAACCAG GAAGCAAAGC CGGAGGTAAA GCCGGAAGTA 61 AAACCGGAAA CTCACATTAA CCTGAAAGTG AGCGACGGCT CTTCCGAGAT CTTCTTCAAG 121ATCAAAAAAA CCACCCCGCT GGCCGCCTG ATGGAAGCAT TTGCCAAACG TCAGGGCAAG 181GAAATGGACT CCCTGCGTTT CCTGTACGAC GGCATTCGTA TCCAGGCTGA TCAGACGCCG 241GAAGATCTGG ACATGGAAGA CAACGACATT ATCGAAGCAC ACCGCGAACA GATCGGTGGC 301AGCAGCAGCC ACCCAATCTT CCACCGTGGT GAATTCTCTG TGTGCGATTC CGTCTCCGTG 361TGGGTAGGCG ATAAGACTAC TGCTACCGAC ATCAAAGGCA AGGAAGTTAT GGTCCTGGGT 421GAAGTGAACA TTAACAACTCCGTTTTTAAGGGCTACTTCTTCGAAACTAAGTGTCGTGAC 481CCGAACCCGG TGGACTCTGG TTGCCGCGGC ATCGACAGCA AAATTGGAA CTCCTACTGT 541ACTACCACTC ACACCTTTCGT AAAAGCGCTG ACCATGGATG GCAAACAGGC GGCCTGGCGT 601TTCATTCGCA TCGATACCGC TTGCTACTGC GTTCTGAGCC GTAAAGCGGT TCGTCGTGCT 661TAA SEQ ID NO.2 SUMO-NGF artificial amino acid sequence: 220aa 1 ASMSDSEVNQ EAKPEVKPEV KPETHINLKV SDGSSEIFFK IKKTTPLRRL MEAFAKRQGK 61 EMDSLRFLYD GIRIQADQTP EDLDMEDNDI IEAHREQIGG SSSHPIFHRG EFSVCDSVSV 121WVGDKTTATD IKGKEVMVLG EVNINSVFK GYFFETKCRD PNPVDSGCRG IDSKHWNSYC 181TTTHTFVKAL TMDGKQAAWR FIRIDTACYC VLSRKAVRRA SEQ ID NO.3 Human βNGF amino acid sequence: 120aa 1 SSSHPIFHRG EFSVCDSVSV WVGDKTTATD IKGKEVMVLG EVNINSVFK GYFFETKCRD 61 PNPVDSGCRG IDSKHWNSYC TTTHTFVKAL TMDGKQAAWR FIRIDTACYC VLSRKAVRRA Example 1: Preparation of pET28a-His-tag-SUMO-NGF expression vector and engineered bacteria: I. Construction and identification of recombinant expression plasmids; a. Gene synthesis: artificial synthesis of the gene insertion site and the entire SUMO-NGF gene.

[0029] The following sequence was designed and synthesized in vitro: Sequence Listing SEQ ID NO.1; The SUMO-NGF fusion protein gene and the stop codon (TAA) were seamlessly ligated to the end of the thrombin restriction site CTGGTGCCGCGCGGCAGC sequence in the pET28a plasmid (see [link to pET28a plasmid]). Figure 1 Synthesized artificially by Nanjing Genscript Biotech Co., Ltd., the plasmid was transformed into E. coli top10 strains after being correctly sequenced.

[0030] b. E. coli transformed with the recombinant plasmid were cultured in LB liquid medium containing kanamycin (100 μg / ml). The plasmid was extracted using a plasmid miniprep kit. After successful extraction of the recombinant plasmid was confirmed by 1% agarose gel electrophoresis, 5 μL of the recombinant plasmid was used to transform competent E. coli BL21(DE3) cells. 50 μL of the transformed bacterial culture was spread on LB solid medium containing kanamycin (100 μg / ml) and cultured overnight at 37°C. Single colonies were picked and transferred to LB liquid medium containing kanamycin (100 μg / ml) and identified by PCR using universal primers for the pET28 plasmid.

[0031] II. Expression of the fusion protein and purification of the NGF product; 1) E. coli transformed with the recombinant gene plasmid were inoculated at a 1% inoculum rate into LB liquid culture medium containing kanamycin (50 μg / ml) and cultured at 37°C until OD500. 600 When the concentration reaches approximately 0.6-0.8, add 1M IPTG to a final concentration of 0.7-0.8mM, and continue culturing at 20-25℃ for 12-14 hours to induce the expression of the target product. Then, separate the recombinant *E. coli* and the culture medium by high-speed centrifugation. Add a 10:1 volume buffer solution to the bacterial cells containing the target protein. The buffer solution formulation is pH 7.4, 20mM PB, 0.5M NaCl, and 20mM imidazole. After the bacterial cells are sonicated at low temperature in the buffer solution, centrifuge at 20000g for 20 minutes at 4℃. The soluble portion of the supernatant is taken as the crude extract of the fusion protein (10% gel SDS-PAGE results are shown in [reference needed]). Figure 2 ).

[0032] 2) Affinity chromatography was used to purify the fusion protein using Ni chelation media. The crude extract was loaded onto a Ni-IDA agarose resin column equilibrated with pH 7.4 20mM PB, 0.5M NaCl, and 20mM imidazole buffer. The column was washed with a buffer containing pH 7.4 20mM PB, 0.5M NaCl, and 40mM imidazole until the absorbance of the elution at 280nm was close to the baseline. The column was then washed again with elution buffer containing pH 7.4 20mM PB, 0.5M NaCl, and 250mM imidazole. The protein elution peak was detected and collected at 280nm, which was the His6-Tag-SUMO-NGF fusion protein (15% gel SDS-PAGE results are shown in [link to SDS-PAGE]). Figure 3 ).

[0033] 3) SUMO protease digestion: The fusion protein collection solution was diluted 5-fold with 20mM PB solution at pH 7.4, and 20-50 IU / mL of specific, highly active SUMO protease was added. The fusion protein was digested in a 30°C water bath for 3 hours (see 15% SDS-PAGE results). Figure 3 ).

[0034] 4) Removal of fusion tag and SUMO protease: After enzyme digestion, affinity chromatography was performed using Ni metal chelate media to separate the His-tag-SUMO tag portion, the His-tag-containing SUMO protease, and the NGF target protein. The diluted liquid sample after enzyme digestion was loaded onto a Ni-IDA agarose resin column equilibrated with buffer. The flow-through peak at 280 nm was detected and collected, which represents the NGF containing a small amount of impurities.

[0035] 5) Further purification of NGF protein using an SP-Sepharose 4 Fast Flow column: The flow-through buffer was diluted 5-fold with pH 7.4 20mM PB solution and loaded onto an SP-Sepharose 4 Fast Flow column that had been equilibrated with buffer at pH 7.4 20mM PB. NGF bound to the column, and elution was performed using a 0-100% continuous gradient with buffer at pH 7.4 20mM PB containing 0.5M NaCl. The protein elution peak at 0.25M NaCl was detected and collected at 280nm. The protein was then concentrated and desalted using a 3000MV ultrafiltration membrane, yielding NGF with a purity >95% (see 15% gel SDS-PAGE results). Figure 3 ).

[0036] III. HPLC method for determining rhNGF purity: The purity of rhNGF was determined by HPLC using a C18RP column. The peak was a single absorption peak with a retention time of 20.67 min and a peak area of ​​97.54%, which meets the requirement of a purity of over 95% as stipulated in the Chinese Pharmacopoeia.

[0037] rhNGF activity was measured using the TF-1 cell proliferation assay, followed by MTS and CCK-8 staining. The initial cell concentration was 3 × 10⁻⁶. 5 The initial concentration of NGF activity units was 20 μg / mL (CFU / mL), diluted 1 / 4, and cultured for 48 h. The A value was measured by MTS staining (490 nm wavelength) and CCK-8 staining (450 nm wavelength), respectively. A four-parameter fitting curve was plotted, and the specific activity of rhNGF was calculated to be 6.9 × 10⁻⁶. 5 IU / mg.

Claims

1. A method for preparing recombinant human NGF using soluble expression of a SUMO fusion tag, characterized in that... Includes the following steps: Step 1: Artificially synthesize the recombinant human nerve growth factor SUMO-NGF fusion protein gene, the gene sequence of which is shown in SEQ ID NO.1; Step 2: Seamlessly synthesize the thrombin restriction site for inserting into the expression vector pET28a plasmid; Step 3: Transform into Escherichia coli BL21 for expression, induce expression with IPTG at 20-25℃, collect bacterial cells and broken bacteria by centrifugation, and centrifuge the soluble fraction to obtain the crude extract of fusion protein; Step 4: Affinity chromatography was performed using Ni chelation medium to purify the fusion protein, yielding the His6-Tag-SUMO-NGF fusion protein; Step 5, Fusion Tag Digestion: Dilute the fusion protein collection solution 5-fold with pH 7.4 20mM PB solution, add 20 IU / ml of specific high-activity SUMO protease, and digest in a 30℃ water bath for 3 hours; Step 6: Removal of fusion tag and purification of enzyme: After enzyme digestion, the digested sample is loaded onto a Ni-IDA agarose resin column equilibrated with buffer. The flow-through peak is detected and collected at 280 nm, which is rhNGF containing a small amount of impurities. Step 7: Purify rhNGF containing a small amount of impurities using a cation exchange column. Detect and collect the largest protein elution peak component at 280 nm, concentrate and desalt it to obtain rhNGF with a purity ≥95%.

2. The method for preparing recombinant human NGF using soluble expression of the SUMO fusion tag according to claim 1, characterized in that: Step two specifically involves seamlessly linking the SUMO-NGF fusion protein gene and the stop codon TAA to the end of the thrombin restriction site CTGGTGCCGCGCGGCAGC sequence in the pET28a plasmid.

3. The method for preparing recombinant human NGF using soluble expression of the SUMO fusion tag according to claim 2, characterized in that: Step three specifically involves: transforming the bacteria into Escherichia coli BL21(DE3); inducing expression with IPTG at 20-25℃; collecting the bacterial cells by centrifugation; resuspending and lysing the recombinant E. coli using a buffer solution of pH 7.4, 20mM PB (20mM NaH2PO4·2H2O, 20mM Na2HPO4·7H2O), 0.5M NaCl, and 20mM imidazole; and centrifuging at high speed to obtain the soluble fraction, which is the crude extract of the fusion protein.

4. The method for preparing recombinant human NGF using soluble expression of the SUMO fusion tag according to claim 3, characterized in that: Step four specifically involves: loading the crude extract onto a Ni-IDA agarose resin column, equilibrating it with a pH 7.4 20mM PB, 0.5M NaCl, and 20mM imidazole buffer, and washing the column with a pH 7.4 20mM PB, 0.5M NaCl, and 40mM imidazole buffer until the absorbance of the elution at 280nm is close to the baseline. Then, wash the Ni-IDA column with a pH 7.4 20mM PB, 0.5M NaCl, and 250mM imidazole elution buffer, and detect and collect the protein elution peak at 280nm, which is the His6-Tag-SUMO-NGF fusion protein.

5. The method for preparing recombinant human NGF using soluble expression of the SUMO fusion tag according to claim 4, characterized in that: Step six is ​​as follows: De-fusion tag removal and enzyme purification: After enzyme digestion, affinity chromatography was performed using Ni metal chelate media to separate and purify the His-tag-SUMO tag moiety, the His-tag-containing SUMO protease, and the NGF target protein. Liquid samples were loaded onto a Ni-IDA agarose resin column equilibrated with buffer, and the flow-through peak at 280 nm was detected and collected, which represented NGF containing a small amount of impurities.

6. The method for preparing recombinant human NGF using soluble expression of the SUMO fusion tag according to claim 5, characterized in that: Step seven specifically involves: NGF protein was further purified using an SP-Sepharose 4 Fast Flow column: the flow-through buffer was diluted 5-fold with pH 7.4 20mM PB solution and loaded onto an SP-Sepharose 4 Fast Flow column equilibrated with buffer pH 7.4 20mM PB. NGF bound to the column, and elution was performed using a 0-100% continuous gradient with buffer pH 7.4 20mM PB containing 0.5M NaCl. The fraction of the largest protein elution peak was detected and collected at 280 nm. A 3000MV ultrafiltration membrane pack is used for concentration and desalination, resulting in high-purity NGF.

Images