Integrated i-crispr-cbest base editor for controllable expression and construction and application thereof

CN122811230APending Publication Date: 2026-09-25SHANGHAI JIAOTONG UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610784610.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-06-02
Publication Date
2026-09-25

AI Technical Summary

Technical Problem

为克服CRISPR-cBEST碱基编辑器(耦联胞嘧啶脱氨酶的CRISPR胞嘧啶碱基编辑器,cBE)在放线菌宿主中接合转移效率低的问题,本发明将CRISPR-cBEST系统整合至pSET152载体(Journal of industrial microbiology&biotechnology, 2012, 39(5):661-72.)

Benefits of technology

本发明所述的I-CRISPR-cBEST碱基编辑技术,利用了整合型质粒pSET152高效的接合转移效率的特征、Tc灵敏的诱导系统和sgRNA的高效定位效应,可以针对含有φC31 整合系统的放线菌,实现便捷、高效的基因编辑,为遗传操作困难的放线菌的基因功能研究,提供了有可靠的基因编辑工具。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122811230A_ABST
    Figure CN122811230A_ABST
Patent Text Reader

Abstract

The application discloses an integrated I-CRISPR-cBEST base editor for controllable expression and construction and application thereof. int The plasmid pSET152 containing a phiC31 integrase gene attP and an integration site attB is used as a skeleton, the plasmid can be efficiently and site-specifically integrated into a homologous site of an actinomycete chromosome under the action of an integrase, and has higher conjugative transfer efficiency and is convenient to operate. In order to overcome the bottleneck of low conjugative transfer efficiency of the CRISPR-cBEST base editor in the actinomycete, the application clones the base editor into the pSET152 vector, introduces a tetracycline (Tc) induction system to regulate expression of the editor protein, successfully constructs the integrated gene editor for controllable expression, and realizes efficient base editing in a Streptomyces coelicolor M145. The application provides an efficient gene editing tool for the actinomycete based on the phiC31 integration system, and provides an optimal gene editing tool for gene function research of the actinomycete which is difficult to be genetically operated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of synthetic biology gene editing technology, and relates to an integrated I-CRISPR-cBEST base editor for controllable expression, its construction and application; it has been successfully applied in Streptomyces cerevisiae and Actinomyces cerevisiae, showing good results. Background Technology Actinomycetes, especially Streptomyces, are an important and valuable resource for the discovery of bioactive natural products. However, genetic manipulation of many actinomycetes remains challenging, severely hindering research on key functional genes involved in the biosynthesis of bioactive natural products. Base editing technology, a novel genome editing method derived from the CRISPR / Cas system, is a highly efficient editing system that directly and irreversibly converts one base pair into another at the target site without DNA double-strand breaks or a DNA template. Existing CRISPR-cBEST base editors (CRISPR cytosine base editors coupled to cytosine deaminase, cBEs) are constructed using the pSG5 plasmid, commonly used in actinomycetes, as a backbone. However, they suffer from low conjugation and transfer efficiency in many actinomycete hosts, making it difficult to obtain conjugates, especially in rare actinomycetes where genetic manipulation is challenging. Furthermore, the expression of constitutively expressed cBEST base editing elements (cBEs) is uncontrollable. These limitations significantly restrict the precise application of this technology in the field of microbial gene base editing. However, plasmid pSET152 contains the integrase-encoding gene for φC31. integrase and integration sites attP Through the mediation of integrase, plasmids can be integrated into homologous chromosomes of actinomycetes. attB At the site. φC31 integrase belongs to the serine recombinase family. φC31 integrase acts on... attB site and attP Sites can form attL and attR They exhibit good genetic stability. pSET152 and other vectors based on φC31 integrase have proven useful in many Streptomyces and other actinomycetes, with conjugation transfer efficiencies reaching 1.6 × 10⁻⁶ in many Streptomyces genera. -4 Up to 1.4×10 -2Furthermore, conjugation transfer efficiency can also be very high in certain other non-Streptomycete genera (Synthetic and Systems Biotechnology, 2017, 2:302-309. Journal of industrial microbiology & biotechnology, 2012, 39(5): 661-72.). Tetracycline (Tc) induction systems have been successfully used as tools to regulate gene expression in many organisms. tetO-tetR The interaction between them is very strong, and high levels of repression can be achieved in the absence of Tc (Nucleic acids research, 2005, 33(9): e87). Gene expression can be controlled at the desired level using inducers.

[0002] This invention combines the advantages of efficient conjugation transfer mediated by φC31 integrase and the controllable gene expression of the tetracycline (Tc) induction system. It attempts to construct the CRISPR-coupled cytosine deaminase base editor cBEST (CytosineBase Editor, cBE) onto the pSET152 plasmid. Simultaneously, to achieve controllability of the gene editing process, a tetracycline induction system was introduced during cloning to regulate the expression of the protein-coding gene of the editing editor. Ultimately, a controllable integrative technology was successfully obtained and successfully tested in the model strain *Streptomyces cerevisiae* M145. This provides an optimal gene editing tool for verifying the function of rare actinomycete genes containing φC31 integration sites and which are difficult to manipulate genetically. Summary of the Invention

[0003] This invention provides an integrated I-CRISPR-cBEST base editor for controlled expression, its construction, and its application; using a gene containing the φC31 integrase encoding... integrase and their corresponding integration sites attP Using plasmid pSET152 as a backbone, it can efficiently and site-specifically integrate into homologous chromosomes of actinomycetes under the action of integrase. attBThe invention provides a highly efficient single-base editor for actinomycetes based on the φC31 integration site, offering significant advantages in conjugation and transfer efficiency. To overcome the low conjugation and transfer efficiency of the CRISPR-cBEST base editor (a CRISPR cytosine base editor coupled with cytosine deaminase, cBE) in actinomycete hosts, this invention integrates the CRISPR-cBEST system into the pSET152 vector (Journal of Industrial Microbiology & Biotechnology, 2012, 39(5):661-72.). Simultaneously, a tetracycline (Tc) induction system was introduced to regulate the expression of the protein-coding gene of the base editor, ultimately successfully constructing a controllable integrated editor. Highly efficient single-base editing was achieved in tests on *Streptomyces azureense* and *Actinomyces rubrum*. In summary, this invention provides a highly efficient single-gene editor for actinomycetes based on the φC31 integration site, offering a convenient tool for gene function research in actinomycetes where genetic manipulation is difficult.

[0004] The objective of this invention is achieved through the following technical solution: In a first aspect, the present invention provides a controllable expression of an integrative cytosine base editing plasmid containing an integrase-encoding gene containing φC31. integrase and integration sites attP The plasmid pSET152 was used as the starting plasmid, and a tetracycline (Tc) induction expression system was selected. tetO -TetR and the classic terminator of Streptomyces fd The plasmid was obtained by controlling the expression of cytosine-based editing (cBE) fusion proteins. Guided by sgRNA, the plasmid mediates site-directed base transitions from C·G to T·A, introducing a stop codon into the target gene (prematurely terminating DNA replication) to inactivate the gene. This technology was tested in *Streptomyces aquamarine* and *Actinomyces lucida*, both showing good base editing results.

[0005] In one embodiment of the present invention, the plasmid is based on plasmid pSET152 and carries a gRNA expression cassette and a tetracycline (Tc) inducible expression system. tetO -TetR, the cBE gene encoding the cytosine base editing fusion protein, and the classical terminator of Streptomyces fd .

[0006] As one embodiment of the present invention, in the plasmid... etO-tetR Among gene expression control elements, constitutive strong promoters are the most important. stYnP drive tetR Genome shaping and expression; simultaneously, stYnP-tetR upstream introduction ermE and tetO Operator, intetO Downstream and in stYnP-tetR The downstream of each gene contains restriction enzyme sites for insertion of the cBE-encoding gene and sgRNA element.

[0007] As one embodiment of the present invention, in the expression unit of the cBE-encoding gene of the plasmid, the cBE fusion protein encoding gene is derived from the plasmid pCRISPR-cBEST; PermE* The promoter (used to express the cBE gene) and the cBE-encoding gene rbs Add TetR operator between tetO The expression of cBE-encoded gene editing elements is affected by PermE* Promoter, TetR operator tetO Joint control enables the induced expression of the cBE fusion protein encoding gene.

[0008] In addition to the elements contained in the general integrative plasmid pSET152, the plasmid also contains elements required for conjugation and transfer (cited in Gene, 1992;116(1):43-49. doi:10.1016 / 0378-1119(92)90627-2). The construction of the plasmid module includes: tetO-tetR Gene expression control elements, guide RNA linking sites, and cBE-encoded gene elements.

[0009] As one embodiment of the present invention, the DNA sequence of the plasmid is shown in SEQ ID NO.1.

[0010] As one embodiment of the present invention, the plasmid can be implemented in Streptomyces: (1) φC31 integrase-mediated attP site-specific integration; (2) Tetracycline dose-dependent cBE fusion protein induced expression; (3) sgRNA-targeted C G→T A. Single-base editing; (4) The target gene is inactivated by introducing the STOP codon.

[0011] Secondly, the present invention provides a method for constructing an integrated cytosine base editing plasmid for controllable expression, the method comprising the following steps: S1. Employs a universal constitutive strong promoter for actinomycetes. stnYp Control genes tetR The expression, in stYnP-tetR upstream introduction ermE and tetO Operator, stYnP-tetRDownstream of the molecule is an EcoRV restriction site for inserting sgRNA elements; simultaneously, in tetO Downstream Nde I and Mfe I restriction site, used for insertion of cBE-encoding gene; etO-tetR Gene expression control elements were synthesized and constructed into plasmid pBlueScript SK(+). EcoR I / Not The plasmid was obtained at site I, denoted as plasmid SK- tet ; S2, Utilization Nde I and Eco RI digestion was performed to obtain the cBE-encoding gene element from plasmid CRISPR-cBEST, which was then cloned into plasmid SK- tet In Nde I and Mfe At the I restriction site, the correct clone was obtained and denoted as plasmid SK-. tet- cBEST; S3, Utilization Not I and Eco RI digestion, from plasmid SK- tet- Gene fragments containing the Tc induction system and editing system were recovered from cBEST and ligated into pSET152. Not I and Eco The integrated cytosine base editing plasmid is obtained by digestion with RI enzyme.

[0012] As one embodiment of the present invention, in the cBE-encoding gene element, in PermE* promoters and cBE-encoding genes rbs Add TetR operator between tetO The expression of cBE-encoded gene editing elements is affected by PermE* Promoter, TetR operator tetO Joint control enables the induced expression of the cBE fusion protein encoding gene.

[0013] Thirdly, the use of the aforementioned integrative cytosine base editing plasmid also falls within the scope of protection of this invention; the integrative cytosine base editing plasmid is used for gene base editing of Streptomyces or rare actinomycete strains containing the φC31 integration site. The expression of the gene editing element is induced by Tc.

[0014] In some implementation examples, the Streptomyces is selected as Sky Blue Streptomyces; the rare actinomycete strain is selected as Rare Orange Actinomyces.

[0015] Fourthly, the present invention also provides a method for gene editing using an integrative cytosine base editing plasmid, the method comprising the following steps: A1. Construction of sgRNA expression fragment and plasmid assembly: Design a specific base-editing sgRNA for the target gene, and tandemly splice the kasO*p promoter, sgRNA sequence and lambda t0 terminator to obtain an sgRNA expression fragment; insert this fragment into the EcoRV restriction site of the integrative cytosine base-editing plasmid according to any one of claims 1-6 to construct the recombinant integrative I-cBEST editing plasmid; A2. Plasmid conjugation transfer and positive strain screening: The constructed I-cBEST recombinant plasmid was electroporated into the conjugation transfer donor strain E. coli ET12567 / pUZ8002; the recombinant plasmid was introduced into the target actinomycete strain through the Escherichia coli-Streptomyces indirect conjugation transfer system, and the conjugate was screened and its correctness was verified by PCR. A3. Tetracycline-induced intracellular base editing: Verified positive conjugates were inoculated and cultured, and tetracycline (Tc) was added to induce controllable expression of the cBE fusion protein. The protein was cultured at an incubator until site-directed base editing of the target gene was completed; alpramycin (Apr) resistance screening was then performed. A4. Amplification of edited strains and identification of editing effect: Single colonies were randomly selected from plates and cultured in alpramycin-resistant medium; PCR amplification was performed using upstream and downstream specific primers for the editing site, the PCR products were recovered and sequenced, and the base editing and gene inactivation effects of the target gene were verified by sequence alignment.

[0016] In some specific implementation examples, a gene editing method for the integrative gene base editing plasmid pJQK853 is provided, the method comprising the following steps: S1. The base editor sgRNA was designed using CRISPy-web (https: / / crispy.secondary metabolites.org), and the corresponding sgRNA sequences were obtained through gene synthesis or PCR primer amplification by Jiutian Gene Technology (Tianjin) Co., Ltd. Among them, kasO*p The sgRNA was tandemly linked to the terminator lambda t0. This fragment was then ligated to the EcoRV site on plasmid pJQK853.

[0017] S2. Electroporate the constructed integrated I-cBEST plasmid to E. coli In ET12567 / pUZ8002, the bacterial strain used E. coli ET12567 / pUZ8002 was ligated with Streptomyces genus for indirect transfer, the target plasmid was introduced into the target strain, the correct conjugates were screened, and PCR verification was performed using primers attP-F / R and cBEST-F / R.

[0018] S3. Inoculate fresh bacterial culture into TSBY medium and add 5 μM inducer Tc to induce the expression of cBE fusion protein. After 3 days of induction culture, serially dilute the bacterial culture and spread it on solid plates containing Apr strains that show good growth.

[0019] S4. Randomly pick a single colony from the plate, inoculate it on a medium containing Apr for amplification, and then perform PCR amplification using primers targeting the upstream and downstream of the gene editing region to obtain the target band. Sequencing the PCR product and verifying the gene inactivation effect based on the sequencing results.

[0020] Using the integrative gene base editing technology of this invention, the gene for the biosynthesis of the blue substance Actinorhodin was successfully realized in Streptomyces m. M145. actVB The inactivation of the integrative I-cBEST base editing technology for actinomycetes demonstrates its successful application.

[0021] Previous cBEST base editing technologies have certain drawbacks, such as low conjugation and transfer efficiency of the replicative plasmids used, difficulty in obtaining conjugates, and uncontrollable expression of the cBE base editing element. These limitations significantly restrict the application of this technology in the field of microbial gene base editing. Compared with existing technologies, this invention has the following advantages: The I-CRISPR-cBEST base editing technology described in this invention utilizes the high conjugation and transfer efficiency of the integrative plasmid pSET152, the Tc-sensitive induction system, and the efficient localization effect of sgRNA. It can achieve convenient and efficient gene editing for actinomycetes containing the φC31 integration system, providing a reliable gene editing tool for gene function research in actinomycetes where genetic manipulation is difficult. Attached Figure Description

[0022] Other features, objects, and advantages of the invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings: Figure 1 A schematic diagram illustrating the construction of the integrative plasmid I-CRISPR-cBEST pJQK853; Figure 2 Results of plasmid pJQK860 construction verification (A) and strain CMY01 binding assay verification (B); Figure 3 The results show the PCR verification (A), sequencing analysis (B), and comparison of strain growth differences (C) for strain CMY07. Figure 4Results of plasmid pJQK866 construction verification (A), CMY20 binding assay verification (B), CMY21 PCR verification (C), sequencing analysis (D), and comparison of strain growth differences (E); Figure 5 To utilize the I-CRISPR-cBEST base editor for the analysis of *Streptomyces cerevisiae* M145 (sky blue) and *Streptomyces cerevisiae* DSM 44131 (orange) T The result of gene inactivation. Detailed Implementation

[0023] The following embodiments, in conjunction with the accompanying drawings, further illustrate the present invention. These embodiments are implemented based on the technical solution of the present invention, and detailed implementation methods and processes are provided. These embodiments will help those skilled in the art to further understand the present invention, but the scope of protection of the present invention is not limited to the following embodiments. For those skilled in the art, appropriate adjustments and improvements can be made without departing from the spirit of the present invention, and these all fall within the scope of protection of the present invention. Experimental methods in the following embodiments that do not specify specific conditions are performed under conventional conditions or the manufacturer's recommended conditions.

[0024] Example 1: Construction of a highly efficient single-gene editor for actinomycetes based on the φC31 integration site This embodiment provides an integrative I-CRISPR-cBEST base editing plasmid pJQK853 for controlled expression, targeting actinomycetes containing the φC31 integration site. This technology requires conjugation transfer to introduce a controllable integrative base editing plasmid containing sgRNA into the target strain, utilizing tetracycline induction to achieve controlled gene editing. Figure 1 A). The detailed steps for plasmid construction are as follows: S1. Design and construction of gene-controlled expression system elements: using a universal constitutive strong promoter from actinomycetes. stnYp Control genes tetR The expression, tetR Downstream of the sgRNA, there is an EcoRV restriction site to facilitate the insertion of the desired sgRNA element via gene recombination. tetO The downstream left Nde I and Mfe The I restriction site allows for the introduction of gene editing elements derived from the pCRISPR-cBEST plasmid. This gene portion, after synthesis, is incorporated into the plasmid pBlueScript SK(+). EcoR I / Not Plasmid SK- was obtained at site I. tet .

[0025] S2. The base editing element cBE encodes genes derived from the pCRISPR-cBEST plasmid, including the genes encoding cytidine deaminase rAPOBEC1, adenosine deaminase ecTadA, nickase Cas9n (D10A), and uracil-DNA glycosylase inhibitor UGI, all codon-optimized for Streptomyces. Cytidine deaminase rAPOBEC1 is linked to the N-terminus of nickase Cas9n (D10A) by 16 amino acids. To prevent the intermediate uracil (U) from being cleaved, resulting in base pair reduction to cytosine (C), the CBE protein expression sequence also links UGI to the C-terminus of Cas9n (D10A) with a 4-amino acid linker. PermE* To control the transcription of the cBE-encoding gene and achieve its controlled expression, in PermE* With cBE encoding gene rbs TetR manipulator was added between them tetO .

[0026] S3, the guide RNA linker site can be located during gene fragment synthesis, tetR The downstream reserved EcoRV restriction site allows for easy ligation of sgRNA to the plasmid after EcoRV digestion, using a DNA assembly kit.

[0027] S4, Utilization Nde I and Eco RI digestion was performed to obtain the cBE-encoding gene element from plasmid CRISPR-cBEST, which was then cloned into plasmid SK- tet In Nde I and Mfe At site I, the correct clone SK- was obtained. tet- cBEST. Then, utilize... Not I and Eco RI enzyme digestion and recovery of gene fragments containing the Tc induction system and the editing system, linked to pSET152 Not I and Eco The RI restriction site yields the Tc-induced integrated plasmid pJQK853.

[0028] S5. Select the obtained single colonies for overnight culture, extract recombinant plasmids, and utilize... Eco RI and Nco I performed double enzyme digestion verification and obtained matching band sizes of 4.5 kb and 7.8 kb, thus obtaining the correct target plasmid, which was named pJQK853. Figure 1 B).

[0029] This embodiment further provides a method for constructing a controllable integrated base editing plasmid and inducing expression of the gene encoding the editable gene. This method requires designing the base editor sgRNA and obtaining the DNA fragment in CRISPy-web based on the target gene sequence, cloning it into the EcoRV site of plasmid pJQK853, and obtaining a plasmid suitable for targeted base editing. The target plasmid is then transformed into... E. coli After ET12567 / pUZ8002, based on E. coli Indirect synergistic transfer with Streptomyces was used to introduce the base-edited plasmid into the target strain. Correct conjugates were screened, and then inoculated into TSBY medium with 5 μM Tc inducer to express the cBE fusion protein, thus performing base editing on the target gene. Finally, the results of base editing were further verified by PCR and gene sequencing.

[0030] Example 2: Application of the base editing tool I-CRISPR-cBEST in Streptomyces azureense Step 1: Select a flavin reductase from the biosynthetic pathway of type II polyketide blue compound Actinorhodin (ACT) in Streptomyces m145 (sky blue). actVB As a test subject, this enzyme participates in the dimerization of two polyketide precursors. actVB ( SCO5092 The inactivation of the gene leads to the disappearance of the blue substance. SCO5092 Upload the GenBank format sequence file to the CRISPy-web online analysis software, select the target region, and then check CRISPR-BEST mode, C to T, and Show only STOP mutations. This will display the number of candidate sgRNAs in the target gene. Select the sgRNA that is encoded by the gene at the beginning (ggtccagtccgtgcacgtcg). AGG-PAM Targeted Synthesis of Nine Heavens Gene Technology (Tianjin) Co., Ltd. SCO5092 The gene's plasmid pUC57-gRNA-actVB.

[0031] Step 2: Integrate plasmid pUC57-gRNA-actVB with the previously constructed integrative base editing vector pJQK853. Eco RV restriction enzymes were used to linearize the cells, and the corresponding target bands were recovered. Then, the two fragments were ligated using a Gibson recombination kit. The ligated product was transformed into DH10B competent cells and cultured at 37°C for 12 h. Single colonies were picked and cultured in LB broth at 37°C and 220 rpm for approximately 8 h. The bacterial culture was relatively turbid. Preliminary colony PCR was then performed using primers gRNA-F / R for verification.Figure 2 A) The strain with correct PCR results was re-sequencing for verification. The plasmid with correct sequencing results was named pJQK860.

[0032]

[0033] Step 3: Electroconvert the correctly constructed integrated I-cBEST plasmid pJQK860 to... E. coli ET12567 / pUZ8002 was used as the donor strain for indirect co-transfer between *Escherichia coli* and *Streptomyces*. The target plasmid was then introduced into *Streptomyces cerevisiae* M145 using the indirect co-transfer strategy. Conjugate transfer molecules were picked and cultured in TSBY shake flasks at 30°C and 220 rpm. PCR verification using primers attP-F / R and cBEST-F / R confirmed successful plasmid transfer into *Streptomyces*. Figure 2 B), the correct conjugate was obtained and named Streptomyces CMY01.

[0034]

[0035] Step 4: Re-inoculate Streptomyces CMY01 into TSBY medium, and add 5 μM of the inducer Tet to induce the expression of the cBE fusion protein. After 3 days, serially dilute the bacterial culture and spread it on MS solid plates containing abramycin. Single colonies grew out after 5 days.

[0036] Step 5: Randomly select single colonies that do not produce blue pigment from the plate, inoculate them onto MS medium containing 50 μg / mL of Apr, and culture them. Then transfer them to TSBY liquid culture, extract DNA, and perform PCR amplification using primers 5092-F / R to obtain a 534 bp sample. Figure 3 The band in A) was recovered, the PCR product was sequenced and verified, and the strain was named CMY07.

[0037]

[0038] Step Six: Sequencing results sufficiently demonstrate that the base editing system can effectively convert base C to base T and introduce a stop codon. The base editing system can convert base C into base T in the ACT biosynthesis gene cluster. actVB The mutation of amino acid Gln (CAG) at position 136 of the gene into the TAG stop codon leads to actVB Gene expression is interrupted, and the 137th amino acid Ser (TCC) is mutated to Phe (TTC). Figure 3 B) prevents the production of the blue polyketide antibiotic actinomycin ACT. Figure 3 C, Figure 5 ).

[0039] Example 3: Application of the base editing tool I-CRISPR-cBEST in rare orange bundle filament actinomycetes Orange-bundle Actinomycetes Actinosynnema pretiosum subsp. auranticum DSM 44131 T (Abbreviated strain DSM 44131) T This is an aerobic actinomycete named for its pale orange-yellow mycelium. This strain has attracted widespread attention for producing highly effective antitumor drugs, including the ansamitocin series of compounds and dnacin B1. Among them, strain DSM 44131... T Our laboratory has already completed the sequencing of the whole genome of this strain and carried out related studies on the biosynthesis of anserin and dnacin B1. However, due to the difficulty of genetic manipulation of this strain and the long verification cycle of gene function, this invention chose to apply the base editing tool I-CRISPR-cBEST in rare orange bundle filament actinomycetes to explore the effect of gene inactivation.

[0040] Step 1: Targeting strain DSM 44131 T The biosynthetic genes of isorenieratenes were analyzed. Key genes in the isorenierate gene cluster were analyzed using a base editor. crtB Directional inactivation of the gene encoding phytopene synthase (CrtB) prevents the production of orange-colored carotenoids, allowing for direct verification of the base editor's editing efficiency through changes in mycelial color. Phytopene synthase CrtB catalyzes the synthesis of phytopene from two geranylgeranyl pyrophosphatates (GGPP), making it the first synthase in the carotenoid biosynthesis pathway. Therefore, targeting this key gene in the biosynthesis pathway is crucial. crtB Base mutations can be performed to interrupt product synthesis.

[0041] Step 2: Genes crtB The sequence was transferred to the CRISPy-web online analysis software. A suitable sgRNA sequence was selected, and the designed and synthesized sgRNA (cctgcaggtgctgccggtgc) was analyzed. TGG-PAM The expression cassette was synthesized and ligated into the E. coli vector pUC57, named pUC57-44131-gRNA, and ligated to the first-generation base editing plasmid pJQK853 using the same ligation method described above. Transformants were picked, cultured, and then PCR amplified and verified using primers gRNA-F / R, producing a band of 748 bp. Figure 4 A), to obtain plasmid pJQK866.

[0042]

[0043] Step 3: Plasmid pJQK866 was introduced into *E. coli* ET / pUZ8002 via electroporation, and correct single clones were selected. Then, *E. coli* containing plasmid pJQK866 were cultured for 20 h, and the cells were washed with liquid LB medium for later use as conjugation transfer donors. The strain DSM 44131, cultured in TSBY liquid medium for approximately 14 h... T After washing twice, the *E. coli* and mycelium were mixed evenly and spread on YMG plates containing 10 mM MgCl2. The plates were allowed to dry and then incubated at 37°C for 14 h. The plates were then covered with 50 μg / mL apramycin and 40 μg / mL nalidixic acid and incubated at 30°C for 3 days. The conjugates obtained were initially screened using apramycin. The obtained conjugates were then verified by PCR using primers cBEST-F / R, producing a 1127 bp band. Figure 4 B), obtained positive strain CMY20.

[0044]

[0045] Step 4: Culture strain CMY20 in TSBY medium containing abramycin. Inoculate 10% of the culture into fresh TSBY medium containing 50 μg / mL Apr and 1 μM tet inducer. Incubate at 30°C with shaking for 3 days. Divide the culture into 10% of the original culture. -1 10 -2 10 -3 The solutions were serially diluted and spread onto YMG plates containing Apr antibiotic, and incubated at 30 °C for 3-5 days.

[0046] Step 5: After the single-clone bacteria have fully grown, white strains can be observed growing. This color change can be used to preliminarily determine the presence of white strains. crtB The gene has been inactivated. White bacterial strains were streaked onto antibiotic-containing YMG plates and transferred to TSBY culture for further incubation. Using the bacterial culture as a template, PCR amplification was performed using primers crtB-F / R to obtain a 594 bp fragment. Figure 4 C), sequencing verification was performed, and the correct clone was named CMY21.

[0047] Step Six: Sequencing results analysis revealed that the target site produced the expected gene mutation, with the base pair CG changing to the base pair TA, and the amino acid Gln mutating into a stop codon, resulting in gene inactivation. Figure 4 D, Figure 5When the mutant strain CMY21 and the wild-type strain were plated on YMG plates, a clear change in the color of the strains was observed. Figure 4 E), consistent with the gene mutation results.

[0048] The foregoing has described in detail the specific embodiments of the present invention. It should be further noted that the present invention is not limited to the specific embodiments described above. Those skilled in the art can make various adjustments or modifications within the scope of the claims, and such adjustments or modifications do not affect the substantive content of the present invention.

Claims

1. A controllable expression integrative cytosine base editing plasmid, characterized in that, The integrase encoding gene containing φC31 int and integration sites attP The plasmid pSET152 was used as the starting plasmid, and the tetracycline Tc induction expression system was selected. tetO -TetR and the classic terminator of Streptomyces fd The expression of the cBE fusion protein is controlled by cytosine editing, thus obtaining the plasmid. Under the guidance of sgRNA, the plasmid can mediate C·G→T·A site-directed base conversion, introducing a stop codon into the target gene to achieve gene inactivation.

2. The controllable expression integrative cytosine base editing plasmid according to claim 1, characterized in that, The plasmid is based on plasmid pSET152 and carries a gRNA expression cassette and a tetracycline Tc inducible expression system. tetO -TetR, the cBE gene encoding the cytosine base editing fusion protein, and the classical terminator of Streptomyces fd .

3. The controllable expression integrative cytosine base editing plasmid according to claim 1, characterized in that, In the plasmid etO-tetR Among gene expression control elements, constitutive strong promoters are the most important. stYnP drive tetR Genome shaping and expression; simultaneously, stYnP-tetR upstream introduction ermE and tetO Operator, in tetO Downstream and in stYnP-tetR The downstream of each gene contains restriction enzyme sites for insertion of the cBE-encoding gene and sgRNA element.

4. The controllable expression integrative cytosine base editing plasmid according to claim 1, characterized in that, In the expression unit of the cBE-encoding gene in the plasmid, the cBE fusion protein encoding gene is derived from the plasmid pCRISPR-cBEST; PermE* promoters and cBE-encoding genes rbs Add TetR operator between tetO The expression of cBE-encoded gene editing elements is affected by PermE* Promoter, TetR operator tetO Joint control enables the induced expression of the cBE fusion protein encoding gene.

5. The controllable expression integrative cytosine base editing plasmid according to claim 1, characterized in that, The DNA sequence of the plasmid is shown in SEQ ID NO.

1.

6. The controllable expression of an integrated cytosine base editing plasmid according to any one of claims 1-5, characterized in that, The plasmid can be implemented in Streptomyces: (1) φC31 Integrase-mediated attP Site-specific integration; (2) Tetracycline dose-dependent cBE fusion protein induced expression; (3) sgRNA-targeted C G→T A. Single-base editing; (4) The target gene is inactivated by introducing the STOP codon.

7. A method for constructing an integrated cytosine base editing plasmid for controllable expression according to claim 1, characterized in that, The method includes the following steps: S1. Employs a universal constitutive strong promoter for actinomycetes. stnYp Control genes tetR The expression, in stYnP-tetR upstream introduction ermE and tetO Operator, stYnP-tetR Downstream of the molecule is an EcoRV restriction site for inserting sgRNA elements; simultaneously, in tetO Downstream Nde I and Mfe I restriction site, used for insertion of cBE-encoding gene; etO-tetR Gene expression control elements were synthesized and constructed into plasmid pBlueScript SK(+). EcoR I / Not The plasmid was obtained at site I, denoted as plasmid SK- tet ; S2, Utilization Nde I and Eco RI digestion was performed to obtain the cBE-encoding gene element from plasmid CRISPR-cBEST, which was then cloned into plasmid SK- tet In Nde I and Mfe At the I restriction site, the correct clone was obtained and denoted as plasmid SK-. tet- cBEST; S3, Utilization Not I and Eco RI digestion, from plasmid SK- tet- Gene fragments containing the Tc induction system and editing system were recovered from cBEST and ligated into pSET152. Not I and Eco The integrated cytosine base editing plasmid is obtained by digestion with RI enzyme.

8. The construction method according to claim 7, characterized in that, In the cBE-encoded gene element, PermE* promoters and cBE-encoding genes rbs Add TetR operator between tetO The expression of cBE-encoded gene editing elements is affected by PermE* Promoter, TetR operator tetO Joint control enables the induced expression of the cBE fusion protein encoding gene.

9. The use of an integrated cytosine base editing plasmid according to any one of claims 1-6, or an integrated cytosine base editing plasmid constructed according to the method of claim 7 or 8, characterized in that, The integrative cytosine base editing plasmid is used for gene base editing of Streptomyces or rare actinomycete strains containing the φC31 integration site.

10. A method for gene editing using an integrative cytosine base editing plasmid, characterized in that, The method includes the following steps: A1. Construction of sgRNA expression fragment and plasmid assembly: Design a specific base-editing sgRNA for the target gene, and tandemly splice the kasO*p promoter, sgRNA sequence and lambda t0 terminator to obtain an sgRNA expression fragment; insert this fragment into the EcoRV restriction site of the integrative cytosine base-editing plasmid according to any one of claims 1-6 to construct the recombinant integrative I-cBEST editing plasmid; A2. Plasmid conjugation transfer and positive strain screening: The constructed I-cBEST recombinant plasmid was electroporated into the conjugation transfer donor strain E. coli ET12567 / pUZ8002; the recombinant plasmid was introduced into the target actinomycete strain through the Escherichia coli-Streptomyces indirect conjugation transfer system, and the conjugate was screened and its correctness was verified by PCR. A3. Tetracycline-induced intra-channel base editing: Verified positive conjugates were inoculated and cultured, tetracycline Tc was added to induce controllable expression of cBE fusion protein, and the culture was incubated at an incubator until site-directed base editing of the target gene was completed; alpramycin Apr resistance screening was performed; A4. Amplification of edited strains and identification of editing effect: Single colonies were randomly selected from plates and cultured in alpramycin-resistant medium; PCR amplification was performed using upstream and downstream specific primers for the editing site, the PCR products were recovered and sequenced, and the base editing and gene inactivation effects of the target gene were verified by sequence alignment.