A k. marxianus integrative expression vector

Abstract

The application discloses a Kluyveromyces marxianus integrated expression vector. The application provides a double-stranded DNA molecule which comprises the following elements from upstream to downstream: a Kluyveromyces marxianus chromosome upstream homologous arm, a eukaryotic promoter, a target gene, a Kluyveromyces marxianus IRES sequence, a eukaryotic screening gene, a eukaryotic transcription termination sequence and a Kluyveromyces marxianus chromosome downstream homologous arm. The application also provides a ring vector containing the double-stranded DNA molecule. The Kluyveromyces marxianus expression vector of the application provides a good tool for protein expression and metabolic pathway construction of Kluyveromyces marxianus.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to an integrative expression vector of *Kluyveromyces martensii*. Background Technology

[0002] Max Kluyveromycin ( Kluyveromyces marxianus Kluyveromyces is a microorganism with broad application prospects. It is a non-pathogenic yeast with unique biological characteristics, which makes it show great application value in many fields. The cells of Kluyveromyces are spherical or oval, with a diameter of 5-10 μm, and it reproduces by budding.

[0003] Kluyveromyces martensii is a commonly used microorganism in modern industrial biotechnology, the health product industry, and medical biotechnology. As a thermophilic yeast, it breaks the limitations of traditional yeasts on growth temperature, maintaining good metabolic activity and fermentation capacity in environments above 45°C. This characteristic makes it stand out in industrial production scenarios where energy is scarce and temperature control costs are high. Simultaneously, it possesses broad substrate utilization capabilities, efficiently metabolizing common sugars such as glucose and sucrose, and converting inexpensive biomass such as inulin and whey into high-value-added products, greatly expanding the range of raw materials for bio-fermentation. With its rapid growth, abundant enzyme production, and convenient gene manipulation, Kluyveromyces martensii has moved from the laboratory to industrial applications, becoming a core strain in food fermentation, biofuels, and industrial enzyme preparation, driving the green upgrading and technological innovation of related industries. Kluyveromyces martensii expression vectors are indispensable tools for the above applications and research, and the construction of various types of expression vectors is receiving increasing attention.

[0004] Expression vectors for *Kluyveromyces martensii* are typically plasmid-based. Commonly used plasmid-based expression vectors are *E. coli*-*Kluyveromyces martensii* shuttle vectors. However, these vectors introduce the *E. coli* replication origin and prokaryotic selection markers (such as the ampicillin resistance gene) into *Kluyveromyces martensii* cells, posing a potential biosafety risk. While in vivo assembly techniques can remove prokaryotic DNA elements from plasmid-based expression vectors, they increase the complexity of the process. Furthermore, constructing engineered bacteria using plasmid-based expression vectors is prone to plasmid loss, leading to unstable production performance. Summary of the Invention

[0005] The purpose of this invention is to provide an integrative expression vector for *Kluyveromyces martensii*. In a first aspect, the present invention claims protection for a double-stranded DNA molecule.

[0006] The double-stranded DNA molecule claimed in this invention comprises the following elements (eukaryotic element set) from upstream to downstream: upstream homologous arm of the *Kluyveromyces martensii* chromosome, eukaryotic promoter, target gene, *Kluyveromyces martensii* IRES sequence, eukaryotic selection gene, eukaryotic transcription termination sequence, and downstream homologous arm of the *Kluyveromyces martensii* chromosome.

[0007] The IRES sequence of *Kluyveromyces martensii* is a DNA sequence in *Kluyveromyces martensii* that has an internal ribosome entry site and the ability to initiate translation. In some embodiments of the present invention, the IRES sequence of *Kluyveromyces martensii* is shown as positions 4021-4551 of SEQ ID NO:1.

[0008] Furthermore, the upstream homologous arm of the *Kluyveromyces martensii* chromosome may be the upstream sequence of the 18S rDNA located on the *Kluyveromyces martensii* chromosome; the downstream homologous arm of the *Kluyveromyces martensii* chromosome may be the downstream sequence of the 18S rDNA located on the *Kluyveromyces martensii* chromosome.

[0009] In some embodiments of the present invention, the upstream sequence of the 18S rDNA located on the chromosome of *Kluyveromyces martensii* is shown in positions 1-700 of SEQ ID NO:1. The downstream sequence of the 18S rDNA located on the chromosome of *Kluyveromyces martensii* is shown in positions 5513-6212 of SEQ ID NO:1.

[0010] Furthermore, the eukaryotic promoter can be an endogenous promoter of yeast, such as the endogenous promoter of *Kluyveromyces martensii*. In some embodiments of the present invention, the endogenous promoter of *Kluyveromyces martensii* is the *Inulinase* gene promoter or the *Gap3* gene promoter of *Kluyveromyces martensii*. Specifically, the nucleotide sequence of the *Inulinase* gene promoter of *Kluyveromyces martensii* is shown at positions 701-1836 of SEQ ID NO:1; the nucleotide sequence of the *Gap3* gene promoter of *Kluyveromyces martensii* is shown in SEQ ID NO:2.

[0011] Furthermore, the eukaryotic transcription termination sequence can be an endogenous transcription termination sequence of yeast, such as the endogenous transcription termination sequence of *Kluyveromyces martensii*. In some embodiments of the present invention, the endogenous transcription termination sequence of *Kluyveromyces martensii* is the transcription termination sequence of the *Kluyveromyces martensii* URA3 gene. Specifically, the nucleotide sequence of the *Kluyveromyces martensii* URA3 gene transcription termination sequence is shown at positions 5356-5512 of SEQ ID NO:1.

[0012] In some embodiments of the present invention, the target gene is the encoding gene for lactoferrin (such as bovine lactoferrin). Specifically, the nucleotide sequence of the encoding gene for lactoferrin (such as bovine lactoferrin) is shown in positions 1837-4020 of SEQ ID NO:1.

[0013] Furthermore, the eukaryotic selection gene may be a auxotroph selection marker gene or an antibiotic selection marker gene.

[0014] Furthermore, the eukaryotic selection gene is an endogenous selection gene of *Kluyveromyces martensii*. In some embodiments of the present invention, the endogenous selection gene of *Kluyveromyces martensii* is the *URA3* gene of *Kluyveromyces martensii*. Specifically, the nucleotide sequence of the *URA3* gene of *Kluyveromyces martensii* is shown at positions 4552-5355 of SEQ ID NO:1.

[0015] In some embodiments of the present invention, the nucleotide sequence of the double-stranded DNA molecule includes (or is) positions 1-6212 of SEQ ID NO:1. Secondly, the present invention claims protection for a ring-shaped carrier.

[0016] The circular vector claimed in this invention comprises the double-stranded DNA molecule described in the first aspect above.

[0017] Furthermore, the circular vector may also include a set of prokaryotic elements, such as prokaryotic origin of replication and / or prokaryotic selection genes.

[0018] In some embodiments of the present invention, the prokaryotic replication origin is the *E. coli* replication origin. The prokaryotic selection gene is a kanamycin selection gene. Specifically, the nucleotide sequence of the *E. coli* replication origin is shown at positions 7923-8511 of SEQ ID NO:1. The nucleotide sequence of the kanamycin selection gene is shown at positions 8633-9448 of SEQ ID NO:1.

[0019] In some embodiments of the present invention, the sequence of the ring carrier is as shown in SEQ ID NO:1.

[0020] Thirdly, the present invention claims the use of the double-stranded DNA molecule described in the first aspect above or the circular vector described in the second aspect above in the preparation of a target protein; the target protein is encoded by the target gene described in the first aspect above.

[0021] Fourthly, the present invention claims protection for a method for preparing a target protein.

[0022] The method for preparing the target protein claimed in this invention may include the following steps (A1) or (A2): (A1) The double-stranded DNA molecule described in the first aspect above is introduced into the recipient strain of Kluyveromyces martensii, and the resulting recombinant yeast is cultured to obtain the target protein from the culture product; the target protein is encoded by the target gene described in the first aspect above. (A2) The circular vector described in the second aspect above is introduced into the recipient strain of *Kluyveromyces martensii*, and the resulting recombinant yeast is cultured to obtain the target protein from the culture product; the target protein is encoded by the target gene described in the first aspect above.

[0023] In this method, the eukaryotic promoter is used to initiate the expression of the gene encoding the target protein (i.e., the target gene). The eukaryotic selection gene can provide selection pressure for screening recombinant bacteria, thereby avoiding the limitations of existing methods, such as low selection pressure, inability to increase the copy number of the target fragment on the host chromosome, and thus, unsatisfactory expression levels of the target gene.

[0024] Fifthly, the present invention claims the use of the double-stranded DNA molecule described in the first aspect above or the circular vector described in the second aspect above in constructing an engineered strain of *Kluyveromyces martensii* for preparing a target protein; the target protein being encoded by the target gene described in the first aspect above.

[0025] Sixthly, the present invention claims a method for constructing an engineered strain of *Kluyveromyces martensii* for the preparation of a target protein.

[0026] The method for constructing an engineered strain of *Kluyveromyces martensii* for preparing a target protein, as claimed in this invention, may include the following steps (B1) or (B2): (B1) The double-stranded DNA molecule described in the first aspect above is introduced into the recipient strain of Kluyveromyces martensii to obtain an engineered strain of Kluyveromyces martensii for the preparation of the target protein. (B2) The circular vector described in the second aspect above is introduced into the recipient strain of Kluyveromyces martensii to obtain an engineered strain of Kluyveromyces martensii for the preparation of the target protein. The target protein is encoded by the target gene described in the first aspect above.

[0027] In a seventh aspect, the present invention claims protection for engineered strains of *Kluyveromyces martensii* obtained by means of the method described in the sixth aspect above.

[0028] Eighthly, the present invention claims the use of the engineered strain of *Kluyveromyces martensii* described in the seventh aspect above in the preparation of a target protein; said target protein is encoded by the target gene described in the first aspect above.

[0029] In some embodiments of the present invention, the *Kluyveromyces martensii* is *Kluyveromyces martensii*. KM:: △ hurray3 This strain is a variant of the genome of Kluyveromyces CS-01. Hurray! The strain obtained after gene knockout. The Kluyveromyces martensii CS-01 strain has the accession number CGMCC No. 30573 at the China General Microbiological Culture Collection Center.

[0030] When preparing the target protein (such as lactoferrin) using the method of this invention, the DNA fragments transformed into *Kluyveromyces martensii*, except for the target gene, are all DNA fragments from the *Kluyveromyces martensii*'s own chromosome. Other DNA fragments have been excised during vector linearization and do not contain any prokaryotic DNA elements. The *Kluyveromyces martensii* expression vector of this invention enables the expression of exogenous or endogenous genes in *Kluyveromyces martensii* without induction, allowing for the production of target proteins (such as lactoferrin) using *Kluyveromyces martensii*, or for the construction of metabolic pathways in genetically engineered strains. The *Kluyveromyces martensii* expression vector of this invention provides an excellent tool for protein expression and metabolic pathway construction in *Kluyveromyces martensii*. Attached Figure Description

[0031] Figure 1 Microscopic examination (40x) of Kluyveromyces martensii CS-01.

[0032] Figure 2 This is a schematic diagram of the structure of the recombinant plasmid pET-LF.

[0033] Figure 3 The images show genomic PCR verification gel images of positive single colonies. Lanes 1-11 show the identification results of primer pair YZ-F1 / R1, with a target band size of 4937 bp; lanes 12-22 show the identification results of primer pair YZ-F2 / R2, with a target band size of 4812 bp.

[0034] Figure 4 This is an SDS-PAGE image showing the expression level of bovine lactoferrin. + indicates a positive lactoferrin standard; - indicates a negative standard. KM:: △ura3 / pUKDN119 Negative control; 1 is KM::△ura3 / pUKDN119-LF ;2-9 are KM:: △ ura3::IRES::LF The arrow indicates lactoferrin (approximately 78 KD).

[0035] Figure 5 This is a Western blotting image showing the expression level of bovine lactoferrin. + indicates a positive lactoferrin standard; - indicates a negative standard. KM::△ura3 / pUKDN119 Negative control; 1 is KM::△ura3 / pUKDN119 - LF ;2-9 are KM:: △ ura3::IRES:: LF Lactoferrin is approximately 78 kDa in size.

[0036] Copyright notice Classification and nomenclature: Kluyveromyces martensii ( Kluyveromyces marxianus ); Biomaterial from ginseng: CS-01; Preservation institution: China General Microbiological Culture Collection Center, China Committee on the Preservation and Management of Microbial Cultures; The abbreviation for the depository institution is CGMCC. Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; Deposit date: May 9, 2024; Registered with the China National Collection Center (CGMCC) No. 30573. Detailed Implementation

[0037] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0038] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0039] The Kluyveromycin used in the following examples KM:: △ hurray3 Kluyveromyces macrocarpa was knocked out using CRISPR / Cas9 technology. CS-01 On the genome of (CGMCC No. 30573) Hurray! Obtained after genome sequencing (GenBank: CP015054.1, positions 204969-205772). Due to production requirements prohibiting the introduction of resistance selection markers, the genome was knocked out. Hurray! Genes. Among them, Kluyveromyces martensii ( Kluyveromyces marxianus The separation and identification of CS-01 are as follows: I. Strains Isolation The CS-01 strain was isolated from yak yogurt samples from Maduo County, Qinghai Province in August 2022.

[0040] Take 1g of yogurt sample, dilute it with 50ml of sterile water, then dilute it 10-10000 times with sterile water. Take 100μL of the diluted solution and spread it on a yeast solid medium YNB (amino-free yeast nitrogen source) plate. Incubate at 30℃ for 3-4 days, and pick single clones.

[0041] II. Strain Identification The bacterial strain was identified using the 18S rDNA method. Using the genome of strain CS-01 as a template, PCR amplification and sequencing were performed using the universal 18S rDNA primers ITS1 (TCCGTAGGTGAACCTGCG) and ITS4 (TCCTCCGCTTATTTATGG). The resulting 18S rDNA sequence is shown in SEQ ID NO:4. After comparison with known sequences in GenBank, it was found that the 18S rDNA sequence of CS-01 is consistent with... Kluyveromyces marxianus strain XJ-50 and Kluyveromyces marxianus The sequence similarity of isolate ilia21 was 99.71%, therefore strain CS-01 was identified as Kluyveromyces martensii (Kluyveromyces). Kluyveromyces marxianus ).

[0042] Cell morphological observation revealed that the colonies of strain CS-01 were round, milky white, with neat edges. Microscopic observation showed that the yeast cells were oval, approximately 4-8 μm in size, and reproduced by budding, with single, two, or multiple lines adhering together. Figure 1 ), which is consistent with the cell morphology of Max Kluyveromyces.

[0043] Based on the above identification, strain CS-01 was identified as *Kluyveromyces martensii* (Kluyveromyces). Kluyveromyces Marxian This strain was deposited at the China General Microbiological Culture Collection Center (CGMCC) on May 9, 2024, with the registration number CGMCC No. 30573.

[0044] Example 1: Construction of recombinant plasmid pET-LF 1. Genomic DNA was extracted from Kluyveromyces masculinii CS-01.

[0045] 2. Using a synthetically produced plasmid carrying the sequence shown in "SEQ ID NO:1, positions 6194-10598 + SEQ ID NO:1, positions 1-33" as a template, PCR amplification was performed using the primer pair composed of ET1 and ET2 (target sequence 4429 bp) to obtain a PCR amplification product containing the vector sequence (SEQ ID NO:1, positions 6194-10598 + positions 1-33). The primer sequences of ET1 and ET2 are as follows (5'-3'): ET1: GTAAAGGAACTATCAAATAAACGATAACTGATTtatacgctacgctatgctatgctatgctatgct; ET2: GCGAGTACAACCTTGGCCGctagagtactggtatttgataagagacg.

[0046] 3. Using the genomic DNA extracted in step 1 as a template, PCR amplification was performed using a primer pair consisting of 18sUP-F and 18sUP-R (target sequence 700 bp) to obtain the PCR amplification product containing the upstream homologous arm (positions 1-700 of SEQ ID NO:1) of Kluyveromyces martensii 18S rDNA. The primer sequences of 18sUP-F and 18sUP-R are as follows (5'-3'): 18sUP-F:catagcatagcatagcgtagcgtataAATCAGTTATCGTTTATTTGATAGTTCCTTTACTACA; 18sUP-R: gcgtttttgtgtttgtgtttgtgtttgtgCATGCTAATATATTCGAGCTTTCGCCTGC.

[0047] 4. Using the genomic DNA extracted in step 1 as a template, PCR amplification was performed using a primer pair consisting of 18sDown-F and 18sDown-R (target sequence 700 bp) to obtain the PCR amplification product containing the downstream homologous arm of Kluyveromyces martensii 18S rDNA (positions 5513-6212 of SEQ ID NO: 1). The primer sequences of 18sDown-F and 18sDown-R are as follows (5'-3'): 18sDown-F: cgtgctagaagctgttttttgcGAATAATGGAATAGGACGTTTGGTTCTAT; 18sDown-R:cgtctcttatcaaataccagtactctagCGGCCAAGGTTGTACTCGC.

[0048] 5. Using the PCR products from steps 2-4 as templates, perform overlap PCR using primer pair 18sDown-F and 18sUP-R (target sequence 5786 bp) to obtain donor fragment 1. Donor fragment 1 contains the nucleotide sequence shown in "SEQ ID NO:1 positions 5513-10598 + SEQ ID NO:1 positions 1-700".

[0049] 6. Using the genomic DNA extracted in step 1 as a template, PCR amplification was performed using the primer pair composed of Pinu-F and Pinu-R (target sequence 1136 bp) to obtain the PCR amplification product containing the Kluyveromyces marxoir yeast inulinase promoter (i.e., the inulinase gene promoter, as shown in positions 701-1836 of SEQ ID NO:1). The primer sequences of Pinu-F and Pinu-R are as follows (5'-3'): Pinu-F: CGAAAGCTCGAATATATTAGCATGcacaaacacaaacacaaacacaaaaac; Pinu-R:ATCCCACAATCCAAGAGAACCAAAACCTGCCTCATatctaacaaaaaaaaaattaaatgtgtcact.

[0050] 7. Using a biosynthesized plasmid carrying the bovine lactoferrin encoding gene (as shown in positions 1837-4020 of SEQ ID NO:1) as a template, PCR amplification was performed using the primer pair consisting of LF-F and LF-R (target sequence 2184 bp) to obtain the PCR amplification product containing LF (i.e., the bovine lactoferrin encoding gene, as shown in positions 1837-4020 of SEQ ID NO:1). The LF-F and LF-R primer sequences are as follows (5'-3'): LF-F:cacatttaattttttttttgttagatATGAGGCAGGTTTGGTTCTCTT; LF-R: agggagagagtccgagtCTATCATTATCTAGTCAAAAATGCACATGCTTCC.

[0051] 8. Using the genomic DNA extracted in step 1 as a template, PCR amplification was performed using the primer pair consisting of IRES-F and IRES-R (target sequence 531 bp) to obtain the PCR amplification product containing the IRES sequence of *Kluyveromyces martensii* (positions 4021-4551 of SEQ ID NO:1). The primer sequences of IRES-F and IRES-R are as follows (5'-3'): IRES-F: GTGCATTTTTGACTAGATAATGATAGactcggactctctctccctccct; IRES-R: agctgctctttccgagtaactcttagtcgacatcctcttttaatactccgagaatttttccc.

[0052] 9. Using the PCR products from steps 6-8 as templates, perform overlap PCR using primer pair consisting of primers Pinu-F and IRES-R (target sequence 3851 bp) to obtain donor fragment 2. Donor fragment 2 contains the nucleotide sequence shown in positions 701-4551 of SEQ ID NO:1.

[0053] 10. Using the genomic DNA extracted in step 1 as a template, PCR amplification was performed using the primer pair consisting of Ura-F and Ura-R (target sequence 961 bp) to obtain the PCR amplification product containing the URA3 gene of *Kluyveromyces martensii* (positions 4552-5355 of SEQ ID NO:1) and the URA3 gene transcription termination sequence (positions 5356-5512 of SEQ ID NO:1). The primer sequences of Ura-F and Ura-R are as follows (5'-3'): Ura-F:ctcggagtattaaaagaggatgtcgactaagagttatcggaaag; Ura-R: GAACCAAACGTCCTATTCCATTATTCgcaaaaaacagcttctagcacgtgactaaacttgtagc.

[0054] 11. The donor fragment 1 obtained in step 5, the donor fragment 2 obtained in step 9, and the PCR product obtained in step 10 were ligated using a one-step cloning rapid recombination kit (Tiangen, VI201-01) to obtain the recombinant plasmid pET-LF. A schematic diagram of the structure of the recombinant plasmid pET-LF is shown below. Figure 2 .

[0055] Sequencing results of the recombinant plasmid pET-LF showed its full sequence as shown in SEQ ID NO:1. In SEQ ID NO:1, nucleotides from the 5' end, positions 1 to 700, are 18S nucleotides from *Kluyveromyces martensii*. The upstream sequence of the rDNA (i.e., the upstream homologous arm) contains the following sequences: nucleotides 701 to 1836 are the promoter of the inulinase gene in *Kluyveromyces martensii*; nucleotides 1837 to 4020 are the encoding gene for the LF protein (bovine lactoferrin); nucleotides 4021 to 4551 are the IRES sequence of *Kluyveromyces martensii*; nucleotides 4552 to 5355 are the URA3 gene in *Kluyveromyces martensii*; nucleotides 5356 to 5512 are the transcription termination sequence of the URA3 gene in *Kluyveromyces martensii*; nucleotides 5513-6212 are the downstream sequence of the 18S rDNA in *Kluyveromyces martensii* (i.e., the downstream homologous arm); nucleotides 7923-8511 are the replication initiation site in *E. coli*; and nucleotides 8633-9448 are the prokaryotic selection marker gene (ampicillin resistance gene).

[0056] Example 2: Chemical transformation of yeast using recombinant integrative plasmid pET-LF Select Max Kluyveromycin KM:: △ hurray3 Single colonies were cultured in 30 mL of YPD medium until OD500 reached. 600 If the concentration is greater than 10, then take the bacterial culture into a 2mL Eppendorf tube and centrifuge to obtain the precipitate. Take 3mL of 1M LiAc and 3mL of 10×TE (formulation: 100mM Tris-HCl, 10mM EDTA adjusted to pH=8.0 with NaOH), add sterile water to 30mL, mix well to obtain 1×LiAc / TE buffer. Wash the precipitate twice with 1×LiAc / TE buffer to remove the supernatant. Then add 5 μL of Carrier DNA (Takara, catalog number 630440) to the center of the precipitate, and add 1 μg of the recombinant plasmid pET-LF obtained in Example 1. Gently mix with a pipette tip. Finally, add 300 μL of PEG / LiAc / TE solution (preparation method: dissolve 40g of PEG in water to the 80mL mark, sterilize at 115℃ for 20min, add 10mL each of sterile 1M LiAc and 10×TE and mix well). Gently mix, add an appropriate amount of 1M DTT to the system, the final DTT concentration is 10mM, mix again, then incubate at 30℃ for 15min, then at 47℃ for 15min. Finally, centrifuge to obtain the precipitate, add 150 μL of sterile water and mix well, spread on SD plates, and incubate at 30℃ for 2-4 days until single colonies grow. Perform colony PCR verification. The target band was validated using a two-segment method, at 4937 bp (corresponding to primer pair YZ-F1 / R1) and 4812 bp (corresponding to primer pair YZ-F2 / R2). The final selected target clones... KM:: △ ura3::IRES::LF ,like Figure 3 As shown, the strain that can amplify the two target bands shown above is obtained, i.e., the target clone. KM:: △ ura3::IRES::LF The primer pairs are as follows (5'-3'): YZ-F1: GCAGGCGAAAGCTCGAATATATTAGC; YZ-R1: GACAATTGAATACTGATGCCCCCGAC.

[0057] YZ-F2:cacaaacacaaacacaaacacaaaaacgc; YZ-R2: gcaaaaaacagcttctagcacgtgac.

[0058] Example 3: Chassis cell transformation of expression plasmid pUKDN119-LF use Hair II (NEB, R0157S) and Spe I (NEB, R3133S) endonuclease pairs with pUKDN119 plasmid (full sequence shown in SEQ ID NO:3; this plasmid contains the following elements: PKD1 fragment, inulinase promoter and signal peptide, PMD18-T, inulinase terminator, Ura3 promoter). Hurray! The gene was digested with enzymes, and the large fragment was recovered. Then, using primers LF-F / R (sequence shown below), the bovine lactoferrin-encoding gene was amplified using a biosynthesized plasmid as a template. Corresponding restriction enzyme sites were added to both ends of the primers, and the fragment was cleaved and recovered. This recovered fragment was then mixed with the large fragment of the pUKDN119 vector at a molar ratio of 1:4 and ligated using T4 ligase. The resulting recombinant plasmid was named pUKDN119-LF. The structure of this recombinant plasmid is described as follows: [The text abruptly ends here, likely due to an incomplete translation or source material.] Hair II and Spe The recombinant plasmid obtained by replacing the small fragment between I with the bovine lactoferrin encoding gene (positions 1837-4020 of SEQ ID NO:1).

[0059] In the recombinant plasmid pUKDN119-LF, the expression of the bovine lactoferrin-encoding gene is initiated by the inulinase promoter (positions 4768-5983 of SEQ ID NO:3) and its transcription is terminated by the inulinase terminator (positions 8771-9635 of SEQ ID NO:3).

[0060] Finally, the recombinant plasmid pUKDN119-LF was transformed into chassis cells. KM::△ura3 The procedure is as described in Example 2. Once a single colony has grown, it is verified using primers PINU-F and LF-R (sequences below). A single colony with a 2200 bp band is considered correct, followed by sequencing. The primers used in this example are shown below. The final positive transformant is named... KM::△ura3 / pUKDN119-LF .

[0061] LF-F: TACAAGAGAGACGGTCCGCGGGGTAGAAAGAAGAAGATCAGTTCAATGGTGTG; LF-R:CAAAGCTTGCGGCCTTAACTAGTTTATTTTCTCAAAAATTCACATGCTTCC; PINU-F: CAGCAATTAAATCCGGGGTAAG.

[0062] Simultaneously, the system was configured to convert the unloaded pUKDN119 into the chassis cell. KM::△ura3The control group was named the final positive transformant. KM::△ura3 / pUKDN119 .

[0063] Example 4: Detection of translational level of bovine lactoferrin in recombinant Kluyveromyces martensii. Single colonies of positive transformants obtained in Example 2 above. KM:: △ ura3::IRES::LF Yeast extract was collected in YG medium (formulation: 20 g / L yeast extract, 40 g / L glucose) and fermented at 30°C for 3 days at 200 rpm in a shaker. Then, the supernatant was collected by centrifugation at 8000 rpm for 15 min using a benchtop refrigerated centrifuge. 10% of the supernatant volume of 1M trichloroacetic acid was added to precipitate the secretory proteins in the supernatant. The mixture was incubated overnight at 4°C. The next day, it was centrifuged at 4°C for 20 min at 12000 rpm, discarding the supernatant and collecting the precipitate. The precipitate was washed twice with 2 mL of pre-cooled anhydrous ethanol, the supernatant was discarded, and the container was then placed on ice to evaporate the ethanol. Finally, 50 mM Tris-HCl (pH 8.5) was added to dissolve the precipitate, yielding the secretory proteins. Lactoferrin was quantitatively analyzed using SDS-PAGE and Western blot. The strain obtained in Example 3 was also used. KM::△ura3 / pUKDN119-LF As a control (a strain transformed with a conventional overexpression plasmid was used as a control for the strain transformed with the integrative expression plasmid of this invention). KM::△ura3 / pUKDN119 As a reference for no-load operation.

[0064] The SDS-PAGE graph of lactoferrin expression level is shown below. Figure 4 As shown, the Western Blot plot is as follows: Figure 5 As shown in the figure. KKM:: △ ura3::IRES::LF Capable of expressing complete lactoferrin, and control KM::△ura3 / pUKDN119-LF The absence of complete lactoferrin fragments in the supernatant indicates that the integrated expression of the IRES strategy of this invention promotes lactoferrin secretion.

[0065] Example 5: ELISA detection of lactoferrin secretion in recombinant Kluyveromyces martensii. The supernatant obtained from the initial centrifugation in Example 4 was used as the antigen and diluted 5-fold using the coating buffer. Lactoferrin (Saputo, 1001102) was used as the standard curve, with an initial concentration of 10 mg / L, and then serially diluted 5-fold to 1.28 × 10⁻⁶. -4Add 100 μL of coating buffer (formulation: 1.59 g Na2CO3, 2.93 g NaHCO3, diluted with distilled water to 1000 mL) to each well at mg / L concentration. Incubate at 4°C for 2 h. Discard the liquid from the wells. Add 150 μL of washing buffer (formulation: 0.2 g KH2PO4, 2.9 g Na2HPO4•12H2O, 0.5 mL Tween-20; diluted with distilled water to 1000 mL). Let stand for 3 min. Wash 3 times to remove the washing buffer. Add 100 μL of blocking buffer (formulation: 5 g skim milk dissolved in 100 mL washing buffer). Incubate at 37°C for 2 h. Wash 3 times. Add 0.1 mL of primary antibody-rabbit anti-lactoferrin (Bioss, bs-5810R) diluted 2000 times to each well. Incubate at 37°C for 1 h. Then wash. Add 0.1 mL of 6000-fold diluted enzyme-labeled secondary antibody—goat anti-rabbit (Sangon Biotech, SA00001-2)—to each well, incubate at 37°C for 1 h, and then wash. Add 0.1 mL of freshly prepared TMB substrate solution to each well, react at room temperature for 3-10 min, and stop the reaction by adding 50 μL of 2 mol / L H2SO4 to each well. Read the values ​​on an ELISA reader at 450 nm. The constructed chassis cells (i.e., single colonies of positive transformants obtained in Example 2) are then analyzed. KM:: △ ura3::IRES::LF The expression of lactoferrin was detected. Simultaneously, the strain obtained in Example 3 was used for detection. KM::△ura3 / pUKDN119-LF As a control, OD was measured. 450 After obtaining the value, according to the LF standard curve y=0.0556x+0.0758 (y is OD), 450 Reading value, x is the LF concentration, R 2 The lactoferrin yield was calculated using the formula (=0.9575), and the strain was tested in three replicates. KM:: △ ura3::IRES::LF The mean lactoferrin secretion yield was 284 μg / L, significantly higher than that of the control group. KM::△ura3 / pUKDN119-LF The lactoferrin secretion yield was shown in Table 1. It is evident that the integrative plasmid of this invention is more conducive to the expression of the target protein (such as lactoferrin) than conventional expression plasmids.

[0066] Table 1 KM:: △ ura3::IRES::LF Results of lactoferrin fermentation experiment

[0067] Note: P < 0.05 indicates a significant difference between the two.

[0068] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A double-stranded DNA molecule, characterized in that: The double-stranded DNA molecule comprises the following elements from upstream to downstream: an upstream homologous arm of the *Kluyveromyces martensii* chromosome, a eukaryotic promoter, a target gene, an IRES sequence of *Kluyveromyces martensii*, a eukaryotic selection gene, a eukaryotic transcription termination sequence, and a downstream homologous arm of the *Kluyveromyces martensii* chromosome.

2. The double-stranded DNA molecule according to claim 1, characterized in that: The IRES sequence of the Kluyveromyces martensii is shown in positions 4021-4551 of SEQ ID NO:1; And / or, The upstream homologous arm of the *Kluyveromyces martensii* chromosome is the upstream sequence of the 18S rDNA located on the *Kluyveromyces martensii* chromosome; the downstream homologous arm of the *Kluyveromyces martensii* chromosome is the downstream sequence of the 18S rDNA located on the *Kluyveromyces martensii* chromosome. Further, the nucleotide sequence of the upstream homologous arm of the Kluyveromyces chromosome is shown in positions 1-700 of SEQ ID NO:1; and / or, the nucleotide sequence of the downstream homologous arm of the Kluyveromyces chromosome is shown in positions 5513-6212 of SEQ ID NO:1; And / or, The eukaryotic promoter is an endogenous promoter of Kluyveromyces martensii; Furthermore, the endogenous promoter of *Kluyveromyces martensii* is the *Inulinase* gene promoter or the *gap3* gene promoter of *Kluyveromyces martensii*. Furthermore, the nucleotide sequence of the promoter of the Inulinase gene of Kluyveromyces martensii is shown in positions 701-1836 of SEQ ID NO:1; or, the nucleotide sequence of the promoter of the gap3 gene of Kluyveromyces martensii is shown in SEQ ID NO:2; And / or, The eukaryotic transcription termination sequence is an endogenous transcription termination sequence of *Kluyveromyces martensii*. Furthermore, the endogenous transcription termination sequence of *Kluyveromyces martensii* is the transcription termination sequence of the *Kluyveromyces martensii* URA3 gene. Furthermore, the nucleotide sequence of the transcription termination sequence of the URA3 gene of Kluyveromyces martensii is shown at positions 5356-5512 of SEQ ID NO:1; And / or, The target gene is the gene encoding lactoferrin; Furthermore, the nucleotide sequence of the gene encoding lactoferrin is shown in positions 1837-4020 of SEQ ID NO:1; And / or, The eukaryotic selection gene is an endogenous selection gene of Kluyveromyces martensii. Furthermore, the endogenous selection gene of *Kluyveromyces martensii* is the *URA3* gene of *Kluyveromyces martensii*. Furthermore, the nucleotide sequence of the URA3 gene of Kluyveromyces martensii is shown at positions 4552-5355 of SEQ ID NO:1; And / or, The nucleotide sequence of the double-stranded DNA molecule includes positions 1-6212 of SEQ ID NO:

1.

3. A ring-shaped carrier, characterized in that: The circular vector comprises the double-stranded DNA molecule as described in claim 1 or 2.

4. The annular carrier according to claim 3, characterized in that: The circular vector also includes a prokaryotic origin of replication and / or a prokaryotic selection gene; Furthermore, the prokaryotic replication origin is the Escherichia coli replication origin; and / or, the prokaryotic selection gene is a kanamycin selection gene; More specifically, the nucleotide sequence of the E. coli replication origin is shown in positions 7923-8511 of SEQ ID NO:1; and / or, the nucleotide sequence of the kanamycin selection gene is shown in positions 8633-9448 of SEQ ID NO:1; And / or, The sequence of the circular carrier is shown in SEQ ID NO:

1.

5. The use of the double-stranded DNA molecule of claim 1 or 2 or the circular vector of claim 3 or 4 in the preparation of a target protein; wherein the target protein is encoded by the target gene of claim 1 or 2.

6. A method for preparing a target protein, comprising the following steps (A1) or (A2): (A1) The double-stranded DNA molecule described in claim 1 or 2 is introduced into the recipient strain of Kluyveromyces martensii, and the resulting recombinant yeast is cultured to obtain the target protein from the culture product; (A2) The circular vector described in claim 3 or 4 is introduced into the recipient strain of *Kluyveromyces martensii*, and the resulting recombinant yeast is cultured to obtain the target protein from the culture product; The target protein is encoded by the target gene described in claim 1 or 2.

7. The use of the double-stranded DNA molecule of claim 1 or 2 or the circular vector of claim 3 or 4 in constructing an engineered strain of *Kluyveromyces martensii* for preparing a target protein; wherein the target protein is encoded by the target gene of claim 1 or 2.

8. A method for constructing an engineered strain of *Kluyveromyces martensii* for preparing a target protein, comprising the following steps (B1) or (B2): (B1) The double-stranded DNA molecule described in claim 1 or 2 is introduced into the recipient strain of Kluyveromyces martensii to obtain an engineered strain of Kluyveromyces martensii for the preparation of the target protein. (B2) The circular vector described in claim 3 or 4 is introduced into the recipient strain of *Kluyveromyces martensii* to obtain an engineered strain of *Kluyveromyces martensii* for the preparation of the target protein. The target protein is encoded by the target gene described in claim 1 or 2.

9. The engineered strain of *Kluyveromyces martensii* constructed using the method of claim 8.

10. The use of the engineered strain of *Kluyveromyces martensii* according to claim 9 in the preparation of the target protein; wherein the target protein is encoded by the target gene according to claim 1 or 2.

Images