Compositions and methods for driving t1 event diversity

Abstract

Systems and methods for generating multiple unique edits in T1 seeds of a plant are provided. In one example, a method comprises transforming at least one expression cassette into a plant cell or plant tissue. The at least one expression cassette can comprise a nucleic acid encoding a DNA modifying enzyme; optionally, a nucleic acid encoding at least one guide RNA (gRNA); and a floral mosaic (FMOS) regulatory sequence, wherein the FMOS regulatory sequence (i) mediates expression of the DNA modifying enzyme in at least one of floral primordia cells and floral reproductive organs, and (ii) mediates multiple edits in at least one of the floral primordia and the floral reproductive organs. The method can further comprise regenerating the plant cell or plant tissue into a TO plant having multiple T1 seeds, wherein the T1 seeds contain multiple unique edits.

Description

[0001] This application is a divisional application of the invention patent application filed on February 24, 2000, with application number 202080016568.6 and entitled "Composition and Method for Driving T1 Event Diversity".

[0002] Related applications

[0003] This application claims priority to PCT / CN 2019 / 076062, filed on February 25, 2019, which is incorporated herein by reference in its entirety.

[0004] sequence list

[0005] This application is accompanied by a sequence list named 81776-WO-PCT_Seq_ST25.txt, created on February 23, 2020, and approximately 1,566 kb in size. This sequence list is incorporated herein by reference in its entirety. This sequence list is submitted with this application via EFS-Web and is compliant with 37 C.FR § 1.824(a)(2)-(6) and (b). Background Technology

[0006] The development of scientific methods to improve crop quantity and quality is of paramount importance. Gene editing (e.g., through targeted mutagenesis, insertion events, allele substitution, etc.) is a crucial technique widely used to improve both the quantity and quality of various crops. Currently, there are many methods for editing specific gene targets, including CRISPR and CRISPR-associated sequence (Cas) enzymes, transcription activator-like effector nucleases (TALENs), large-scale nucleases, and zinc fingers. However, gene editing is not always an easy task.

[0007] Genome editing can relatively easily turn off gene function (often called "knockout"). Small insertions or deletions ("indels") in the coding sequence of a target gene can be readily produced using site-directed nucleases, such as Cas9 and associated CRISPR guide RNAs (gRNAs), often resulting in truncated proteins or frameshifts of aberrant sequences. Compared to these well-known gene knockout methods, other types of editing (such as editing alleles that result in partial loss or gain of function, or editing that alters gene expression levels or the function of protein products) can be very labor-intensive. Many of these edits require allele substitution, which is highly inefficient. Similarly, editing the deletion of entire exons or gene or chromosomal regions (large deletions) can be challenging because these edits may require simultaneous cleavage at more than one gRNA target site. Likewise, editing that introduces SNPs—for example, changing cytosine nucleotides to thymine nucleotides—can utilize "base editing" techniques, but only within certain windows relevant to the target site. There are only a few instances where obtaining the desired editing results is challenging due to the lack of complete specificity or inefficiency of the DNA-modifying enzyme systems used.

[0008] Allele substitution (sometimes called "allele swapping") is an editing method that uses homologous recombination or homologous targeted repair to replace an endogenous sequence in a plant cell with a new, available sequence. While this is fairly straightforward in yeast and many animal systems, it is extremely challenging in plants because DNA repair is highly predisposed to non-homologous end joining pathways. Furthermore, this process requires the delivery of abundant donor DNA to the cleavage site as a template for DNA repair via homologous recombination. This delivery is not easy to accomplish, especially in plants. For this reason, allele substitution in plants is typically very expensive and labor-intensive. For example, if one wishes to transform a plant and perform allele substitution, it may require a thousand stable transformation events to ensure that only one or two of these events result in an allele swap. Efficiency is typically less than 1%, and in some cases, it is between 0% and 0.3%. Even in the best crop, line, and construct designs, efficiency remains very low.

[0009] The applicant believes that the cost and labor intensity of producing allele substitutions, large deletions, certain base edits, and various other editing results have become a major bottleneck in plant breeding. Few methods can alleviate the extreme inefficiency of this process. Therefore, this disclosure addresses at least one of these or other problems.

[0010] Besides allelic substitution, another major challenge in genome editing is the time and labor required to produce a wide variety of sequences (allelic diversity at loci). For example, generating diverse allelic arrays of gene-coding sequences or producing expression diversity by modifying the regulatory regions (promoters) of genes is very time-consuming and expensive. In many embodiments, this disclosure also relates to cost-effective methods for generating allelic sequences. These and other benefits will become apparent from the detailed description below. Summary of the Invention

[0011] This disclosure relates in particular to systems, compositions, and methods for improving gene editing efficiency (e.g., for reducing the number of transformations required to generate multiple edits in plant DNA). In various embodiments, this disclosure relates to methods for generating multiple unique edits (e.g., multiple unique allelic substitutions, multiple unique base insertions, multiple unique base deletions, and / or multiple unique base substitutions) in T1 seeds of plants.

[0012] For example, these methods include transforming at least one expression cassette into plant cells or plant tissues, wherein the at least one expression cassette contains a nucleic acid encoding a DNA-modifying enzyme; a floral mosaic (FMOS) regulatory sequence; and optionally, a nucleic acid encoding at least one guide RNA (gRNA). The FMOS regulatory sequence mediates the expression of the DNA-modifying enzyme in at least one of the floral primordia cells and floral reproductive organs (e.g., anthers or carpels), and mediates multiple edits in the floral primordia cells and floral reproductive organs. The plant cells or tissues are then allowed to grow, pollinate, and produce multiple T1 seeds containing multiple unique edits. The FMOS regulatory sequence will include an FMOS promoter, and in some embodiments, further includes an FMOS terminator.

[0013] The expression rate of DNA-modifying enzymes may vary from embodiment to embodiment, but it is significant in at least one of the floral primordia and floral reproductive organs, especially when compared to vegetative growth and mature seeds. For example, the expression rate in floral primordia and / or floral reproductive organs will be at least twice that in leaf tissue or shoot apical meristem (SAM), and the expression rate in floral primordia and / or floral reproductive organs will be at least twice that in seeds or callus. More typically, the expression rate will be even higher, for example, at least 10 times, at least 50 times, at least 100 times, at least 500 times or more, for example, at least 1000 times higher. In some embodiments, there will be no expression in one or both of the vegetative tissues or seeds.

[0014] Using the methods disclosed herein, multiple unique edits can be generated in a T1 seed. For example, a T1 generation seed may contain at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, or at least 95 unique edits.

[0015] The selected DNA-modifying enzymes can vary and may include, for example, site-directed nucleases selected from the group consisting of: broad-spectrum nucleases (MN); zinc finger nucleases (ZFN); transcription activator-like effector nucleases (TALEN); Cas9 nucleases, Cas12a (also referred to herein as "Cpf1") nucleases, Cas12b nucleases, Cas12i nucleases, Cas12h nucleases, etc.; dCas9-FokI; dCpf1-FokI; and intercalated DNA-modifying enzymes. Chimeric Cas9-cytidine deaminase or chimeric Cas12a-cytidine deaminase; chimeric Cas9-adenine deaminase or chimeric Cas12a-adenine deaminase (AID); Cas9-EvolvR sequence or Cas12aEvolvR sequence (error-prone bacterial DNA polymerase I); chimeric FEN1-FokI, and Mega-TAL, nickase Cas9 (nCas9), chimeric dCas9 non-FokI nuclease and dCas12a non-FokI nuclease.

[0016] When multiple unique allelic substitutions are generated, the at least one expression cassette may also include additional components, including a target nucleic acid (also referred to herein as “donor DNA”), to confer the desired allele. Additional features, such as a replicase gene (Rep or RepA) that drives the replication of the donor DNA, may be used to assist in the replication of the donor DNA. In many instances, the donor DNA will be a component of the replicon, which includes additional features, such as a long intergenic region (LIR) of wheat dwarf virus (WDV) and a short intergenic region (SIR) derived from WDV, for example. Rep / RepA initiates rolling circle amplification of the donor DNA, which is located between the long intergenic region (LIR) and the short intergenic region (SIR) of the same virus, where migration protein genes and coating protein genes are typically present.

[0017] In some embodiments, the DNA-modifying enzyme is a Cas9 nuclease or a Cas12a nuclease, and the at least one expression cassette contains a nucleic acid encoding a gRNA. The nucleic acid encoding the gRNA is operatively linked to an FMOS promoter or a second promoter. The at least one expression cassette may further contain a target nucleic acid (donor DNA) and be usable for allelic substitution editing. The at least one expression cassette may further contain a replication promoter operatively linked to the donor DNA to drive the replication of the donor DNA.

[0018] These methods may further include growing T1 seeds to produce multiple T1 plants, measuring at least one phenotype in the T1 generation plants, and selecting T1 generation plants based on the measured phenotypic differences driven by unique editing. In some embodiments, these methods may include sequencing the insertion sites of donor DNA, INDEL, or SNP in the selected T1 generation plants, sequencing the insertion sites of donor DNA, INDEL, or SNP in the unselected T1 generation plants, and aligning these sequences. The selected plants with unique editing may also be hybridized with plants without unique editing or self-pollinated to produce offspring with unique editing.

[0019] In another embodiment, a method for generating multiple unique edits in T1 seeds of a plant includes expressing a nucleic acid encoding a DNA-modifying enzyme and a nucleic acid encoding a guide RNA (gRNA) in floral primordial cells or floral reproductive organs. At least one of the nucleic acid encoding the DNA-modifying enzyme and the nucleic acid encoding the gRNA is operatively linked to an FMOS promoter. The plant tissue is then regenerated into a plant with multiple T1 seeds containing multiple unique edits. In this example, the method may further include delivering donor DNA to plant cells or plant tissues in which the edits are expressed, and inserting the donor DNA into the plant's DNA, for example, to produce allelic substitutions, such as those with gain-of-function or functional substitution.

[0020] This disclosure also relates to various compositions for improving gene editing efficiency. For example, one embodiment includes at least one expression cassette for producing unique edits in T1 seeds of plants. In this embodiment, the expression cassette comprises a nucleic acid encoding a DNA-modifying enzyme, optionally a nucleic acid encoding at least one guide RNA (gRNA), and an FMOS promoter. In another embodiment, the at least one expression cassette is contained in a vector.

[0021] In some embodiments, this disclosure provides methods and compositions for altering the expression of target genes in plant seeds. Exemplary methods include a) transforming at least one expression cassette into plant cells or plant tissues, wherein the at least one expression cassette contains a nucleic acid encoding a DNA-modifying enzyme; a nucleic acid encoding at least one guide RNA (gRNA), wherein the at least one guide RNA targets a regulatory region of a target gene; and a floral mosaic (FMOS) regulatory sequence, wherein the FMOS regulatory sequence (i) mediates the expression of a DNA-modifying enzyme in at least one of floral primordia cells and floral reproductive organs, and (ii) mediates multiple edits in a regulatory region of a target gene in at least one of floral primordia and floral reproductive organs. Plant cells or plant tissues can be regenerated into T0 plants having multiple T1 seeds, wherein the T1 seeds contain multiple unique edits in the regulatory regions of the target genes, thereby generating multiple target gene expression profiles.

[0022] In some embodiments, this disclosure provides methods and compositions for generating variable knockout combinations in a gene regulatory network (GRN) having at least a first DNA encoding a first network member and a second DNA encoding a second network member. An exemplary method includes a) transforming at least one expression cassette into plant cells or plant tissues, wherein the at least one expression cassette contains a nucleic acid encoding a DNA-modifying enzyme; a nucleic acid encoding a first guide RNA (gRNA) that targets the first DNA encoding the first network member; a nucleic acid encoding a second guide RNA (gRNA) that targets the second DNA encoding the second network member; and a floral mosaic (FMOS) regulatory sequence, wherein the FMOS regulatory sequence (i) mediates the expression of the DNA-modifying enzyme in at least one of the floral primordia cells and floral reproductive organs, and (ii) mediates multiple edits in at least one of the floral primordia and floral reproductive organs. The plant cells or tissues can then be regenerated into T0 plants having multiple T1 seeds, wherein the T1 seeds contain multiple unique knockout combinations in the GRN.

[0023] In some embodiments, this disclosure provides methods and compositions for generating multiple unique point mutations in T1 seeds of plants. Exemplary methods include a) transforming at least one expression cassette into plant cells or plant tissues, wherein the at least one expression cassette comprises a nucleic acid encoding a catalytically inactivated Cas (dCas); a nucleic acid encoding at least one guide RNA (gRNA) carrying an MS2 hairpin binding site; a nucleic acid encoding a deaminase; and a floral mosaic (FMOS) regulatory sequence, wherein the FMOS regulatory sequence (i) mediates the expression of a DNA-modifying enzyme in at least one of the floral primordia cells and floral reproductive organs, and (ii) mediates multiple edits in at least one of the floral primordia and floral reproductive organs. Plant cells or tissues can be regenerated into T0 plants having multiple T1 seeds containing multiple unique point mutations. dCas may vary depending on the embodiment and may include, for example, inactivated Cas9 (dCas9) or inactivated Cas12a (dCas12a). An exemplary deaminase is an activation-induced cytidine deaminase (AID).

[0024] In other embodiments, a method for generating multiple unique point mutations in T1 seeds of a plant includes a) transforming at least one expression cassette into plant cells or plant tissues, wherein the at least one expression cassette contains nucleic acid encoding a nick variant of Cas (nCas); nucleic acid encoding DNA polymerase (Pol); nucleic acid encoding at least one guide RNA (gRNA); and a floral mosaic (FMOS) regulatory sequence, wherein the FMOS regulatory sequence (i) mediates the expression of nCas and Pol in at least one of the floral primordia cells and floral reproductive organs, and (ii) mediates multiple edits in at least one of the floral primordia and floral reproductive organs. Plant cells or tissues can be regenerated into T0 plants with multiple T1 seeds containing multiple unique point mutations. nCas can be a nick variant of Cas9 (nCas9) or a nick variant of Cas12a (nCas12a), which can be fused to, for example, Pol. In many instances, nCas is nCas9 with a D10A mutation. In many instances, Pol is Escherichia coli Pol, which may include at least one of the following mutations: D424A, I709N, and A759R.

[0025] In some embodiments, this disclosure provides compositions and methods for deleting large intergenic regions in T1 seeds of plants. Exemplary methods include a) transforming at least one expression cassette into plant cells or plant tissues, wherein the at least one expression cassette contains a nucleic acid encoding an RNA-directed nuclease; a nucleic acid encoding at least one first guide RNA (gRNA-1); a nucleic acid encoding at least one second guide RNA (gRNA-2), wherein gRNA-1 targets a first target sequence on a chromosome and wherein gRNA-2 targets a second target sequence on a chromosome, wherein the first target sequence and the second target sequence are at least 0.1 Mb apart; and a floral mosaic (FMOS) regulatory sequence, wherein the FMOS regulatory sequence (i) mediates the expression of a DNA-modifying enzyme in at least one of the floral primordia cells and floral reproductive organs, and (ii) mediates multiple edits in at least one of the floral primordia and floral reproductive organs. Plant cells or tissues can be regenerated into T0 plants having multiple T1 seeds containing at least one large intergenic deletion. The size of the large intergenic region may vary depending on the embodiment. For example, a large intergenic region may include at least one region within the range of at least one of 0.1-2 Mb, 0.2-1.9 Mb, 0.3-1.8 Mb, 0.4-1.7 Mb, 0.5-1.6 Mb, 0.6-1.5 Mb, 0.7-1.4 Mb, 0.7-1.3 Mb, 0.7-1.2 Mb, 0.3-1.1 Mb, 0.3-1.0 Mb, 0.4-1.0 Mb, 0.5-1.0 Mb, and 0.6-0.8 Mb. Similarly, the distance between the first target sequence and the second target sequence may vary depending on the embodiment. For example, the first target sequence and the second target sequence may be separated by at least one distance in at least one of the ranges of 0.1-2 Mb, 0.2-1.9 Mb, 0.3-1.8 Mb, 0.4-1.7 Mb, 0.5-1.6 Mb, 0.6-1.5 Mb, 0.7-1.4 Mb, 0.7-1.3 Mb, 0.7-1.2 Mb, 0.3-1.1 Mb, 0.3-1.0 Mb, 0.4-1.0 Mb, 0.5-1.0 Mb, and 0.6-0.8 Mb. The nucleic acid encoding gRNA-1 is operatively ligated to the FMOS promoter or the second promoter, and the nucleic acid encoding gRNA-2 is operatively ligated to the FMOS promoter, to the second promoter, or to the third promoter.

[0026] In other embodiments, this disclosure provides additional compositions and methods for generating multiple unique edits in T1 seeds of plants. Exemplary methods include a) transforming at least one expression cassette into plant cells or plant tissues, wherein the at least one expression cassette comprises a nucleic acid encoding an RNA-directed nuclease; a nucleic acid encoding a guide RNA (gRNA); and a floral mosaic (FMOS) regulatory sequence comprising an FMOS promoter, wherein the FMOS regulatory sequence (i) mediates the expression of gRNA in at least one of floral primordia cells and floral reproductive organs, (ii) mediates multiple edits in at least one of floral primordia and floral reproductive organs, (iii) expresses at least two-fold, at least three-fold, at least four-fold, at least five-fold, and at least six-fold more gRNA in at least one of floral primordia and floral reproductive organs than in shoot apical meristem (SAM), and (iv) expresses at least two-fold, at least three-fold, at least four-fold, at least five-fold, and at least six-fold more gRNA in at least one of floral primordia and floral reproductive organs than in seeds. Plant cells or tissues can be regenerated into plants with multiple T1 seeds, each with multiple unique edits.

[0027] In some aspects, this disclosure provides crop plants or seeds thereof that are available or obtainable through any of the uses or methods described in the embodiments herein. In some aspects, this disclosure provides plant cells comprising at least one expression cassette as disclosed herein.

[0028] The foregoing summary is intended to outline certain embodiments disclosed herein. Embodiments will be described in more detail in the tables and descriptions below. However, it will be clear that the specific descriptions of particular embodiments are not intended to limit the scope of the invention.

[0029] A brief explanation of sequence listings

[0030] SEQ ID NO:1 is the nucleotide sequence of vector 24301.

[0031] SEQ ID NO:2 is the nucleotide sequence of the promoter prZmAP1-01 in vector 24301.

[0032] SEQ ID NO:3 is the nucleotide sequence of the terminator tZmAP1-01 in vector 24301.

[0033] SEQ ID NO:4 is the nucleotide sequence of cCas9-02 in vector 24301.

[0034] SEQ ID NO:5 is the nucleotide sequence of rsgRNAZmADH1-01 in vector 24301.

[0035] SEQ ID NO:6 is the nucleotide sequence of the ZmADH1 target in vector 24301.

[0036] SEQ ID NO:7 is the nucleotide sequence of rCrRNA-01 in vector 24301.

[0037] SEQ ID NO:8 is the nucleotide sequence of rTracrRNA-01 in vector 24301.

[0038] SEQ ID NO:9 is the nucleotide sequence of the promoter prOsU3-01 in vector 24301.

[0039] SEQ ID NO:10 is the nucleotide sequence of vector 24224 (control).

[0040] SEQ ID NO:11 is the nucleotide sequence of the promoter _prCMP-04 in vector 24224.

[0041] SEQ ID NO:12 is the nucleotide sequence of the terminator tNOS-05-01 in vector 24224.

[0042] SEQ ID NO:13 is the nucleotide sequence of Cas9 in vector 24224.

[0043] SEQ ID NO:14 is the nucleotide sequence of rsgRNAZmADH1-01 in vector 24224.

[0044] SEQ ID NO:15 is the nucleotide sequence of the ZmADH1 target in vector 24224.

[0045] SEQ ID NO:16 is the nucleotide sequence of rCrRNA-01 in vector 24224.

[0046] SEQ ID NO:17 is the nucleotide sequence of rTracrRNA-01 in vector 24224.

[0047] SEQ ID NO:18 is the nucleotide sequence of the promoter prOsU3-01 in vector 24224.

[0048] SEQ ID NO:19 is the nucleotide sequence of vector 24265.

[0049] SEQ ID NO:20 is the nucleotide sequence of the promoter prZmBde1-01 in vector 24265.

[0050] SEQ ID NO:21 is the nucleotide sequence of the terminator tNOS-05-01 in vector 24265.

[0051] SEQ ID NO:22 is the nucleotide sequence of vector 24266.

[0052] SEQ ID NO:23 is the nucleotide sequence of the promoter prZmBde1-01 in vector 24266.

[0053] SEQ ID NO:24 is the nucleotide sequence of the terminator tZmBde1-01 in vector 24266.

[0054] SEQ ID NO:25 is the nucleotide sequence of vector 24269.

[0055] SEQ ID NO:26 is the nucleotide sequence of the promoter prZmAGO18A-01 in vector 24269.

[0056] SEQ ID NO:27 is the nucleotide sequence of the terminator tZmAGO18A-01 in vector 24269.

[0057] SEQ ID NO:28 is the nucleotide sequence of vector 24270.

[0058] SEQ ID NO:29 is the nucleotide sequence of the promoter prZmAGO5B-01 in vector 24270.

[0059] SEQ ID NO:30 is the nucleotide sequence of the terminator tZmAGO5B-01 in vector 24270.

[0060] SEQ ID NO:31 is the nucleotide sequence of vector 24289.

[0061] SEQ ID NO:32 is the nucleotide sequence of the promoter prZmAG5-02 in vector 24289.

[0062] SEQ ID NO:33 is the nucleotide sequence of the terminator tZmAG5-01 in vector 24289.

[0063] SEQ ID NO:34 is the nucleotide sequence of vector 24299.

[0064] SEQ ID NO:35 is the nucleotide sequence of the promoter prZmAG5-01 in vector 24299.

[0065] SEQ ID NO:36 is the nucleotide sequence of the terminator tZmAG5-01 in vector 24299.

[0066] SEQ ID NO:37 is the nucleotide sequence of vector 24230.

[0067] SEQ ID NO:38 is the nucleotide sequence of the promoter prZmAGO18B-01 in vector 24230.

[0068] SEQ ID NO:39 is the nucleotide sequence of the terminator tZmAGO18B-01 in vector 24230.

[0069] SEQ ID NO:40 is the nucleotide sequence of vector 24243.

[0070] SEQ ID NO:41 is the nucleotide sequence of the promoter prOsMEL1-01 in vector 24243.

[0071] SEQ ID NO:42 is the nucleotide sequence of the terminator tOsMEL1-01 in vector 24243.

[0072] SEQ ID NO:43 is the nucleotide sequence of vector 24305.

[0073] SEQ ID NO:44 is the nucleotide sequence of the promoter prOsMEL1-02 in vector 24305.

[0074] SEQ ID NO:45 is the nucleotide sequence of the terminator tOsMEL1-01 in vector 24305.

[0075] SEQ ID NO:46 is the nucleotide sequence of vector 24306.

[0076] SEQ ID NO:47 is the nucleotide sequence of the promoter prZmCoLig-01 in vector 24306.

[0077] SEQ ID NO:48 is the nucleotide sequence of the terminator tZmCoLig-01 in vector 24306.

[0078] SEQ ID NO:49 is the nucleotide sequence of vector 24320.

[0079] SEQ ID NO:50 is the nucleotide sequence of the promoter prZmBde1-02 in vector 24320.

[0080] SEQ ID NO:51 is the nucleotide sequence of the terminator tZmBde1-01 in vector 24320.

[0081] SEQ ID NO:52 is the nucleotide sequence of vector 24426.

[0082] SEQ ID NO:53 is the nucleotide sequence of the promoter prOsZFP-01 in vector 24426.

[0083] SEQ ID NO:54 is the nucleotide sequence of the terminator tOsZFP-01 in vector 24426.

[0084] SEQ ID NO:55 is the nucleotide sequence of vector 24427.

[0085] SEQ ID NO:56 is the nucleotide sequence of the promoter prZmAMS-01 in vector 24427.

[0086] SEQ ID NO:57 is the nucleotide sequence of the terminator tZmAMS-01 in vector 24427.

[0087] SEQ ID NO:58 is the nucleotide sequence of vector 24428.

[0088] SEQ ID NO:59 is the nucleotide sequence of the promoter prZmAMS-01 in vector 24428.

[0089] SEQ ID NO:60 is the nucleotide sequence of the terminator tNOS-05-01 in vector 24428.

[0090] SEQ ID NO:61 is the nucleotide sequence of vector 24454.

[0091] SEQ ID NO:62 is the nucleotide sequence of the promoter prZmExine1-01 in vector 24454.

[0092] SEQ ID NO:63 is the nucleotide sequence of the terminator tZmExine1-01 in vector 244254.

[0093] SEQ ID NO:64 is the nucleotide sequence of vector 24455.

[0094] SEQ ID NO:65 is the nucleotide sequence of the promoter prOsExine1-01 in vector 24455.

[0095] SEQ ID NO:66 is the nucleotide sequence of the terminator tOsExine1-01 in vector 244255.

[0096] SEQ ID NO:67 is the nucleotide sequence of vector 24458.

[0097] SEQ ID NO:68 is the nucleotide sequence of the promoter prZmAMS-01 in vector 24458.

[0098] SEQ ID NO:69 is the nucleotide sequence of the terminator tNOS-05-01 in vector 244258.

[0099] SEQ ID NO:70 is the nucleotide sequence of vector 24459.

[0100] SEQ ID NO:71 is the nucleotide sequence of the promoter prOsTBr1-01 in vector 24459.

[0101] SEQ ID NO:72 is the nucleotide sequence of the terminator tOsTBr1-01 in vector 24429.

[0102] SEQ ID NO:73 is the nucleotide sequence of vector 24460.

[0103] SEQ ID NO:74 is the nucleotide sequence of the promoter prOsAP1-01 in vector 24460.

[0104] SEQ ID NO:75 is the nucleotide sequence of the terminator tOsAP1-01 in vector 24460.

[0105] SEQ ID NO:76 is the nucleotide sequence of vector 24548.

[0106] SEQ ID NO:77 is the nucleotide sequence of the promoter prZmRa2-02 in vector 24548.

[0107] SEQ ID NO:78 is the nucleotide sequence of the terminator tZmRa2-02 in vector 24548.

[0108] SEQ ID NO:79 is the nucleotide sequence of vector 24602.

[0109] SEQ ID NO:80 is the nucleotide sequence of the promoter prOsCoLig-01 in vector 24602.

[0110] SEQ ID NO:81 is the nucleotide sequence of the terminator tOsCoLig-01 in vector 24602.

[0111] SEQ ID NO:82 is the nucleotide sequence of vector 24688.

[0112] SEQ ID NO:83 is the nucleotide sequence of the promoter prZmWUS2-01 in vector 24688.

[0113] SEQ ID NO:84 is the nucleotide sequence of the terminator tZmWUS2-01 in vector 24688.

[0114] SEQ ID NO:85 is the nucleotide sequence of vector 24300.

[0115] SEQ ID NO:86 is the nucleotide sequence of the promoter prZmAGO18B-01 in vector 24300.

[0116] SEQ ID NO:87 is the nucleotide sequence of the terminator tZmAGO18B-01 in vector 24300.

[0117] SEQ ID NO:88 is the nucleotide sequence of vector 25123.

[0118] SEQ ID NO:89 is the nucleotide sequence of the promoter prZmBde1-02 in vector 25123.

[0119] SEQ ID NO:90 is the nucleotide sequence of the terminator tZmBde1-01 in vector 25123.

[0120] SEQ ID NO:91 is the nucleotide sequence of the promoter prOsU3-1 in vector 25123.

[0121] SEQ ID NO:92 is the nucleotide sequence of intron iZmBde1-01 in vector 25123.

[0122] SEQ ID NO:93 is the nucleotide sequence of xNLS-01 in vector 25123.

[0123] SEQ ID NO:94 is the nucleotide sequence of xALS target-01 in vector 25123.

[0124] SEQ ID NO:95 is the nucleotide sequence of the ALS target in vector 25123.

[0125] SEQ ID NO:96 is the nucleotide sequence of the ALS target in vector 25123.

[0126] SEQ ID NO:97 is the nucleotide sequence (donor DNA) of xZmALS-V2 in vector 25123.

[0127] SEQ ID NO:98 is the nucleotide sequence of rsgRNAZmALS-V1 in vector 25123.

[0128] SEQ ID NO:99 is the nucleotide sequence of rCrRNA-01 in vector 25123.

[0129] SEQ ID NO:100 is the nucleotide sequence of rTracrRNA-01 in vector 25123.

[0130] SEQ ID NO:101 is the nucleotide sequence of the promoter prOsU3-01 in vector 25123.

[0131] SEQ ID NO:102 is the nucleotide sequence of Cas9 in 25123. SEQ ID NO:103 is the edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 1).

[0132] SEQ ID NO:104 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 1a).

[0133] SEQ ID NO:105 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 2).

[0134] SEQ ID NO:106 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 2a).

[0135] SEQ ID NO:107 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 3).

[0136] SEQ ID NO:108 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 4).

[0137] SEQ ID NO:109 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 5).

[0138] SEQ ID NO:110 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 6).

[0139] SEQ ID NO:111 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 6a).

[0140] SEQ ID NO:112 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 7).

[0141] SEQ ID NO:113 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 7a).

[0142] SEQ ID NO:114 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 8).

[0143] SEQ ID NO:115 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 9).

[0144] SEQ ID NO:116 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 10).

[0145] SEQ ID NO:117 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 10a).

[0146] SEQ ID NO:118 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 12).

[0147] SEQ ID NO:119 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 12a).

[0148] SEQ ID NO:120 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 14).

[0149] SEQ ID NO:121 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 14a).

[0150] SEQ ID NO:122 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 15).

[0151] SEQ ID NO:123 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 16).

[0152] SEQ ID NO:124 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 16a).

[0153] SEQ ID NO:125 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 17).

[0154] SEQ ID NO:126 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 17a).

[0155] SEQ ID NO:127 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 19).

[0156] SEQ ID NO:128 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 19a).

[0157] SEQ ID NO:129 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 19b).

[0158] SEQ ID NO:130 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 20).

[0159] SEQ ID NO:131 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 21).

[0160] SEQ ID NO:132 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 21a).

[0161] SEQ ID NO:133 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 22).

[0162] SEQ ID NO:134 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 22a).

[0163] SEQ ID NO:135 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 23).

[0164] SEQ ID NO:136 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 23a).

[0165] SEQ ID NO:137 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 23b).

[0166] SEQ ID NO:138 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 24).

[0167] SEQ ID NO:139 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 24a).

[0168] SEQ ID NO:140 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 24b).

[0169] SEQ ID NO:141 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 25).

[0170] SEQ ID NO:142 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 25a).

[0171] SEQ ID NO:143 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 26).

[0172] SEQ ID NO:144 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 26a).

[0173] SEQ ID NO:145 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 27).

[0174] SEQ ID NO:146 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 28).

[0175] SEQ ID NO:147 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 28a).

[0176] SEQ ID NO:148 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 29).

[0177] SEQ ID NO:149 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 29a).

[0178] SEQ ID NO:150 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 30).

[0179] SEQ ID NO:151 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 30a).

[0180] SEQ ID NO:152 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 31).

[0181] SEQ ID NO:153 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 32).

[0182] SEQ ID NO:154 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 32a).

[0183] SEQ ID NO:155 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 33).

[0184] SEQ ID NO:156 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 33a).

[0185] SEQ ID NO:157 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 34).

[0186] SEQ ID NO:158 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 34a).

[0187] SEQ ID NO:159 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 35).

[0188] SEQ ID NO:160 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 35a).

[0189] SEQ ID NO:161 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 36).

[0190] SEQ ID NO:162 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 36a).

[0191] SEQ ID NO:163 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 37).

[0192] SEQ ID NO:164 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 37a).

[0193] SEQ ID NO:165 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 38).

[0194] SEQ ID NO:166 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 38a).

[0195] SEQ ID NO:167 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 39).

[0196] SEQ ID NO:168 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 39a).

[0197] SEQ ID NO:169 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 40).

[0198] SEQ ID NO:170 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 40a).

[0199] SEQ ID NO:171 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 41).

[0200] SEQ ID NO:172 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 42).

[0201] SEQ ID NO:173 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 42a).

[0202] SEQ ID NO:174 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 43).

[0203] SEQ ID NO:175 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 44).

[0204] SEQ ID NO:176 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 44a).

[0205] SEQ ID NO:177 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 45).

[0206] SEQ ID NO:178 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 45a).

[0207] SEQ ID NO:179 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 46).

[0208] SEQ ID NO:180 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 47).

[0209] SEQ ID NO:181 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 47a).

[0210] SEQ ID NO:182 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 48).

[0211] SEQ ID NO:183 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 49).

[0212] SEQ ID NO:184 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 49a).

[0213] SEQ ID NO:185 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 50).

[0214] SEQ ID NO:186 is the nucleotide sequence of the vector AR-SDN2_REP_NoCut.

[0215] SEQ ID NO:187 is the nucleotide sequence of the vector AR-SDN2_REP_2Cuts.

[0216] SEQ ID NO:188 is the nucleotide sequence of the vector AR-SDN2_REP_1Cut.

[0217] SEQ ID NO:189 is an edited nucleotide sequence of the T1 progeny from vector 24269 (event number MZKE181002A135A, sample 13).

[0218] SEQ ID NO:190 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 1a).

[0219] SEQ ID NO:191 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 1b).

[0220] SEQ ID NO:192 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 2a).

[0221] SEQ ID NO:193 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 2b).

[0222] SEQ ID NO:194 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 3).

[0223] SEQ ID NO:195 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 4a).

[0224] SEQ ID NO:196 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 4b).

[0225] SEQ ID NO:197 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 5a).

[0226] SEQ ID NO:198 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 5b).

[0227] SEQ ID NO:199 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 6).

[0228] SEQ ID NO:200 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 7a).

[0229] SEQ ID NO:201 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 7b).

[0230] SEQ ID NO:202 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 8a).

[0231] SEQ ID NO:203 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 8b).

[0232] SEQ ID NO:204 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 9a).

[0233] SEQ ID NO:205 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 9b).

[0234] SEQ ID NO:206 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 10).

[0235] SEQ ID NO:207 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 11a).

[0236] SEQ ID NO:208 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 11b).

[0237] SEQ ID NO:209 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 12).

[0238] SEQ ID NO:210 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 13a).

[0239] SEQ ID NO:211 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 13b).

[0240] SEQ ID NO:212 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 14).

[0241] SEQ ID NO:213 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 15).

[0242] SEQ ID NO:214 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 16a).

[0243] SEQ ID NO:215 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 16b).

[0244] SEQ ID NO:216 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 17a).

[0245] SEQ ID NO:217 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 17b).

[0246] SEQ ID NO:218 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 18a).

[0247] SEQ ID NO:219 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 18b).

[0248] SEQ ID NO:220 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 19).

[0249] SEQ ID NO:221 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 20a).

[0250] SEQ ID NO:222 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 20b).

[0251] SEQ ID NO:223 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A050A, sample 21).

[0252] SEQ ID NO:224 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 1a).

[0253] SEQ ID NO:225 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 1b).

[0254] SEQ ID NO:226 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 2a).

[0255] SEQ ID NO:227 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 2b).

[0256] SEQ ID NO:228 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 3).

[0257] SEQ ID NO:229 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 4a).

[0258] SEQ ID NO:230 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 4b).

[0259] SEQ ID NO:231 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 5a).

[0260] SEQ ID NO:232 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 5b).

[0261] SEQ ID NO:233 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 6a).

[0262] SEQ ID NO:234 ​​is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 6b).

[0263] SEQ ID NO:235 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 7a).

[0264] SEQ ID NO:236 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 7b).

[0265] SEQ ID NO:237 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 8a).

[0266] SEQ ID NO:238 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A063A, sample 8b).

[0267] SEQ ID NO:239 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 1).

[0268] SEQ ID NO:240 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 2a).

[0269] SEQ ID NO:241 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 2b).

[0270] SEQ ID NO:242 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 3a).

[0271] SEQ ID NO:243 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 3b).

[0272] SEQ ID NO:244 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 4a).

[0273] SEQ ID NO:245 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 4b).

[0274] SEQ ID NO:246 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 5a).

[0275] SEQ ID NO:247 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 5b).

[0276] SEQ ID NO:248 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 6a).

[0277] SEQ ID NO:249 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 6b).

[0278] SEQ ID NO:250 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 7a).

[0279] SEQ ID NO:251 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 7b).

[0280] SEQ ID NO:252 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 8a).

[0281] SEQ ID NO:253 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 8b).

[0282] SEQ ID NO:254 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 9a).

[0283] SEQ ID NO:255 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 9b).

[0284] SEQ ID NO:256 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 10a).

[0285] SEQ ID NO:257 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 10b).

[0286] SEQ ID NO:258 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 11a).

[0287] SEQ ID NO:259 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A064A, sample 11b).

[0288] SEQ ID NO:260 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 1a).

[0289] SEQ ID NO:261 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 1b).

[0290] SEQ ID NO:262 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 2a).

[0291] SEQ ID NO:263 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 2b).

[0292] SEQ ID NO:264 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 3a).

[0293] SEQ ID NO:265 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 3b).

[0294] SEQ ID NO:266 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 4a).

[0295] SEQ ID NO:267 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 4b).

[0296] SEQ ID NO:268 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 5a).

[0297] SEQ ID NO:269 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 5b).

[0298] SEQ ID NO:270 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 6a).

[0299] SEQ ID NO:271 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 6b).

[0300] SEQ ID NO:272 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 7a).

[0301] SEQ ID NO:273 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 7b).

[0302] SEQ ID NO:274 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 8a).

[0303] SEQ ID NO:275 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 8b).

[0304] SEQ ID NO:276 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 9a).

[0305] SEQ ID NO:277 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 9b).

[0306] SEQ ID NO:278 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 10a).

[0307] SEQ ID NO:279 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 10b).

[0308] SEQ ID NO:280 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 11).

[0309] SEQ ID NO:281 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 12a).

[0310] SEQ ID NO:282 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 12b).

[0311] SEQ ID NO:283 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 13).

[0312] SEQ ID NO:284 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 14a).

[0313] SEQ ID NO:285 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 14b).

[0314] SEQ ID NO:286 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 15a).

[0315] SEQ ID NO:287 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 15b).

[0316] SEQ ID NO:288 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 16a).

[0317] SEQ ID NO:289 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 16b).

[0318] SEQ ID NO:290 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 17a).

[0319] SEQ ID NO:291 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 17b).

[0320] SEQ ID NO:292 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 18a).

[0321] SEQ ID NO:293 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 18b).

[0322] SEQ ID NO:294 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 19a).

[0323] SEQ ID NO:295 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 19b).

[0324] SEQ ID NO:296 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 20a).

[0325] SEQ ID NO:297 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 20b).

[0326] SEQ ID NO:298 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 21a).

[0327] SEQ ID NO:299 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 21b).

[0328] SEQ ID NO:300 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 22).

[0329] SEQ ID NO:301 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 23a).

[0330] SEQ ID NO:302 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 23b).

[0331] SEQ ID NO:303 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 24).

[0332] SEQ ID NO:304 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 25a).

[0333] SEQ ID NO:305 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 25b).

[0334] SEQ ID NO:306 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 26a).

[0335] SEQ ID NO:307 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 26b).

[0336] SEQ ID NO:308 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 27a).

[0337] SEQ ID NO:309 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 27b).

[0338] SEQ ID NO:310 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 28a).

[0339] SEQ ID NO:311 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 28b).

[0340] SEQ ID NO:312 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 29a).

[0341] SEQ ID NO:313 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A078A, sample 29b).

[0342] SEQ ID NO:314 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 1).

[0343] SEQ ID NO:315 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 2a).

[0344] SEQ ID NO:316 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 2b).

[0345] SEQ ID NO:317 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 3a).

[0346] SEQ ID NO:318 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 3b).

[0347] SEQ ID NO:319 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 4).

[0348] SEQ ID NO:320 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 5a).

[0349] SEQ ID NO:321 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 5b).

[0350] SEQ ID NO:322 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 6a).

[0351] SEQ ID NO:323 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 6b).

[0352] SEQ ID NO:324 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 7a).

[0353] SEQ ID NO:325 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 7b).

[0354] SEQ ID NO:326 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 8a).

[0355] SEQ ID NO:327 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 8b).

[0356] SEQ ID NO:328 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 9a).

[0357] SEQ ID NO:329 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 9b).

[0358] SEQ ID NO:330 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 10a).

[0359] SEQ ID NO:331 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 10b).

[0360] SEQ ID NO:332 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 11a).

[0361] SEQ ID NO:333 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 11b).

[0362] SEQ ID NO:334 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 12a).

[0363] SEQ ID NO:335 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 12b).

[0364] SEQ ID NO:336 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 13a).

[0365] SEQ ID NO:337 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 13b).

[0366] SEQ ID NO:338 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 14a).

[0367] SEQ ID NO:339 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 14b).

[0368] SEQ ID NO:340 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 15a).

[0369] SEQ ID NO:341 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 15b).

[0370] SEQ ID NO:342 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 16a).

[0371] SEQ ID NO:343 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 16b).

[0372] SEQ ID NO:344 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 17a).

[0373] SEQ ID NO:345 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 17b).

[0374] SEQ ID NO:346 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 18).

[0375] SEQ ID NO:347 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 19a).

[0376] SEQ ID NO:348 is an edited nucleotide sequence of the T1 progeny from vector 24301 (event number MZKE18100A084A, sample 19b).

[0377] SEQ ID NO:349 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 1a).

[0378] SEQ ID NO:350 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 1b).

[0379] SEQ ID NO:351 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 2a).

[0380] SEQ ID NO:352 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 2b).

[0381] SEQ ID NO:353 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 3a).

[0382] SEQ ID NO:354 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 3b).

[0383] SEQ ID NO:355 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 4a).

[0384] SEQ ID NO:356 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 4b).

[0385] SEQ ID NO:357 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 5a).

[0386] SEQ ID NO:358 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 5b).

[0387] SEQ ID NO:359 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 6a).

[0388] SEQ ID NO:360 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 6b).

[0389] SEQ ID NO:361 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 7a).

[0390] SEQ ID NO:362 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 7b).

[0391] SEQ ID NO:363 is an edited nucleotide sequence from the T1 progeny of vector 24320 (event number MZKE18200A019A, sample 8).

[0392] SEQ ID NO:364 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 9a).

[0393] SEQ ID NO:365 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 9b).

[0394] SEQ ID NO:366 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 10).

[0395] SEQ ID NO:367 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 11).

[0396] SEQ ID NO:368 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 12a).

[0397] SEQ ID NO:369 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 12b).

[0398] SEQ ID NO:370 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 13a).

[0399] SEQ ID NO:371 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 13b).

[0400] SEQ ID NO:372 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 14).

[0401] SEQ ID NO:373 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 15a).

[0402] SEQ ID NO:374 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 15b).

[0403] SEQ ID NO:375 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 16a).

[0404] SEQ ID NO:376 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 16b).

[0405] SEQ ID NO:377 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A019A, sample 17).

[0406] SEQ ID NO:378 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 1a).

[0407] SEQ ID NO:379 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 1b).

[0408] SEQ ID NO:380 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 2a).

[0409] SEQ ID NO:381 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 2b).

[0410] SEQ ID NO:382 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 3a).

[0411] SEQ ID NO:383 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 3b).

[0412] SEQ ID NO:384 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 4a).

[0413] SEQ ID NO:385 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 4b).

[0414] SEQ ID NO:386 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 5).

[0415] SEQ ID NO:387 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 6a).

[0416] SEQ ID NO:388 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 6b).

[0417] SEQ ID NO:389 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 7a).

[0418] SEQ ID NO:390 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 7b).

[0419] SEQ ID NO:391 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 8a).

[0420] SEQ ID NO:392 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 8b).

[0421] SEQ ID NO:393 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 9a).

[0422] SEQ ID NO:394 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 9b).

[0423] SEQ ID NO:395 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 10).

[0424] SEQ ID NO:396 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 11a).

[0425] SEQ ID NO:397 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 11b).

[0426] SEQ ID NO:398 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 12a).

[0427] SEQ ID NO:399 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 12b).

[0428] SEQ ID NO:400 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 13a).

[0429] SEQ ID NO:401 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 13b).

[0430] SEQ ID NO:402 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 14a).

[0431] SEQ ID NO:403 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 14b).

[0432] SEQ ID NO:404 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 15).

[0433] SEQ ID NO:405 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 16a).

[0434] SEQ ID NO:406 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 16b).

[0435] SEQ ID NO:407 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 17a).

[0436] SEQ ID NO:408 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 17b).

[0437] SEQ ID NO:409 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 18a).

[0438] SEQ ID NO:410 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 18b).

[0439] SEQ ID NO:411 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 19a).

[0440] SEQ ID NO:412 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 19b).

[0441] SEQ ID NO:413 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 20a).

[0442] SEQ ID NO:414 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 20b).

[0443] SEQ ID NO:415 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 21a).

[0444] SEQ ID NO:416 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 21b).

[0445] SEQ ID NO:417 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 22a).

[0446] SEQ ID NO:418 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 22b).

[0447] SEQ ID NO:419 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 23a).

[0448] SEQ ID NO:420 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 23b).

[0449] SEQ ID NO:421 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 24a).

[0450] SEQ ID NO:422 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A028A, sample 24b).

[0451] SEQ ID NO:423 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 1a).

[0452] SEQ ID NO:424 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 1b).

[0453] SEQ ID NO:425 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 2a).

[0454] SEQ ID NO:426 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 2b).

[0455] SEQ ID NO:427 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 3a).

[0456] SEQ ID NO:428 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 3b).

[0457] SEQ ID NO:429 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 4a).

[0458] SEQ ID NO:430 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 4b).

[0459] SEQ ID NO:431 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 5a).

[0460] SEQ ID NO:432 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 5b).

[0461] SEQ ID NO:433 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 6).

[0462] SEQ ID NO:434 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 7a).

[0463] SEQ ID NO:435 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 7b).

[0464] SEQ ID NO:436 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 8a).

[0465] SEQ ID NO:437 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 8b).

[0466] SEQ ID NO:438 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 9a).

[0467] SEQ ID NO:439 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 9b).

[0468] SEQ ID NO:440 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 10a).

[0469] SEQ ID NO:441 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 10b).

[0470] SEQ ID NO:442 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 11a).

[0471] SEQ ID NO:443 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 11b).

[0472] SEQ ID NO:444 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 12a).

[0473] SEQ ID NO:445 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 12b).

[0474] SEQ ID NO:446 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 13a).

[0475] SEQ ID NO:447 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 13b).

[0476] SEQ ID NO:448 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 14a).

[0477] SEQ ID NO:449 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 14b).

[0478] SEQ ID NO:450 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 15).

[0479] SEQ ID NO:451 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 16a).

[0480] SEQ ID NO:452 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 16b).

[0481] SEQ ID NO:453 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 17).

[0482] SEQ ID NO:454 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 18a).

[0483] SEQ ID NO:455 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 18b).

[0484] SEQ ID NO:456 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A045A, sample 19).

[0485] SEQ ID NO:457 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 1a).

[0486] SEQ ID NO:458 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 1b).

[0487] SEQ ID NO:459 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 2a).

[0488] SEQ ID NO:460 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 2b).

[0489] SEQ ID NO:461 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 3a).

[0490] SEQ ID NO:462 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 3b).

[0491] SEQ ID NO:463 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 4).

[0492] SEQ ID NO:464 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 4a).

[0493] SEQ ID NO:465 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 4b).

[0494] SEQ ID NO:466 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 5).

[0495] SEQ ID NO:467 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 6a).

[0496] SEQ ID NO:468 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 6b).

[0497] SEQ ID NO:469 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 7).

[0498] SEQ ID NO:470 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 8).

[0499] SEQ ID NO:471 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 9a).

[0500] SEQ ID NO:472 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 9b).

[0501] SEQ ID NO:473 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 10a).

[0502] SEQ ID NO:474 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 10b).

[0503] SEQ ID NO:475 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 11a).

[0504] SEQ ID NO:476 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 11b).

[0505] SEQ ID NO:477 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 12a).

[0506] SEQ ID NO:478 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A057A, sample 12b).

[0507] SEQ ID NO:479 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 1a).

[0508] SEQ ID NO:480 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 1b).

[0509] SEQ ID NO:481 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 2a).

[0510] SEQ ID NO:482 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 2b).

[0511] SEQ ID NO:483 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 3a).

[0512] SEQ ID NO:484 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 3b).

[0513] SEQ ID NO:485 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 4a).

[0514] SEQ ID NO:486 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 4b).

[0515] SEQ ID NO:487 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 5a).

[0516] SEQ ID NO:488 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 5b).

[0517] SEQ ID NO:489 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 6).

[0518] SEQ ID NO:490 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 7a).

[0519] SEQ ID NO:491 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 7b).

[0520] SEQ ID NO:492 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 8a).

[0521] SEQ ID NO:493 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 8b).

[0522] SEQ ID NO:494 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 9a).

[0523] SEQ ID NO:495 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 9b).

[0524] SEQ ID NO:496 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 10a).

[0525] SEQ ID NO:497 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 10b).

[0526] SEQ ID NO:498 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 11).

[0527] SEQ ID NO:499 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 12a).

[0528] SEQ ID NO:500 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 12b).

[0529] SEQ ID NO:501 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 13a).

[0530] SEQ ID NO:502 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 13b).

[0531] SEQ ID NO:503 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 14a).

[0532] SEQ ID NO:504 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 14b).

[0533] SEQ ID NO:505 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 15a).

[0534] SEQ ID NO:506 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 15b).

[0535] SEQ ID NO:507 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 16a).

[0536] SEQ ID NO:508 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 16b).

[0537] SEQ ID NO:509 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 17a).

[0538] SEQ ID NO:510 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 17b).

[0539] SEQ ID NO:511 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 18a).

[0540] SEQ ID NO:512 is an edited nucleotide sequence of the T1 progeny from vector 24320 (event number MZKE18200A064A, sample 18b).

[0541] SEQ ID NO:513 is the nucleotide sequence of vector 24857.

[0542] SEQ ID NO:514 is the nucleotide sequence of prGmMADS28-01 (FMOS promoter) in soybean.

[0543] SEQ ID NO:515 is the nucleotide sequence of tGmMADS28-01 (FMOS terminator) in soybean.

[0544] SEQ ID NO:516 is the nucleotide sequence of vector 24905 (control) containing a soybean constitutive promoter.

[0545] SEQ ID NO:517 is the nucleotide sequence of vector 24925.

[0546] SEQ ID NO:518 is the nucleotide sequence of prGmMMD1-01 (FMOS promoter) in soybean.

[0547] SEQ ID NO:519 is the nucleotide sequence of tGmMMD1-01 (FMOS terminator) in soybean.

[0548] SEQ ID NO:520 is the nucleotide sequence of gRNA1 targeting the first exon of soybean GmCenH3 in vectors 24857 and 24905.

[0549] SEQ ID NO:521 is the nucleotide sequence of gRNA2 targeting exon 4 of soybean GmCenH3 in vectors 24857 and 24905.

[0550] SEQ ID NO:522 is the nucleotide sequence of the positive primer in CP4 assay.

[0551] SEQ ID NO:523 is the nucleotide sequence of the antisense primer in the CP4 assay.

[0552] SEQ ID NO:524 is the nucleotide sequence of the probe used in the CP4 assay.

[0553] SEQ ID NO:525 is the nucleotide sequence of the positive primer in the Cas assay.

[0554] SEQ ID NO:526 is the nucleotide sequence of the antisense primer in the Cas assay.

[0555] SEQ ID NO:527 is the nucleotide sequence of the probe used in the Cas assay.

[0556] SEQ ID NO:528 is the nucleotide sequence of the forward primer in the Cas assay.

[0557] SEQ ID NO:529 is the nucleotide sequence of the reverse primer used in the Cas assay.

[0558] SEQ ID NO:530 is the nucleotide sequence of the probe used in the Cas assay.

[0559] SEQ ID NO:531 is the nucleotide sequence of intron iUbi1-07 of the ubiquitin promoter prUbi1-18.

[0560] SEQ ID NO:532 is the nucleotide sequence of Cas12a.

[0561] SEQ ID NO:533 is the nucleotide sequence of vector 25053.

[0562] SEQ ID NO:534 is the nucleotide sequence of vector 25074.

[0563] SEQ ID NO:535 is the nucleotide sequence of vector 25068.

[0564] SEQ ID NO:536 is the nucleotide sequence of vector 25069.

[0565] SEQ ID NO:537 is the nucleotide sequence of vector 24997.

[0566] SEQ ID NO:538 is the nucleotide sequence of vector 25002.

[0567] SEQ ID NO:539 is the nucleotide sequence of vector 25003.

[0568] SEQ ID NO:540 is the nucleotide sequence of vector 25004.

[0569] SEQ ID NO:541 is the nucleotide sequence of vector 25005.

[0570] SEQ ID NO:542 is the nucleotide sequence of vector 25006.

[0571] SEQ ID NO:543 is the nucleotide sequence of vector 25007.

[0572] SEQ ID NO:544 is the nucleotide sequence of vector 25008.

[0573] SEQ ID NO:545 is the nucleotide sequence of vector 25009.

[0574] SEQ ID NO:546 is the nucleotide sequence of the primer used for Adh1 editing analysis.

[0575] SEQ ID NO:547 is the nucleotide sequence of the primer used for Adh1 editing analysis.

[0576] SEQ ID NO:548 is the nucleotide sequence used as a reference for the Adh1 target.

[0577] SEQ ID NO:549 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 1).

[0578] SEQ ID NO:550 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 1).

[0579] SEQ ID NO:551 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 2).

[0580] SEQ ID NO:552 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 2).

[0581] SEQ ID NO:553 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 3).

[0582] SEQ ID NO:554 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 3).

[0583] SEQ ID NO:555 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 4).

[0584] SEQ ID NO:556 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 4).

[0585] SEQ ID NO:557 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 5).

[0586] SEQ ID NO:558 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 6).

[0587] SEQ ID NO:559 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 6).

[0588] SEQ ID NO:560 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 7).

[0589] SEQ ID NO:561 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 7).

[0590] SEQ ID NO:562 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 8).

[0591] SEQ ID NO:563 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 8).

[0592] SEQ ID NO:564 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 9).

[0593] SEQ ID NO:565 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 9).

[0594] SEQ ID NO:566 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 10).

[0595] SEQ ID NO:567 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 10).

[0596] SEQ ID NO:568 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 11).

[0597] SEQ ID NO:569 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 11).

[0598] SEQ ID NO:570 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 12).

[0599] SEQ ID NO:571 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 12).

[0600] SEQ ID NO:572 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 13).

[0601] SEQ ID NO:573 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 13).

[0602] SEQ ID NO:574 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 13).

[0603] SEQ ID NO:575 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 14).

[0604] SEQ ID NO:576 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 14).

[0605] SEQ ID NO:577 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 15).

[0606] SEQ ID NO:578 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 16).

[0607] SEQ ID NO:579 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 16).

[0608] SEQ ID NO:580 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 17).

[0609] SEQ ID NO:581 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 17).

[0610] SEQ ID NO:582 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 18).

[0611] SEQ ID NO:583 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 19).

[0612] SEQ ID NO:584 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 20).

[0613] SEQ ID NO:585 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 20).

[0614] SEQ ID NO:586 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 21).

[0615] SEQ ID NO:587 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 22).

[0616] SEQ ID NO:588 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 22).

[0617] SEQ ID NO:589 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 23).

[0618] SEQ ID NO:590 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 23).

[0619] SEQ ID NO:591 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 24).

[0620] SEQ ID NO:592 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 24).

[0621] SEQ ID NO:593 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 25).

[0622] SEQ ID NO:594 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 26).

[0623] SEQ ID NO:595 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 27).

[0624] SEQ ID NO:596 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 27).

[0625] SEQ ID NO:597 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 28).

[0626] SEQ ID NO:598 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 28).

[0627] SEQ ID NO:599 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 29).

[0628] SEQ ID NO:600 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 30).

[0629] SEQ ID NO:601 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 30).

[0630] SEQ ID NO:602 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 31).

[0631] SEQ ID NO:603 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 31).

[0632] SEQ ID NO:604 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 32).

[0633] SEQ ID NO:605 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 32).

[0634] SEQ ID NO:606 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 33).

[0635] SEQ ID NO:607 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 33).

[0636] SEQ ID NO:608 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 34).

[0637] SEQ ID NO:609 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 34).

[0638] SEQ ID NO:610 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 35).

[0639] SEQ ID NO:611 is an edited nucleotide sequence from the T1 progeny of vector 25002 (event number GVG01189803, plant 36).

[0640] SEQ ID NO:612 is the nucleotide sequence of the vector Cr-X-FMOS containing modified Cas.

[0641] SEQ ID NO:613 is the nucleotide sequence of the vector Ev-FMOS containing modified Cas.

[0642] SEQ ID NO:614 is a nucleotide sequence encoding the modified form of prZmAP1 used in 24997.

[0643] SEQ ID NO:615 is a nucleotide sequence encoding the modified form of prZmBde1 used in 25002.

[0644] SEQ ID NO:616 is a nucleotide sequence encoding the modified form of prZmBde1 used in 25003.

[0645] SEQ ID NO:617 is a nucleotide sequence encoding the modified form of prZmBde1 used in 25004.

[0646] SEQ ID NO:618 is a nucleotide sequence encoding the modified form of prZmBde1 used in 25005.

[0647] SEQ ID NO:619 is a nucleotide sequence encoding the modified form of prZmBde1 used in 25006.

[0648] SEQ ID NO:620 is a nucleotide sequence encoding the modified form of prOsAP1 used in 25007.

[0649] SEQ ID NO:621 is a nucleotide sequence encoding the modified form of prOsAP1 used in 25008.

[0650] SEQ ID NO:622 is a nucleotide sequence encoding the modified form of prOsAP1 used in 25009.

[0651] SEQ ID NO:623 is a nucleotide sequence encoding the modified form of the intron in prZmAP1-03.

[0652] SEQ ID NO:624 is a nucleotide sequence encoding the modified form of the introns in prZmBde1-03 and prZmBde1-07.

[0653] SEQ ID NO:625 is a nucleotide sequence encoding the modified form of the intron in prZmBde1-04.

[0654] SEQ ID NO:626 is a nucleotide sequence encoding the modified form of the intron in prZmBde1-05.

[0655] SEQ ID NO:627 is a nucleotide sequence encoding the modified form of the introns in prOsAP1-02 and prOsAP1-04.

[0656] SEQ ID NO:628 is the nucleotide sequence of the forward primer used for CENH3 editing analysis.

[0657] SEQ ID NO:629 is the nucleotide sequence of the reverse primer used for CENH3 editing analysis.

[0658] SEQ ID NO:630 is the nucleotide sequence of the forward primer used for CENH3 editing analysis.

[0659] SEQ ID NO:631 is the wild-type nucleotide sequence of the gRNA2 target of construct 24905.

[0660] SEQ ID NO:632 is the edited nucleotide sequence of the gRNA2 target of construct 24905.

[0661] SEQ ID NO:633 is the nucleotide target sequence of chalcone synthase (WHP1) target 1.

[0662] SEQ ID NO:634 is the nucleotide target sequence of chalcone synthase (C2) target 1.

[0663] SEQ ID NO:635 is the nucleotide target sequence of chalcone synthase (WHP1) target 2.

[0664] SEQ ID NO:636 is the nucleotide target sequence of chalcone synthase (C2) target 2.

[0665] SEQ ID NO:637 is the nucleotide sequence of primer 1 for WHP1 target 1.

[0666] SEQ ID NO:638 is the nucleotide sequence of primer 2 for WHP1 target 1.

[0667] SEQ ID NO:639 is the nucleotide sequence of the probe for WHP1 target 1.

[0668] SEQ ID NO:640 is the nucleotide sequence of primer 1 for C2 target 1.

[0669] SEQ ID NO:641 is the nucleotide sequence of primer 2 for target 1 C2.

[0670] SEQ ID NO:642 is the nucleotide sequence of the probe for C2 target 1.

[0671] SEQ ID NO:643 is the nucleotide sequence of primer 1 for WHP1 target 2.

[0672] SEQ ID NO:644 is the nucleotide sequence of primer 2 for WHP1 target 2.

[0673] SEQ ID NO:645 is the nucleotide sequence of the probe for WHP1 target 2.

[0674] SEQ ID NO:646 is the nucleotide sequence of primer 1 for C2 target 2.

[0675] SEQ ID NO:647 is the nucleotide sequence of primer 2 for target C2.

[0676] SEQ ID NO:648 is the nucleotide sequence of the probe for C2 target 2.

[0677] SEQ ID NO:649 is the nucleotide sequence of the forward primer used for PMI determination.

[0678] SEQ ID NO:650 is the nucleotide sequence of the reverse primer used for PMI determination.

[0679] SEQ ID NO:651 is the nucleotide sequence of the probe used for PMI determination.

[0680] SEQ ID NO:652 is the nucleotide sequence of the forward primer used for determining the control gene ZmEF1.

[0681] SEQ ID NO:653 is the nucleotide sequence of the reverse primer used for determining the control gene ZmEF1.

[0682] SEQ ID NO:654 is the nucleotide sequence of the probe used for the determination of the control gene ZmEF1.

[0683] SEQ ID NO:655 is the WT nucleotide sequence of the gRNA2 target in construct 24905.

[0684] SEQ ID NO:656 is an edited nucleotide sequence from a T0 plant transformed with construct 24905.

[0685] SEQ ID NO:657 is the nucleotide sequence of vector 24925.

[0686] SEQ ID NO:658 is a missing nucleotide sequence in soybeans.

[0687] SEQ ID NO:659 is a missing nucleotide sequence in soybeans.

[0688] SEQ ID NO:660 is a missing nucleotide sequence in soybeans.

[0689] SEQ ID NO:661 is a missing nucleotide sequence in soybeans.

[0690] SEQ ID NO:662 is the WT nucleotide sequence of soybean.

[0691] SEQ ID NO:663 is an edited nucleotide sequence from soybean.

[0692] SEQ ID NO:664 is an edited nucleotide sequence from soybean.

[0693] SEQ ID NO:665 is an edited nucleotide sequence from soybean.

[0694] SEQ ID NO:666 is an edited nucleotide sequence from soybeans.

[0695] SEQ ID NO:667 is the WT nucleotide sequence of soybean.

[0696] SEQ ID NO:668 is an edited nucleotide sequence from soybeans.

[0697] SEQ ID NO:669 is an edited nucleotide sequence from soybeans.

[0698] SEQ ID NO:670 is an edited nucleotide sequence from soybean.

[0699] SEQ ID NO:671 is an edited nucleotide sequence from soybean.

[0700] SEQ ID NO:672 is the WT nucleotide sequence of soybean.

[0701] SEQ ID NO:673 is an edited nucleotide sequence from soybean.

[0702] SEQ ID NO:674 is an edited nucleotide sequence from soybean.

[0703] SEQ ID NO:675 is an edited nucleotide sequence from soybean.

[0704] SEQ ID NO:676 is an edited nucleotide sequence from soybean.

[0705] SEQ ID NO:677 is an edited nucleotide sequence from soybean.

[0706] SEQ ID NO:678 is an edited nucleotide sequence from soybean.

[0707] SEQ ID NO:679 is an edited nucleotide sequence from soybean.

[0708] SEQ ID NO:680 is an edited nucleotide sequence from soybean.

[0709] SEQ ID NO:681 is an edited nucleotide sequence from soybean.

[0710] SEQ ID NO:682 is an edited nucleotide sequence from soybean.

[0711] SEQ ID NO:683 is the WT nucleotide sequence of soybean.

[0712] SEQ ID NO:684 is an edited nucleotide sequence from soybean.

[0713] SEQ ID NO:685 is an edited nucleotide sequence from soybean.

[0714] SEQ ID NO:686 is an edited nucleotide sequence from soybean.

[0715] SEQ ID NO:687 is an edited nucleotide sequence from soybean.

[0716] SEQ ID NO:688 is an edited nucleotide sequence from soybeans.

[0717] SEQ ID NO:689 is an edited nucleotide sequence from soybeans.

[0718] SEQ ID NO:690 is an edited nucleotide sequence from soybean.

[0719] SEQ ID NO:691 is an edited nucleotide sequence from soybean.

[0720] SEQ ID NO:692 is an edited nucleotide sequence from soybean.

[0721] SEQ ID NO:693 is an edited nucleotide sequence from soybean.

[0722] SEQ ID NO:694 is an edited nucleotide sequence from soybean.

[0723] SEQ ID NO:695 is an edited nucleotide sequence from soybean.

[0724] SEQ ID NO:696 is an edited nucleotide sequence from soybean.

[0725] SEQ ID NO:697 is the nucleotide sequence of the vector AR-SDN2_RETRON.

[0726] SEQ ID NO:698 is the nucleotide sequence encoding the promoter prAtAPETALA1-01.

[0727] SEQ ID NO:699 is the nucleotide sequence encoding the terminator tAtAPETALA1-01.

[0728] SEQ ID NO:700 is the nucleotide sequence encoding the promoter prAtSEPELLATA2-01.

[0729] SEQ ID NO:701 is the nucleotide sequence encoding the terminator tAtSEPELLATA2-01.

[0730] SEQ ID NO:702 is the nucleotide sequence encoding the promoter prMMD1-01.

[0731] SEQ ID NO:703 is the nucleotide sequence encoding the terminator tMMD1-01.

[0732] SEQ ID NO:704 is the nucleotide sequence encoding the promoter prSlLOXA-01 (tomato).

[0733] SEQ ID NO:705 is the nucleotide sequence encoding the terminator prSlLOXA-01 (tomato).

[0734] SEQ ID NO:706 is the nucleotide sequence encoding the promoter prSlTM5-01.

[0735] SEQ ID NO:707 is the nucleotide sequence encoding the terminator tSlTM5-01.

[0736] SEQ ID NO:708 is the nucleotide sequence encoding the promoter prSlTM29-01.

[0737] SEQ ID NO:709 is the nucleotide sequence encoding the terminator tSlTM29-01.

[0738] SEQ ID NO:710 is the nucleotide sequence encoding the promoter prGmMMD1-02 (enhanced).

[0739] SEQ ID NO:711 is the nucleotide sequence encoding the first enhancer of prGmMMD1-02.

[0740] SEQ ID NO:712 is the nucleotide sequence encoding the second enhancer of prGmMMD1-02.

[0741] SEQ ID NO:713 is the nucleotide sequence encoding the third enhancer of prGmMMD1-02.

[0742] SEQ ID NO:714 is the nucleotide sequence encoding gRNA.

[0743] SEQ ID NO:715 is the nucleotide sequence encoding gRNA.

[0744] SEQ ID NO:716 is the nucleotide sequence encoding a gRNA that targets the tomato ADH1 gene.

[0745] SEQ ID NO:717 is the nucleotide sequence encoding prZmMSCA1-01.

[0746] SEQ ID NO:718 is the nucleotide sequence encoding tZmMSCA1-01.

[0747] SEQ ID NO:719 is the nucleotide sequence encoding prZmPPG4-01.

[0748] SEQ ID NO:720 is the nucleotide sequence encoding tZmPPG4-01.

[0749] SEQ ID NO:721 is a nucleotide sequence encoding a promoter for NADH dehydrogenase.

[0750] SEQ ID NO:722 is a nucleotide sequence encoding a terminator for NADH dehydrogenase.

[0751] SEQ ID NO:723 is the nucleotide sequence encoding prZmCID11.

[0752] SEQ ID NO:724 is the nucleotide sequence encoding tZmCID11. Attached Figure Description

[0753] Figure 1 This is a schematic diagram of vector 24301 (SEQ ID NO:1), which is used to transform immature corn embryos.

[0754] Figure 2 This is an exemplary diagram of a carrier used to transform immature corn embryos.

[0755] Figure 3 This is a schematic diagram of vector 24224 (SEQ ID NO:10), which is used to transform immature corn embryos.

[0756] Figure 4 This is a schematic diagram of vector 24243 (SEQ ID NO:40), which is used to transform immature corn embryos.

[0757] Figure 5 This is a schematic diagram of vector 24265 (SEQ ID NO:19), which is used to transform immature corn embryos.

[0758] Figure 6 This is a schematic diagram of vector 24266 (SEQ ID NO:22), which is used to transform immature corn embryos.

[0759] Figure 7 This is a schematic diagram of vector 24269 (SEQ ID NO:25), which is used to transform immature corn embryos.

[0760] Figure 8 This is a schematic diagram of vector 24270 (SEQ ID NO:28), which is used to transform immature corn embryos.

[0761] Figure 9 This is a schematic diagram of vector 24289 (SEQ ID NO:31), which is used to transform immature corn embryos.

[0762] Figure 10 This is a schematic diagram of vector 24299 (SEQ ID NO:34), which is used to transform immature corn embryos.

[0763] Figure 11 This is a schematic diagram of vector 24300 (SEQ ID NO:85), which is used to transform immature corn embryos.

[0764] Figure 12 This is a schematic diagram of vector 24305 (SEQ ID NO:43), which is used to transform immature corn embryos.

[0765] Figure 13 This is a schematic diagram of vector 24306 (SEQ ID NO:46), which is used to transform immature corn embryos.

[0766] Figure 14 This is a schematic diagram of vector 24320 (SEQ ID NO:49), which is used to transform immature corn embryos.

[0767] Figure 15 This is a schematic diagram of vector 24426 (SEQ ID NO:52), which is used to transform immature corn embryos.

[0768] Figure 16 This is a schematic diagram of vector 24427 (SEQ ID NO:55), which is used to transform immature corn embryos.

[0769] Figure 17 This is a schematic diagram of vector 24428 (SEQ ID NO:58), which is used to transform immature corn embryos.

[0770] Figure 18 This is a schematic diagram of vector 24454 (SEQ ID NO:61), which is used to transform immature corn embryos.

[0771] Figure 19 This is a schematic diagram of vector 24455 (SEQ ID NO:64), which is used to transform immature corn embryos.

[0772] Figure 20 This is a schematic diagram of vector 24458 (SEQ ID NO:67), which is used to transform immature corn embryos.

[0773] Figure 21 This is a schematic diagram of vector 24459 (SEQ ID NO:70), which is used to transform immature corn embryos.

[0774] Figure 22 This is a schematic diagram of vector 24460 (SEQ ID NO:73), which is used to transform immature corn embryos.

[0775] Figure 23 This is a schematic diagram of vector 24548 (SEQ ID NO:76), which is used to transform immature corn embryos.

[0776] Figure 24 This is a schematic diagram of vector 24602 (SEQ ID NO:79), which is used to transform immature corn embryos.

[0777] Figure 25 This is a schematic diagram of vector 24688 (SEQ ID NO:82), which is used to transform immature corn embryos.

[0778] Figure 26a The plan for sampling male ears of grain was presented.

[0779] Figure 26b This is a graph showing the mosaicism scores of the five types of constructs.

[0780] Figure 26c This is a graph comparing the mosaicism score of the shortened promoter construct with the mosaicism scores of other constructs.

[0781] Figure 26d This is a graph showing the mosaicism scores of various constructs.

[0782] Figure 27 At least one expression cassette is shown, which has a gRNA target site located on the flanking side of the donor DNA.

[0783] Figure 28 At least one expression cassette is shown, which has two gRNA target sites located on the flanking side of the donor DNA.

[0784] Figure 29 At least one expression cassette is shown that does not have a gRNA target site located on the flanking side of the donor DNA.

[0785] Figure 30 Another embodiment of at least one expression box is shown.

[0786] Figure 31 This is a schematic diagram of the vector AR-SDN2_REP_1Cut (SEQ ID NO:188), which is used to transform immature corn embryos.

[0787] Figure 32 This is a schematic diagram of the vector AR-SDN2_REP_2Cuts (SEQ ID NO:187), which is used to transform immature corn embryos.

[0788] Figure 33 This is a schematic diagram of the vector AR-SDN2_REP_NoCut (SEQ ID NO:186), which is used to transform immature corn embryos.

[0789] Figure 34 This is a schematic diagram showing the modifications made to prZmBde1.

[0790] Figure 35 This is a schematic diagram of carrier 24857 (SEQ ID NO:513) used for converting soybeans.

[0791] Figure 36 This is a schematic diagram of carrier 24905 (SEQ ID NO:514) used for converting soybeans.

[0792] Figure 37 This is a photo of a T1 plant.

[0793] Figure 38 and 39 Examples of shortened promoters for use in various builds are shown.

[0794] Figure 40 The sequence alignment is shown, revealing several unique edits in the T1 seed.

[0795] Figure 41 This is a graph showing the expression level of PMI under the control of a constitutive promoter.

[0796] Figure 42 This is a graph showing the expression level of Cas9 under the control of the FMOS promoter.

[0797] Figure 43 This is a schematic diagram of carrier 24925 used to transform immature corn embryos.

[0798] Figure 44 This is a schematic diagram of the vector AR-SDN2_RETRON (SEQ ID NO:697), which is used to transform immature corn embryos.

[0799] definition

[0800] While it is believed that the following terms will be well understood by those skilled in the art, the following definitions are set forth in order to explain the subject matter disclosed in this application.

[0801] Unless otherwise defined below, all technical and scientific terms used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art. References to the techniques used herein are intended to refer to techniques commonly understood in the art, including variations and / or equivalent substitutions of those techniques that are readily apparent to one of ordinary skill in the art. While it is believed that the following terms will be well understood by one of ordinary skill in the art, the following definitions are set forth to facilitate the interpretation of the subject matter disclosed in this application.

[0802] Under the long-standing Patent Law Convention, the terms “a,” “an,” and “the” used in this application (including the claims) mean “one or more of a kind.” For example, the phrase “a cell” refers to one or more cells, and in some embodiments may refer to tissues and / or organs. Similarly, the phrase “at least one” when used herein to refer to an entity means, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, or more of that entity, including but not limited to all integer values ​​between 1 and 100 and integers greater than 100.

[0803] Unless otherwise specified, all figures representing amounts of components, reaction conditions, etc., used in this specification and claims should be understood to be modified in all cases by the term "about". As used herein, the term "about", when referring to a measurable value such as mass, weight, time, volume, concentration, or percentage, means to cover variations of ±20% from a specified amount in some embodiments, ±10% in some embodiments, ±5% in some embodiments, ±1% in some embodiments, ±0.5% in some embodiments, and ±0.1% in some embodiments, because such variations are suitable for carrying out the disclosed methods and / or using the disclosed compositions, nucleic acids, peptides, etc. Therefore, unless indicated to the contrary, the numerical parameters stated in this specification and appended claims are approximate values ​​that may vary depending on the desired characteristics sought to be obtained through the subject matter disclosed in this application.

[0804] As used herein, the term "allelic gene" refers to a variant or alternative sequence form at a genetic locus. In diploid organisms, a single allele at each locus is inherited by offspring individuals from each parent, respectively. While those skilled in the art will understand that an allele in any particular individual does not necessarily represent all alleles present in that species, the two alleles at a given locus in a diploid organism occupy corresponding positions on a pair of homologous chromosomes.

[0805] As used herein, the term “and / or” when used in the context of enumerated entities refers to entities existing individually or in combination. Thus, for example, the phrase “A, B, C and / or D” includes A, B, C, and D individually, but also any and all combinations and sub-combinations of A, B, C, and D (e.g., AB, AC, AD, BC, BD, CD, ABC, ABD, and BCD). In some embodiments, one or more elements referred to by “and / or” may also exist individually in one or more occurrences in one or more combinations and / or one or more sub-combinations.

[0806] As used herein, the phrase “associated with” refers to an identifiable and / or measurable relationship between two entities. For example, the phrase “associated with HI” refers to a trait, locus, gene, allele, marker, phenotype, or its expression, the presence or absence of which can affect the extent and / or degree to which a plant or its offspring exhibit HI or haploid induction. Thus, a marker is “associated” with a trait when it is linked to it and when the presence of the marker indicates whether and / or to what extent the desired trait or trait form will occur in the plant / germplasm containing the marker. Similarly, a marker is “associated” with an allele when it is linked to it and when the presence of the marker indicates the presence of the allele in the plant / germplasm containing the marker. For example, “HI-associated marker” refers to a marker whose presence or absence can be used to predict whether and / or to what extent a plant will exhibit haploid induction.

[0807] The term “comprising” is synonymous with “including,” “containing,” and “characterized by,” and is inclusive or open-ended, and does not exclude additional unlisted elements and / or method steps. “Comprising” means that the specified elements and / or steps are present, but other elements and / or steps may be added and still fall within the scope of the relevant subject matter.

[0808] As used herein, the phrase “composed of” excludes any element, step, or component not specifically listed. When the phrase “composed of” appears in a clause of the body of a claim, rather than directly following the preamble, it limits only the element set forth in that clause; other elements are not excluded from the claim as a whole.

[0809] As used herein, the phrase “consistently of…” limits the scope of the relevant disclosure or claim to the specified materials and / or steps, plus those that do not substantially affect one or more essential and novel features of the disclosed and / or claimed subject matter.

[0810] Regarding the terms “comprising,” “substantially consisting of,” and “consisting of,” when one of these three terms is used herein, the subject matter disclosed and claimed in this application may include the use of any of the other two terms in some embodiments. For example, if the subject matter in some embodiments relates to a nucleic acid encoding a polypeptide comprising at least 95% of the same amino acid sequence as SEQ ID NO:, it should be understood that the disclosed subject matter therefore also covers nucleic acids encoding a polypeptide in some embodiments consisting substantially of the same amino acid sequence as SEQ ID NO:, and nucleic acids encoding a polypeptide in some embodiments consisting of at least 95% the same amino acid sequence as SEQ ID NO:. Similarly, it should also be understood that in some embodiments, a method for the disclosed subject matter includes the steps disclosed herein, in some embodiments, a method for the subject matter disclosed herein consists substantially of the disclosed steps, and in some embodiments, a method for the subject matter disclosed herein consists of the steps disclosed herein.

[0811] As used herein, the term "event" refers to the creation of a genetically engineered organism or cell having non-natural DNA that is not normally found in nature, such as a genetically engineered plant or seed. An event can include a transgene event involving the insertion of a transgene into the DNA of an organism. An event can also include the insertion of a specific transgene into a specific location on a chromosome. An event can also include any combination of insertions or deletions and point mutations.

[0812] As used herein, the term "gene" refers to a genetic unit consisting of a DNA sequence that occupies a specific location on a chromosome and contains the genetic instructions for a specific characteristic or trait in an organism.

[0813] A "genetic map" is a description of the genetic linkages between loci on one or more chromosomes within a given species, usually depicted in the form of a diagram or table.

[0814] As used herein, a “gene regulatory network” (or “GRN”) is a collection of molecular regulators that interact with each other and other substances in the cell to control the expression levels of genes, including mRNA and proteins. These regulators can be DNA, RNA, proteins, and complexes thereof. GRNs may also include “gene families” as used herein. A “gene family” refers to a group of similar genes that typically have similar biochemical functions.

[0815] As used herein, a plant called a “haploid” has a reduced number of chromosomes (n) and its chromosome set is equal to that of the gametes. In haploid organisms, only half the normal number of chromosomes exists. Therefore, haploids of diploid organisms (e.g., corn) exhibit haploidity; haploids of tetraploid organisms (e.g., ryegrass) exhibit diploidity; haploids of hexaploid organisms (e.g., wheat) exhibit triploidity; and so on. As used herein, a plant called a “double haploid” is developed by doubling the haploid set of chromosomes. Plants or seeds obtained from double haploid plants through self-pollination to any number of generations can still be identified as double haploid plants. Double haploid plants are considered homozygous. A plant is considered double haploid if it is fertile, even if its entire vegetative part is not composed of cells with doubled chromosome sets; that is, if a plant contains viable gametes, it will be considered double haploid even if it is chimeric in its vegetative tissue.

[0816] As used herein, the term "human-induced mutation" refers to any mutation resulting from direct or indirect human action. This term includes, but is not limited to, mutations obtained through any targeted mutagenesis method.

[0817] As used herein, “introduced” means delivery, expression, administration, transport, transfer, infiltration, or other similar terms to indicate the delivery of nucleic acid or protein or a combination thereof of a desired object to an object. For example, nucleic acid encoding a site-directed nuclease and optionally at least one guide RNA may be introduced into a plant cell.

[0818] As used herein, the terms "marker probe" and "probe" refer to a nucleotide sequence or nucleic acid molecule that can be used to detect the presence or absence of a sequence within a larger sequence (e.g., a nucleic acid probe that is wholly or partially complementary to a marker or marker locus via nucleic acid hybridization). Marker probes containing approximately 8, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more consecutive nucleotides can be used for nucleic acid hybridization.

[0819] As used herein, when identifying the presence / absence of HI-related loci, the term "molecular marker" can be used to refer to a genetic marker as defined above, or its coding product (e.g., a protein) used as a reference point. Molecular markers can be derived from genomic nucleotide sequences or expressed nucleotide sequences (e.g., derived from RNA, cDNA, etc.). The term also refers to nucleotide sequences complementary to or flanking the marker sequence, such as nucleotide sequences used as probes and / or primers capable of amplifying the marker sequence. These nucleotide sequences are "complementary" (e.g., according to the Watson-Crick base pairing principle) when they specifically hybridize in solution. The term also refers to genetic markers that indicate traits by the absence of nucleotide sequences complementary to or flanking the marker sequence (e.g., nucleotide sequences used as probes and / or primers capable of amplifying the marker sequence).

[0820] As used herein, the terms “nucleotide sequence,” “polynucleotide,” “nucleic acid sequence,” “nucleic acid molecule,” and “nucleic acid fragment” refer to a polymer of single-stranded or double-stranded RNA or DNA, optionally containing synthetic, non-natural, and / or modified nucleotide bases. A “nucleotide” is a monomeric unit from which a DNA or RNA polymer is constructed and consists of a purine or pyrimidine base, a pentose sugar, and a phosphate group. Nucleotides (usually found in their 5'-monophosphate form) are designated by their single-letter names as follows: “A” for adenosine or deoxyadenosine (for RNA or DNA, respectively), “C” for cytidine or deoxycytidine, “G” for guanylic acid or deoxyguanylic acid, “U” for uridine, “T” for deoxythymidine, “R” for purine (A or G), “Y” for pyrimidine (C or T), “K” for G or T, “H” for A, C, or T, “I” for inosine, and “N” for any nucleotide.

[0821] As used herein, the term "nucleotide sequence identity" refers to the presence of identical nucleotides at corresponding positions in two polynucleotides. When performing alignments to obtain the maximum correspondence (e.g., within a comparison window), polynucleotides are considered to have an "identical" sequence if the nucleotide sequences in two polynucleotides are identical. Sequence comparisons between two or more polynucleotides are typically performed by comparing portions of the two sequences within a comparison window to identify and compare local regions of sequence similarity. Comparison windows are typically from about 20 to 200 consecutive nucleotides. The "sequence identity percentage" of a polynucleotide, such as about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity, can be determined within a comparison window by comparing two optimally aligned sequences, where, for optimal alignment of the two sequences, the portion of the polynucleotide sequence within the comparison window compared to a reference sequence may include additions or deletions (i.e., vacancies). In some embodiments, the percentage is calculated by: (a) determining the number of positions where the same nucleic acid base appears in both sequences; (b) dividing the number of matching positions by the total number of positions in the comparison window; and (c) multiplying the result by 100. Optimal alignment of sequences for comparison can also be performed by a computerized implementation of known algorithms or by visual inspection. Easily available sequence comparison and multiple sequence alignment algorithms include the Basic Local Alignment Search Tool (BLAST) and the ClustalW / ClustalW2 / Clustal Omega programs, which are available on the Internet (e.g., the EMBL-EBI website). Other suitable programs include, but are not limited to, GAP, BestFit, Plot Similarity, and FASTA, which are part of the Accelrys GCG software package available from Accelrys Corporation (San Diego, California, USA). See also Smith and Waterman, 1981; Needleman and Wunsch, 1970; Pearson and Lipman, 1988; Ausubel et al., 1988; and Sambrook and Russell, 2001.

[0822] One example of an algorithm suitable for determining percentage sequence identity and sequence similarity is the BLAST algorithm, described in Altschul et al., 1990. In some embodiments, the percentage of sequence identity refers to the sequence identity over the full length of one of the gDNA, cDNA, or predicted protein sequences in the largest ORF of SEQ ID No:1 being compared. In some embodiments, the calculation of determining the percentage of nucleic acid sequence identity does not include any nucleotide positions in the compared nucleic acids that include "N" (i.e., where any nucleotide can be present at that position).

[0823] The term "open reading frame" (ORF) refers to a nucleic acid sequence encoding a polypeptide. In some embodiments, the ORF comprises a translation start codon (i.e., start codon), a translation termination codon (i.e., stop codon), and the nucleic acid sequence encoding amino acids present in the polypeptide therein. The terms "start codon" and "stop codon" refer to a unit of three adjacent nucleotides (i.e., codons) in the coding sequence, which correspondingly indicate the initiation and termination of protein synthesis (mRNA translation).

[0824] As used herein, the terms "phenotype," "phenotypic trait," or "trait" refer to one or more characteristics of a plant or plant cell. A phenotype can be observed with the naked eye or by any other assessment method known in the art (e.g., microscopy, biochemical analysis, or electromechanical assay). In some cases, a phenotype is directly controlled by a single gene or gene locus (i.e., corresponding to a "monogenous trait"). In other cases, a phenotype is the result of interactions between several genes, and in some embodiments, it is also caused by interactions between the plant and / or plant cells and their environment.

[0825] As used herein, the term "plant" can refer to the whole plant, any part thereof, or a cell or tissue culture derived from a plant. Therefore, the term "plant" can refer to any of the following: the whole plant, plant components or organs (e.g., leaves, stems, roots, etc.), plant tissues, seeds, and / or plant cells.

[0826] Plant cells are plant cells obtained from plants or derived from cells taken from plants through culture. Therefore, the term "plant cell" includes, but is not limited to, cells within seeds, suspension cultures, embryos, meristematic zones, callus, leaves, buds, gametophytes, sporophytes, pollen, and microspores. The phrase "plant part" refers to a portion of a plant, including single cells and cellular tissues (e.g., intact plant cells), cell masses, and tissue cultures that can regenerate plants. Examples of plant parts include, but are not limited to, single cells and tissues derived from: pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, buds, and seeds; as well as scions, rhizomes, protoplasts, callus, etc.

[0827] As used herein, the term "primer" refers to an oligonucleotide that, when placed under conditions inducing primer extension product synthesis (e.g., in the presence of nucleotides and reagents for polymerization, such as DNA polymerase, and at suitable temperature and pH), is capable of annealing (in some embodiments, specifically annealing) with a nucleic acid target to allow DNA polymerase and / or reverse transcriptase to attach thereto, thereby serving as a starting point for DNA synthesis. In some embodiments, one or more primers are used to amplify plant nucleic acids (e.g., using polymerase chain reaction; PCR).

[0828] As used herein, the term "probe" refers to a nucleic acid (e.g., a single-stranded nucleic acid or a strand of a double-stranded or higher-order nucleic acid, or a subsequence thereof) that can form a hydrogen-bonded duplex with a complementary sequence in a target nucleic acid sequence. Typically, probes are of sufficient length to form stable and sequence-specific duplex molecules with their complementary sequences, and this can be used in some embodiments to detect a target sequence present in multiple nucleic acids.

[0829] As used herein, the terms “offspring” and “offspring plant” refer to a plant produced from one or more parent plants through vegetative or sexual reproduction. Offspring plants can be obtained by cloning a single parent plant, self-pollinating a single parent plant, or by hybridizing two or more parents. For example, offspring plants can be obtained by cloning or self-pollinating a single parent plant or by hybridizing two parents, and include inbreds as well as F1 or F2 or even further generations. F1 is the first generation of offspring produced from two parents (at least one of the two parents is used as a donor of the trait for the first time), while the second generation (F2) or subsequent generations (F3, F4, etc.) are samples produced from self-pollination, intercrossing, backcrossing, and / or other hybridization of F1, F2, etc. Therefore, F1 can be (and in some embodiments is) a hybrid produced by crossing two purebred parents (i.e., each of the purebred parents is homozygous for the target trait or its alleles), while F2 can be (and in some embodiments is) a progeny produced by self-pollination of the F1 hybrid.

[0830] As used herein, the phrase “recombination” refers to the exchange (“crossing-over”) of DNA segments between two DNA molecules or chromatids on a paired chromosome in regions of similar or identical nucleotide sequences. “Recombination event” is understood herein to refer, in some embodiments, to meiotic crossing-over.

[0831] As used herein, the term "reference sequence" refers to a defined nucleotide sequence that serves as the basis for nucleotide sequence comparisons.

[0832] As used in this article, the term “regeneration” and its grammatical variations refer to the production of plants from tissue cultures.

[0833] As used in this article, the phrase "strict hybridization conditions" refers to the conditions under which polynucleotides typically hybridize with their target sequences (but essentially not with other sequences) in a complex mixture of nucleic acids. Strict conditions are sequence-dependent and can vary in different environments.

[0834] Typically, longer sequences hybridize specifically at higher temperatures. A comprehensive guide to nucleic acid hybridization can be found in Sambrook and Russell, 2001. Generally, for specific sequences at a defined ionic strength pH, ​​stringent conditions are chosen to be approximately 5°C to 10°C below the specific melting point (Tm). Tm is the temperature at which 50% of the probe complementary to the target hybridizes to the target sequence at equilibrium (in the presence of an excess of the target sequence, 50% of the probe is occupied at Tm at a given ionic strength, pH, and nucleic acid concentration). Exemplary stringent conditions include: a salt concentration of less than approximately 1.0 M sodium ions, typically approximately 0.01 to 1.0 M sodium ion concentration (or other salt) at pH 7.0 to 8.3, and a temperature of at least approximately 30°C for short probes (e.g., 10 to 50 nucleotides) and at least approximately 60°C for long probes (e.g., greater than 50 nucleotides).

[0835] Tight conditions can also be achieved by adding a destabilizing agent, such as formamide. Other exemplary tight hybridization conditions include incubation at 42°C with 50% formamide, 5x SSC, and 1% SDS; or incubation at 65°C with SSC and 1% SDS; followed by one or more washes at 65°C in 0.2x SSC and 0.1% SDS. For PCR, a temperature of approximately 36°C is typically used for low-tight amplification, but depending on the primer length, the annealing temperature can vary between approximately 32°C and 48°C (or higher). Further guidelines for determining hybridization parameters are provided in numerous references (see, for example, Ausubel et al., 1999).

[0836] As used herein, the term "trait" refers to a desired phenotype, the gene that induces the desired phenotype, and the nucleic acid sequence associated with the gene that induces the desired phenotype. For example, the "HI trait" refers to a haploid-induced phenotype, the gene that induces haploid induction (e.g., matl in corn or Os03g27610 in rice), and the nucleic acid sequence associated with the presence or absence of the haploid-induced phenotype (e.g., HI-related gene products).

[0837] As used herein, the term "transgenic" refers to a nucleic acid molecule introduced into an organism or one or more of its ancestors through some form of artificial transfer technique. Thus, artificial transfer techniques produce "transgenic organisms" or "transgenic cells." It should be understood that artificial transfer techniques can occur in ancestral organisms (or cells therein and / or cells that can develop into ancestral organisms), and any offspring individual possessing an artificially transferred nucleic acid molecule or fragment thereof is still considered transgenic, even if one or more natural and / or assisted breeding results in the presence of the artificially transferred nucleic acid molecule in the offspring individual.

[0838] As used herein, the term “targeted mutagenesis” or “mutation strategy” refers to any mutagenesis method that intentionally induces mutagenesis in a selected gene. Targeted mutagenesis includes methods such as CRISPR, TILLING, TALEN, and other methods that have not yet been discovered but can be used to achieve the same results.

[0839] In particular, it is considered that promoters can be mutagenized to potentially improve the utility of the element for transgenic expression in plants. Mutagenesis of these elements can be performed randomly, and the activity of the mutagenized promoter sequences can be screened in a trial-by-error procedure. Alternatively, specific sequences that provide the desired expression signature for the promoter or that provide enhancing expression activity can be identified, and these or similar sequences can be introduced into the promoter via mutation. Further consideration is given that these sequences can be mutagenized to enhance the expression of their transgenic components in a particular species. Means for mutagenizing DNA segments encoding the promoter sequences of the present invention are well known to those skilled in the art. As indicated, promoters or other regulatory elements can be modified by random or site-specific mutagenesis procedures. Promoters and other regulatory elements can be modified by adding or deleting one or more nucleotides in the sequence encoding the corresponding unmodified sequence, altering their structure.

[0840] Mutagenesis can be performed according to any of the techniques known in the art, such as, but not limited to, synthesizing oligonucleotides with one or more mutations within a specific regulatory sequence. Specifically, site-specific mutagenesis is a technique that can be used to prepare promoter mutants by specifically mutagenesis of the underlying DNA. RNA-directed endonucleases (“RGEN”, e.g., CRISPR / Cas9) can also be used. For example, in conjunction with one or more of the foregoing considerations, this technique further provides the off-the-shelf capability for preparing and testing sequence variants by introducing one or more nucleotide sequence alterations into the DNA. Site-specific mutagenesis allows for the generation of mutants by using a specific oligonucleotide sequence encoding the desired mutant DNA sequence, along with a sufficient number of adjacent nucleotides, to provide primer sequences of sufficient size and sequence complexity to form stable double strands on both sides of the deletion linker fragment being studied in detail. Typically, primers of about 17 to about 75 nucleotides or more in length are preferred, wherein about 10 to about 25 or more residues on both sides of the sequence linker fragment are altered.

[0841] In the case of isolating a clone containing a promoter according to the present invention, it may be desirable to define the promoter region within the clone. An effective targeting method for preparing mutagenic promoters relies on identifying presumed regulatory elements within the promoter sequence. This can be initiated by comparison with promoter sequences known to express in similar tissue-specific or developmentally unique patterns. Sequences shared between promoters with similar expression patterns may be candidates for transcription factor binding and therefore may be elements that confer the expression pattern. Confirmation of these presumed regulatory elements can be achieved by performing deletion analysis on each presumed regulatory sequence, followed by functional analysis of each deletion construct by determining the reporter gene functionally attached to each construct. Thus, once the start promoter sequence is provided, any of many different deletion mutants of the start promoter can be readily prepared.

[0842] The invention disclosed herein provides polynucleotide molecules comprising regulatory element fragments that can be used to construct novel chimeric regulatory elements. Novel combinations of fragments comprising these polynucleotide molecules and at least one other regulatory element or fragment can be constructed and tested in plants and are considered to be within the scope of this invention. Therefore, the design, construction, and use of chimeric regulatory elements is one embodiment of this invention. The promoters of this invention comprise homologs of cis-elements that exhibit homology with the promoter sequences of this invention and are known to affect gene regulation.

[0843] Functionally equivalent fragments of one of the transcriptional regulatory nucleic acids described herein comprise transcriptional regulatory nucleic acids of at least 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 base pairs. Equivalent fragments of the transcriptional regulatory nucleic acid obtained by deleting the region encoding the 5′ untranslated region of the mRNA will then provide only the (untranscribed) promoter region. The 5′ untranslated region can be readily determined by methods known in the art (e.g., 5′-RACE analysis). Therefore, some of the transcriptional regulatory nucleic acids described herein are equivalent fragments of other sequences.

[0844] As indicated above, deletion mutants of the promoter of the present invention can also be randomly prepared and then tested. Following this strategy, a series of constructs are prepared, each containing a different portion (subclone) of the promoter, and the activity of these constructs is then screened. A suitable means of screening activity is to attach a deleted promoter or intron construct containing the deleted segment to a selectable or screenable marker, and to isolate only those cells expressing the marker gene. In this way, many different deleted promoter constructs are identified, which still retain the desired or even enhanced activity. The minimum segment required for activity is thus identified by comparing the selected constructs. This segment can then be used to construct a vector for expressing a foreign gene.

[0845] As used herein, “at least one expression cassette” specifically refers to DNA comprising a regulatory sequence and a nucleic acid encoding a DNA-modifying enzyme, to be expressed by transfected cells. In one instance, the at least one expression cassette is a component of vector DNA and is expressed in transfected cells after transformation. The at least one expression cassette as described herein typically comprises multiple expression cassettes, such as: an expression cassette containing a regulatory sequence and a nucleic acid encoding a gRNA; an expression cassette containing a regulatory sequence that initiates replication of the donor DNA; and an expression cassette containing a regulatory sequence and a selectability marker or some combination thereof, such as an expression cassette containing DNA encoding a Cas enzyme and a gRNA under the control of an FMOS regulatory sequence. The at least one expression cassette described herein may contain additional regulatory elements. The terminology in this context should be understood broadly as encompassing all sequences that can affect the construction or function of the at least one expression cassette. For example, regulatory elements may modify transcription and / or translation in prokaryotes or eukaryotes. The at least one expression cassette described herein may be downstream (in the 3′ direction) of the nucleic acid sequence to be expressed and optionally contains additional regulatory elements, such as transcriptional or translational enhancers. Each additional regulatory element may be operatively linked to the nucleic acid sequence to be expressed (or a transcriptional regulatory nucleotide sequence). Additional regulatory elements may include additional promoters, minimal promoters, promoter elements, or transposable elements that can modify or enhance expression regulatory properties. The at least one expression cassette may also contain one or more introns, one or more exons, and one or more terminators.

[0846] Furthermore, it is considered that promoter combinations from more than one promoter may be useful. For example, U.S. Patent No. 5,491,288 discloses the combination of a cauliflower mosaic virus promoter with a histone promoter. Therefore, elements from promoters disclosed herein (e.g., the FMOS promoter) can be combined with elements from other promoters (FMOS or others) as long as FMOS functionality is maintained. For example, in some embodiments, introns in the FMOS promoter can be replaced by introns from other promoters (e.g., introns from the ubiquitin promoter). Further, in some embodiments, the FMOS promoter can be extended, for example, by fusing with introns from other promoters, such as fusing an FMOS promoter with an intron from a ubiquitin promoter. Detailed Implementation

[0847] This disclosure relates in particular to systems and methods for improving gene editing efficiency (e.g., for reducing the number of transformations required to produce edits (e.g., new mutations or events) in plant DNA).

[0848] In various embodiments, this disclosure relates to methods for generating multiple unique edits (e.g., multiple unique allele substitutions, multiple unique base insertions, multiple unique base deletions, or multiple unique point mutations) in T1 seeds of plants.

[0849] In one exemplary embodiment, the method includes converting at least one expression cassette into plant cells or plant tissues. Figure 1 Examples of at least one expression cassette 2 suitable for use in transformation methods are shown. As described herein, cassette 2 is shown as a combination of features in a plasmid vector 3, but in other instances, the expression cassette may be isolated DNA or may be features in a viral vector. Expression cassette 2 comprises a nucleic acid 4 encoding a DNA-modifying enzyme; a nucleic acid 6 encoding at least one guide RNA (gRNA); and a flower mosaic (FMOS) regulatory sequence 10 including an FMOS promoter 10a. In many embodiments, the FMOS regulatory sequence will further include an FMOS terminator 10b.

[0850] Nucleic acid 4 can encode a variety of DNA-modifying enzymes. For example, nucleic acid 4 can encode site-directed nucleases selected from the group consisting of: broad-spectrum nucleases (MN), zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), Cas nucleases, Cas9 nucleases, Cas12a nucleases (also referred to herein as Cpf1 nucleases), dCas9-FokI, dCpf1-FokI, chimeric Cas9-cytidine deaminase, chimeric Cas9-adenine deaminase, chimeric FEN1-FokI and Mega-TAL, nickase Cas9 (nCas9), chimeric dCas9 non-FokI nucleases and dCpf1 non-FokI nucleases. SEQ ID NO:4 is an example of a Cas nuclease (specifically, a Cas9a nuclease). SEQ ID NO:532 is another example of a Cas nuclease (specifically, a Cas12a nuclease). Cas nucleases can be modified while still retaining Cas nuclease activity. For example, this Cas12a, based on previous publications, is an optimized form of the rice codon from the Lachnospiraceae bacterium ND2006, except that it has 3 bp alterations to remove two Bsp119I sites and one RsrII site. Two nuclear localization signals (NLS) are added to its N-terminus and C-terminus, respectively; the N-terminus also contains an epitope tag. Other alterations are expected. Thus, in some instances, the Cas nuclease will have a sequence that is at least 90%, 95%, 98%, or 99% identical to SEQ ID NO:4 or SEQ ID NO:532.

[0851] Depending on the nuclease used, it optionally includes a nucleic acid encoding at least one gRNA. For example, when using a nuclease that forms a nuclease-gRNA complex (e.g., Cas), it is desirable to use at least one nucleic acid encoding a gRNA. Further, the gRNA may be single-stranded or may include more than one strand, such as a target RNA that hybridizes to a target DNA sequence and an activator RNA that hybridizes to the target RNA. Various methods using single and multiple guide RNAs are described in U.S. Patent Nos. 8,697,359 and 10,000,772, and U.S. Patent Publication US20160208243 (all of which are incorporated herein by reference).

[0852] FMOS regulatory sequence 10 mediates the expression of at least one DNA-modifying enzyme in floral primordia and floral reproductive organs, and mediates multiple edits in at least one of the floral primordia and floral reproductive organs. Floral primordia and floral reproductive organs include structures present in a fully developed flower, as well as all developmental stages of these structures, such as those initiated after the transition from vegetative growth to floral development. For example, floral primordia and floral reproductive organs include microsporocytes, anthers, stamens, tapetum, megasporocytes, pistils, ovaries, styles, and stigmas, as well as any developmental stages of these structures.

[0853] Therefore, the FMOS regulatory sequence can mediate expression in at least one of the following developmental stages: inflorescence, microsporocyte, anther, stamen, felt layer, megasporocyte, pistil, ovary, style, stigma, or any of these structures. In many embodiments, the FMOS regulatory sequence will mediate the expression of DNA-modifying enzymes in the floral reproductive organs or primordia of both males and females, and will mediate multiple edits in the floral reproductive organs or primordia of both males and females.

[0854] It should be understood that the FMOS regulatory sequence will mediate significantly more expression of DNA-modifying enzymes in floral primordia and floral reproductive organs than in vegetative tissues (e.g., leaf or bud meristems). The increased expression rate may vary depending on the specific example. For instance, the FMOS regulatory sequence will mediate at least one of the following multiples of DNA-modifying enzymes in floral primordia and floral reproductive organs compared to sapical meristems (SAMs): at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 11-fold, at least 12-fold, at least 13-fold, at least 14-fold, at least 15-fold, at least 16-fold, at least 17-fold, at least 18-fold, at least 19-fold, at least... 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, up to At least 74 times, 75 times, 76 times, 77 times, 78 times, 79 times, 80 times, 81 times, 82 times, 83 times, 84 times, 85 times, 86 times, 87 times, 88 times, 89 times, 90 times, 91 times, 92 times, 93 times, 94 times, 95 times, 96 times, 97 times, 98 times, 99 times, and 100 times less. Similar improvements in expression rates can be observed when compared to other vegetative tissues, such as leaf tissues.

[0855] FMOS regulatory sequences will mediate significantly more expression of DNA-modifying enzymes in floral primordia and reproductive organs than in seeds. For example, FMOS regulatory sequences will mediate at least one of the following multiples of DNA-modifying enzyme expression in floral primordia and reproductive organs compared to seeds: at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 11-fold, at least 12-fold, at least 13-fold, at least 14-fold, at least 15-fold, at least 16-fold, at least 17-fold, at least 18-fold, at least 19-fold, at least 20-fold, at least 21-fold. At least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, up to At least 48 times less, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, at least 74 times. At least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times.

[0856] In some embodiments, the FMOS regulatory sequence mediates the expression of DNA-modifying enzymes in the floral reproductive organs of both male and female flowers, and mediates multiple edits in the floral reproductive organs of both male and female flowers. In such embodiments, the expression of DNA-modifying enzymes in the male floral reproductive organs is at least one multiple of the following: at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, and so on. At least 18 times less, at least 19 times, at least 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times. At least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 7 3 times, at least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times.Similarly, the expression of DNA-modifying enzymes in female floral reproductive organs is at least one fold higher in floral primordia and floral reproductive organs than in sapical meristems (SAMs) of the following: at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 11-fold, at least 12-fold, at least 13-fold, at least 14-fold, at least 15-fold, at least 16-fold, at least 17-fold, at least 18-fold. At least 19 times, at least 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times At least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times.

[0857] FMOS Expression Assay: DNA modifying enzyme expression rates were measured using qRT PCR. For vegetative tissues, samples were taken from V3 leaves. For seeds, mature seeds were sampled. For floral primordia and reproductive organs, samples were taken from immature male and female spikes (primordia) and anthers at four stages. These stages were as follows: Female and male spike primordia: 1 cm, 2 cm, and 4 cm in length. Anthers: 0.5 mm, 1.0 mm, 1.5 mm, and 2.0 mm in length (through pre-meiosis and meiosis).

[0858] For expression assessment using a qRT-PCR protocol, RNA was extracted from frozen tissues (leaf, anther, primordium, seed). gDNA was digested with DNase for 2 hours. It was then used as a template in a one-step qRT-PCR assay in 384-well plates using reagents from Sigma and Invitrogen. We used a TaqMan assay designed with Primer Express software. Real-time qPCR was run on QuantStudios, and Ct (or Cq) values ​​were captured after adjusting baselines and thresholds. Expression values ​​for each sample were calculated by normalizing the GOI Ct to the endogenous housekeeper / reference gene Ct. Assay design will vary depending on the nuclease. For example, for Cas9, the primers for qRT-PCR were: forward primer: TTGTGCTGCTCCACGAACA (SEQ ID NO:528); reverse primer: GCCAGCCACTACGAGAAGCT (SEQ ID NO:529); and probe: CTGCTTCTGCTCGTTGTCCTCCGG (SEQ ID NO:530). For the PMI assay, the primers for qRT-PCR were: forward primer: CCGGGTGAATCAGCGTTT (SEQ ID NO:649); reverse primer: GCGTGGCCTTTGACAGT (SEQ ID NO:650); and probe: TGCCGCCAACGAATCACCGG (SEQ ID NO:651). For the control gene ZmEF1α assay, the primers for qRT-PCR were: forward primer: GGCCGTCACCGTATCC (SEQ ID NO:652); reverse primer: GCTCGGGCGTCAGTA (SEQ ID NO:653); and probe: ATCAGAGGCGAGCAGAAACCACACCAC (SEQ ID NO:654).

[0859] exist Figure 1In the example shown, box 2 is contained in vector 24301 (SEQ ID NO:1). Nucleic acid 4 corresponds to the nucleic acid encoding Cas9 (SEQ ID NO:4). Nucleic acid 6 encoding at least one guide RNA (gRNA) corresponds to a single gRNA containing a target-RNA sequence and an activator-RNA sequence. In this example, the target-RNA sequence encodes a sequence targeting the ADH1 gene. FMOS promoter 10a corresponds to prZmAP1-01, which is the promoter sequence for the maize APETALA1 (AP1) gene specifically expressed in early and late male and female inflorescences. This sequence includes an upstream promoter, a first exon, a first intron, and a second exon (partially) with a 2bp alteration to remove the ATG start codon, making the exon untranslatable. In some instances, the FMOS promoter may include at least one of the following: modified to remove at least a portion of the first natural exon, the first intron, and the second exon of the start codon, wherein the portion of the second exon is untranslatable. FMOS terminator 10b corresponds to tZmAP1-01, which is the terminator sequence in the maize APETALA1 (AP1) gene. Box 2 can be used to generate multiple edits, such as multiple insertions or deletions, including multiple single-base deletions and larger deletions, as well as single-base insertions and larger insertions.

[0860] In many embodiments, the cassette may include additional features. For example, cassette 2 includes a gRNA promoter 12 to regulate the expression of at least one gRNA. In this example, gRNA promoter 12 corresponds to prOsU3-01, which is the rice U3 promoter for pol III-dependent transcription of non-coding RNA. The vector may similarly include additional features such as a selectivity marker, for example, marker 14a, which encodes phosphomannose isomerase (PMI) and can be used in conjunction with mannose selection to recover stably transformed plants. Additional features include regulatory sequences, such as promoter 14b and terminator 14c for regulating the expression of the selectivity marker.

[0861] The vector may further include additional features to assist transformation, such as features that assist Agrobacterium-mediated transformation, a well-known and useful technique for introducing exogenous nucleic acid molecules into plants. For example, the vector may include portions of a Ti (tumorigenic) plasmid, such as a virulence (VIR) gene, and T-DNA boundaries (left boundary or LB and right boundary or RB). In short, the wild-type form of Agrobacterium contains a Ti (tumorigenic) plasmid, which in the host plant indicates the generation of galls. The transfer of the oncogenic T-DNA region of the Ti plasmid to the plant genome utilizes the virulence gene encoded by the Ti plasmid and the T-DNA boundaries (commonly referred to as LB and RB), which are a set of forward DNA repeats delineating the region to be transferred. For example, vector 1 includes RB18a, LB 18B, a VIR gene 18c, and a VIR promoter 18d. In many embodiments, the portion of the vector between RB and LB may be considered at least one expression cassette.

[0862] Various vectors for use with expression cassettes as described herein are commercially available, for example from Clontech (Palo Alto, California). Methods for co-culturing Agrobacterium with cultured plant cells or wounded tissues such as leaf tissue, root explants, hypocotyls, stem segments, or tubers are also well known in the art. See, for example, Glick and Thompson, (ed.), Methods in Plant Molecular Biology and Biotechnology, Boca Raton, Fla. (Boca Raton, Florida): CRC Press (1993).

[0863] Plant cells or tissues can be transformed as desired, for example, by Agrobacterium-mediated transformation or by bio-projectile-mediated transformation. Bio-projectile-mediated transformation (originally described by Klein et al. [Nature] 327:70-73 (1987)) relies on microprojectiles, such as gold or tungsten, coated with the desired nucleic acid molecules by precipitation with calcium chloride, spermidine, or polyethylene glycol. Using devices such as the BIOLISTIC PD-1000 (Biorad; Hercules, California), microprojectile particles are introduced into angiosperm tissues at high speeds.

[0864] Following transformation, plant cells or tissues are regenerated into T0 plants with multiple T1 seeds. T1 seeds are typically self-pollinating seeds. In some instances, T0 plants may also be backcrossed to produce “BC1” seeds or crosscrossed to produce “F1” seeds. As used herein, T1 seeds are considered to include self-pollinating or “self-pollinated” seeds, BC1 seeds, and F1 seeds. The “1” refers to the first generation after the T0 transformation. Using embodiments of the invention disclosed herein, T1 seeds (including self-pollinated seeds, BC1 seeds, or F1 seeds) contain multiple unique edits. For the purposes of this disclosure, when plants are subsequently produced in Arabidopsis via flower transformation using the methods disclosed herein (e.g., immersing flowers in Agrobacterium, as is well known in the art), the resulting plants are considered T0 plants. Unique edits may vary depending on the embodiment. For example, unique edits may include multiple unique allelic substitutions, multiple unique base insertions, and multiple unique base deletions. The number of edits can vary and may include at least one of the following: at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, and at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, or at least 95 unique edits per transformation. Unique edits can be determined by comparing the sequence with an unedited sequence.

[0865] In some embodiments, these methods further include growing T1 seeds to produce a plurality of T1 plants, measuring at least one phenotype in the T1 generation plants, and selecting T1 generation plants based on the measurement of at least one phenotype, wherein the selected plants have unique edits. Further, these methods may include sequencing the edited target or insertion site in the selected T1 generation plants, sequencing the edited target or insertion site in the unselected T1 generation plants, and comparing the target or insertion sequence in the selected plants with the target or insertion site sequence in the unselected plants for comparative purposes, such as to identify which mutations confer the desired phenotype and which do not.

[0866] These methods also include crossing selected plants of the T1 generation with unique editing with plants that do not have that unique editing to produce offspring with unique editing. In some embodiments, the selected plants of the T1 generation may be self-pollinated, for example, to improve homozygosity.

[0867] Figure 2A vector 19 containing at least one expression cassette 20 is shown, which is suitable for use in transformation methods to produce multiple edits, particularly multiple different allelic substitutions. The expression cassette 20 contains a nucleic acid 24 encoding a DNA-modifying enzyme; a nucleic acid 26 encoding at least one guide RNA (gRNA); and a flower mosaic (FMOS) regulatory sequence 30 including an FMOS promoter 30A and an FMOS terminator 30B.

[0868] In this example, at least one box 20 further includes donor DNA 32 for allelic substitution and a replicase 34 for driving the replication of the donor DNA. It also includes LIR 36 (long intergenic region, e.g., derived from wheat dwarf virus (WDV)), SIR 40 (short intergenic region, e.g., derived from wheat dwarf virus (WDV)), and LIR 42. Replicase 34 initiates rolling circle amplification of the donor DNA 32, located between LIR 36 and SIR 40, for example, migration protein genes and / or coating protein genes visible here in WDV. A donor left target sequence 44a and a donor right target sequence 44b may also be included to help the donor DNA target genomic DNA. A fluorescent reporter gene 44 (cZsGreen) may also be included. Nucleic acid 24 corresponds to a nucleic acid encoding a site-directed nuclease (e.g., Cas). Nucleic acid 26 encodes at least one guide RNA (gRNA).

[0869] Exemplary FMOS promoters for FMOS modulation sequences are shown in Table 1a. Table 1b lists exemplary FMOS terminators that may also be used if desired.

[0870]

[0871]

[0872]

[0873]

[0874] Furthermore, those skilled in the art will be able to modify the FMOS sequences disclosed in Tables 1a and 1b to practice the invention as shown in Tables 1c and 1d below. For example, transcription factor (TF) binding motifs can be removed or modified to achieve or improve the performance of the FMOS regulatory sequence. When modifying promoters, applicants typically retain important TF binding motifs, i.e., those motifs related to flowering. For example, applicants tend to retain the TF binding motif AC:RSP02530 / / OS:rice (japonica) / gene:DEP1 / RE:GTAC-motif 3 / BF:IPA1 (DEP1 is the flowering TF).

[0875] Figure 34The exemplified example is prZmBde1-02 (SEQ ID NO:50, e.g., in vector 24320), which is modified to remove 760 bp (38% of the promoter sequence upstream of the 5′UTR). In other instances, FMOS efficiency is maintained even with further modifications to the FMOS promoter. For example, prOsAP1-01 (SEQ ID NO:74) retains efficiency even after removing 53% of the sequence. It is also desirable to fuse promoters or terminators, for example (e.g., by intron substitution), to produce fusions of the Bde1 and AP1 sequences with similar FMOS performance. In some instances, FMOS performance can be improved by replacing introns from a native FMOS promoter with introns from another promoter (e.g., from a ubiquitin promoter). By way of example, an intron or a portion thereof of prBde1-02 (as in vector 24320) may be replaced by an intron or a portion thereof from a ubiquitous promoter (e.g., iUbi1-07) (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or all of SEQ ID NO:531). Furthermore, in some instances, FMOS performance may be improved by fusing a native FMOS promoter with an intron from a ubiquitous promoter. For example, the promoter prBde1-02 (as in vector 24320) may be fused with a ubiquitous promoter, such as iUbi1-07 (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or all of SEQ ID NO:531).

[0876]

[0877]

[0878]

[0879]

[0880]

[0881]

[0882]

[0883] The FMOS sequences listed in Tables 1a, 1b, 1c, and 1d are intended to be illustrative only, as those skilled in the art will be able to readily construct expression cassettes as described herein by identifying and screening candidate regulatory sequences (e.g., promoters and terminators) against FMOS activity. Screening will similarly help distinguish non-FMOS regulatory sequences that may not meet FMOS criteria; for example, they may not express the editing mechanism in a manner sufficiently strong to make the editing visible, or they may behave like constitutive promoters when used in a heterologous cassette to drive transgene expression. Alternatively, non-FMOS sequences may fail because they are “missing” and would result in significant expression of the edited transgene in undesirable locations—e.g., nonflorescent tissues (e.g., callus or vegetative meristems). Methods for validating FMOS regulatory sequences are provided in the following examples.

[0884] Exemplary Example:

[0885] 1. A method for generating multiple unique edits in T1 seeds of plants, the method comprising:

[0886] a) Transforming at least one expression cassette into plant cells or plant tissues, wherein the at least one expression cassette contains

[0887] Nucleic acids that encode DNA-modifying enzymes

[0888] Optionally, a nucleic acid encoding at least one guide RNA (gRNA), and

[0889] FMOS (Fragmented Mosaic Metallic) control sequence, wherein the FMOS control sequence

[0890] (i) at least one of the DNA-modifying enzymes mediating the expression of the enzyme in the floral primordium cells and floral reproductive organs, and

[0891] (ii) mediating multiple edits in at least one of the floral primordia and the floral reproductive organs; and

[0892] b) Regenerate the plant cells or plant tissues into a T0 plant with multiple T1 seeds, wherein the T1 seeds contain multiple unique edits.

[0893] 2. The method as described in 1, wherein the plurality of unique edits are selected from the group consisting of: plurality of unique allelic substitutions, plurality of unique base insertions, and plurality of unique base deletions.

[0894] 3. The method as described in 1 or 2, wherein the DNA-modifying enzyme is a site-directed nuclease selected from the group consisting of: macro nucleases (MN), zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), Cas nucleases, Cas9 nucleases, Cpf1 nucleases, dCas9-FokI, dCpf1-FokI, chimeric Cas9-cytidine deaminase, chimeric Cas9-adenine deaminase, chimeric FEN1-FokI and Mega-TAL, nickase Cas9 (nCas9), chimeric dCas9 non-FokI nucleases and dCpf1 non-FokI nucleases.

[0895] 4. The method as described in any of the above, wherein

[0896] The DNA-modifying enzyme is either Cas9 nuclease or Cpf1 nuclease, and

[0897] The at least one expression cassette contains a nucleic acid encoding a gRNA, wherein the nucleic acid encoding the gRNA is operatively linked to an FMOS promoter or a second promoter.

[0898] 5. The method as described in any of the above, wherein

[0899] The unique editing is allele substitution, and

[0900] The at least one expression cassette further comprises the target nucleic acid (donor DNA).

[0901] 6. The method of any one of 5, wherein the at least one expression cassette further comprises a replication promoter operatively linked to the donor DNA to drive replication of the donor DNA.

[0902] 7. The method as described in 5 or 6, wherein the at least one expression box further comprises at least one LIR.

[0903] 8. The method as described in any of the above, wherein the method further comprises:

[0904] The T1 seeds are grown to produce multiple T1 plants, and

[0905] Measure at least one phenotype in T1 generation plants, and

[0906] The plants of the T1 generation were selected based on measurements of at least one phenotype, wherein the selected plants have unique editing.

[0907] 9. The method as described in 8, the method further comprising:

[0908] The insertion sites of the donor DNA in the selected plants of the T1 generation were sequenced.

[0909] The insertion sites of the donor DNA in the unselected plants of the T1 generation were sequenced, and

[0910] The insertion site sequence of the selected plant is compared with the insertion site sequence of the unselected plant.

[0911] 10. The method as described in 8 or 9, the method further comprising crossing the selected plants of the T1 generation having the unique edit with plants not having the unique edit to produce offspring having the unique edit.

[0912] 11. The method as described in any of the above, wherein the FMOS regulatory sequence is mediated in at least one of the inflorescence, microsporocyte, anther, stamen, felt layer, megasporocyte, pistil, ovary, style and stigma.

[0913] 12. The method as described in any of the above, wherein the FMOS modulation sequence mediates...

[0914] The DNA-modifying enzyme is present in the floral primordia and the floral reproductive organs at at least one of the following multiples more than in the vegetative tissues: at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 21 times, at least 2 2 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times At least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, at least 74 times, up to At least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times, and

[0915] The DNA-modifying enzyme in the floral primordia and the floral reproductive organs in at least one of the following multiples compared to that in the seeds: at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 21 times, at least 22 times. At least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times At least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, at least 74 times. At least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times.

[0916] 13. The method as described in any of the above, wherein the FMOS modulation sequence comprises an FMOS promoter and an FMOS terminator.

[0917] 14. The method as described in any of the preceding claims, wherein the FMOS promoter is selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:26, SEQ ID NO:29, SEQ ID NO:35, SEQ ID NO:47, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:56, SEQ ID NO:62, SEQ ID NO:65, SEQ ID NO:71, SEQ ID NO:74, SEQ ID NO:77, SEQ ID NO:80, SEQ ID NO:83, SEQ ID NO:86, SEQ ID NO:514, SEQ ID NO:518, SEQ ID NO:614, SEQ ID NO:615, SEQ ID NO:616, SEQ ID NO:617, SEQ ID NO:618, SEQ ID NO:619, SEQ ID NO:620, SEQ ID NO:621, SEQ ID NO:622, SEQ ID NO:698, SEQ ID NO:700, SEQ ID NO:617, SEQ ID NO:618, SEQ ID NO:619, SEQ ID NO:620, SEQ ID NO:621, SEQ ID NO:622, SEQ ID NO:698, SEQ ID NO:700, SEQ ID NO:618, SEQ ID NO:619 ... SEQ ID NO:702, SEQ ID NO:704, SEQ ID NO:706, SEQ ID NO:708, SEQ ID NO:710, SEQ ID NO:717, SEQ ID NO:719, SEQ ID NO:721 and SEQ ID NO:723 or sequences having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 90% homology with them.

[0918] 15. The method as described in any of the above, wherein the FMOS terminator is selected from the group consisting of: SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:27, SEQ ID NO:30, SEQ ID NO:36, SEQ ID NO:48, SEQ ID NO:51, SEQ ID NO:54, SEQ ID NO:57, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:72, SEQ ID NO:75, SEQ ID NO:78, SEQ ID NO:81, SEQ ID NO:84, SEQ ID NO:87, SEQ ID NO:515, SEQ ID NO:519, SEQ ID NO:699, SEQ ID NO:701, SEQ ID NO:703, SEQ ID NO:705, SEQ ID NO:707, SEQ ID NO:709, SEQ ID NO:718, SEQ ID NO:720, SEQ ID NO:722 and SEQ ID NO:703. NO:724 or at least one of the sequences having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 90% homology with it.

[0919] 16. The method as described in any of the above, wherein the plurality of unique edits comprises at least one of the following: at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95 unique edits.

[0920] 17. The method as described in any of the preceding methods, wherein the at least one expression cassette does not contain a naturally translatable exon for the FMOS regulatory sequence. The FMOS promoter may include at least one of the following: modified to remove at least a portion of a first natural exon, a first intron, and a second exon of the start codon, wherein said portion of the second exon is untranslatable. Further, in some instances, the FMOS promoter may be modified to include, for example, ubiquitin introns to enhance FMOS activity.

[0921] 18. The method as described in any of the above, wherein the FMOS modulation sequence

[0922] (i) The expression of the DNA-modifying enzymes mediated in the floral reproductive organs of both male and female flowers, and

[0923] (ii) Multiple editing is mediated in the floral reproductive organs of both male and female flowers.

[0924] 19. The method as described in any of the above, wherein

[0925] The expression of the DNA-modifying enzyme in the male floral reproductive organs is at least one multiple of the following in the floral primordia and the floral reproductive organs compared to the vegetative tissue: at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times. At least 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, up to at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 4 5 times, at least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 7 3 times, at least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times, and

[0926] The expression of the DNA-modifying enzyme in the female floral reproductive organs is at least one multiple of the following in the floral primordia and the floral reproductive organs compared to the vegetative tissue: at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times. At least 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times At least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, at least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times.

[0927] 20. The method as described in any of the above, the method further comprising measuring the number of edits in at least one of the T0 flower, T0 spike, and seed of the T0 plant.

[0928] 21. A method for generating multiple unique edits in T1 seeds of a plant, the method comprising:

[0929] a) Transforming at least one expression cassette into plant cells or plant tissues, wherein the at least one expression cassette contains

[0930] The nucleic acid encoding a DNA-modifying enzyme, wherein the DNA-modifying enzyme is selected from the group consisting of Cas9 nuclease and Cpf1 nuclease.

[0931] Nucleic acids encoding guide RNA (gRNA), and

[0932] A flower mosaic (FMOS) control sequence comprising an FMOS promoter, wherein the FMOS control sequence

[0933] (i) mediates the expression of the DNA-modifying enzyme in at least one of the floral primordium cells and floral reproductive organs.

[0934] (ii) mediating multiple edits in at least one of the floral primordia and the floral reproductive organs.

[0935] (iii) In at least one of the floral primordia and the floral reproductive organs, the expression of DNA-modifying enzymes mediated by bud apical meristem (SAM) is at least two-fold, at least three-fold, at least four-fold, at least five-fold, and at least six-fold greater than that in the apical meristem (SAM).

[0936] (iv) at least one of the following: at least two times, at least three times, at least four times, at least five times, and at least six times more expressed than in the seed-mediated DNA-modifying enzyme;

[0937] b) Regenerating the plant cells or tissues into a plant with multiple T1 seeds; and

[0938] c) Allow the T1 seeds to grow to produce a T1 generation, wherein the T1 generation contains at least one of at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, or at least 95 unique edits.

[0939] 22. The method of 21, wherein the method further comprises

[0940] d) Measure at least one phenotype in the T1 generation plants.

[0941] e) Selecting plants from the T1 generation based on measurements of at least one phenotype, wherein the selected plants have unique edits, and

[0942] f) Sequencing the insertion site of the donor DNA in the selected plants of the T1 generation.

[0943] 23. The method as described in 21 or 22, wherein the FMOS promoter is selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:26, SEQ ID NO:29, SEQ ID NO:35, SEQ ID NO:47, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:56, SEQ ID NO:62, SEQ ID NO:65, SEQ ID NO:71, SEQ ID NO:74, SEQ ID NO:77, SEQ ID NO:80, SEQ ID NO:83, SEQ ID NO:86, SEQ ID NO:514, SEQ ID NO:518, SEQ ID NO:614, SEQ ID NO:615, SEQ ID NO:616, SEQ ID NO:617, SEQ ID NO:618, SEQ ID NO:619, SEQ ID NO:620, SEQ ID NO:621, SEQ ID NO:622, SEQ ID NO:698, SEQ ID NO:700, SEQ ID NO:618, SEQ ID NO:619, SEQ ID NO:620, SEQ ID NO:621, SEQ ID NO:622, SEQ ID NO:698, SEQ ID NO:700, SEQ ID NO:619, SEQ ID NO:618, SEQ ID NO:619 ... SEQ ID NO:702, SEQ ID NO:704, SEQ ID NO:706, SEQ ID NO:708, SEQ ID NO:710, SEQ ID NO:717, SEQ ID NO:719, SEQ ID NO:721 and SEQ ID NO:723 or sequences having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 90% homology with them.

[0944] 24. A method for generating multiple unique edits in T1 seeds of a plant, the method comprising:

[0945] a) Expression in plant cells or plant tissues selected from groups composed of floral primordia cells and floral reproductive organs

[0946] Nucleic acids encoding DNA-modifying enzymes, and

[0947] Nucleic acids that encode guide RNA (gRNA),

[0948] At least one of the nucleic acid encoding the DNA-modifying enzyme and the nucleic acid encoding the gRNA is operatively linked to a flower mosaic (FMOS) regulatory sequence, wherein the FMOS regulatory sequence...

[0949] (i) mediating the expression of at least one of the DNA-modifying enzymes and the gRNA in at least one of the floral primordia cells and floral reproductive organs, and

[0950] (ii) mediating multiple edits in at least one of the floral primordia and the floral reproductive organs; and

[0951] b) Regenerate the plant cells or plant tissues into a plant with multiple T1 seeds, wherein the T1 seeds contain multiple unique edits.

[0952] 25. The method of 24, wherein the method further comprises

[0953] The delivery of the target nucleic acid (donor DNA) into the plant cells or plant tissues in which it is expressed, and

[0954] The donor DNA is inserted into the genome of the plant.

[0955] 26. The method as described in 24 or 25, wherein the FMOS modulation sequence comprises at least one of an FMOS promoter and an FMOS terminator, wherein

[0956] The FMOS promoter is selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:26, SEQ ID NO:29, SEQ ID NO:35, SEQ ID NO:47, SEQ ID NO:50, SEQ ID NO:53, SEQ IDNO:56, SEQ ID NO:62, SEQ ID NO:65, SEQ ID NO:71, SEQ ID NO:74, SEQ ID NO:77, SEQ ID NO:80, SEQ ID NO:83, SEQ ID NO:86, SEQ ID NO:514, SEQ ID NO:518, SEQ ID NO:614, SEQ ID NO:615, SEQ ID NO:616, SEQ ID NO:617, SEQ ID NO:618, SEQ ID NO:619, SEQ ID NO:620, SEQ ID NO:621, SEQ ID NO:622, SEQ ID NO:698, SEQ ID NO:700, SEQ ID NO:702, SEQID SEQ ID NO:704, SEQ ID NO:706, SEQ ID NO:708, SEQ ID NO:710, SEQ ID NO:717, SEQ ID NO:719, SEQ ID NO:721 and SEQ ID NO:723 or sequences having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 90% homology with them, and

[0957] The FMOS terminator is selected from the group consisting of: SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:27, SEQ ID NO:30, SEQ ID NO:36, SEQ ID NO:48, SEQ ID NO:51, SEQ ID NO:54, SEQ ID NO:57, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:72, SEQ ID NO:75, SEQ ID NO:78, SEQ ID NO:81, SEQ ID NO:84, SEQ ID NO:87, SEQ ID NO:515, SEQ ID NO:519, SEQ ID NO:699, SEQ ID NO:701, SEQ ID NO:703, SEQ ID NO:705, SEQ ID NO:707, SEQ ID NO:709, SEQ ID NO:718, SEQ ID NO:720, SEQ ID NO:722 and SEQ ID NO:722. NO:724 or at least one of the sequences having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 90% homology with it.

[0958] 27. The method as described in any of the foregoing, wherein the T0 plant has a mosaicism score of at least 0.5, 1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20, wherein the mosaicism score is determined by mosaicism scoring method 1. The upper limit of the mosaicism score will be determined by the efficacy of the FMOS promoter; however, the applicant expects typical mosaicism scores to be in the range of at least one of 0.5 to 30, 1 to 25, 2 to 25, 3 to 25, 4 to 25, 5 to 25, 6 to 25, 5 to 20, 5 to 19, 5 to 18, 5 to 17, 5 to 16, and 5 to 15.

[0959] 28. At least one expression cassette for generating at least 20 unique edits in T1 seeds of a plant, said

[0960] The expression box contains:

[0961] Nucleic acids that encode DNA-modifying enzymes

[0962] Optionally, a nucleic acid encoding at least one guide RNA (gRNA), and

[0963] Flower mosaic (FMOS) promoter, wherein the FMOS promoter

[0964] (i) at least one of the DNA-modifying enzymes mediating the expression of the enzyme in the floral primordium cells and floral reproductive organs, and

[0965] (ii) mediating multiple edits in at least one of the floral primordia and the floral reproductive organs, and

[0966] (iii) Mediating

[0967] The DNA-modifying enzyme expressed in at least one of the following quantities at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 21 times in the vegetative tissue, compared to the expression in the vegetative tissue: at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 21 times. At least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times. At least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, up to At least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times, and

[0968] The DNA-modifying enzyme is expressed in at least one of the following quantities at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 21 times, in at least 21 times the amount expressed in the seed. At least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times At least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times. At least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times.

[0969] 29. The box as described in 28, wherein

[0970] The DNA-modifying enzyme is either Cas9 nuclease or Cpf1 nuclease;

[0971] The box contains a nucleic acid encoding gRNA, wherein the nucleic acid encoding gRNA is operatively linked to the FMOS promoter or a second promoter;

[0972] The cartridge further comprises a target nucleic acid (donor DNA) and a replication promoter operatively linked to the donor DNA to drive replication of the donor DNA; and

[0973] The FMOS promoter is mediated in at least one of the following: inflorescence, microsporocyte, anther, stamen, felt layer, megasporocyte, pistil, ovary, style, and stigma.

[0974] 29. The box as described in 27 or 28, wherein the FMOS promoter is selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:26, SEQ ID NO:29, SEQ ID NO:35, SEQ ID NO:47, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:56, SEQ ID NO:62, SEQ ID NO:65, SEQ ID NO:71, SEQ ID NO:74, SEQ ID NO:77, SEQ ID NO:80, SEQ ID NO:83, SEQ ID NO:86, SEQ ID NO:514, SEQ ID NO:518, SEQ ID NO:614, SEQ ID NO:615, SEQ ID NO:616, SEQ ID NO:617, SEQ ID NO:618, SEQ ID NO:619, SEQ ID NO:620, SEQ ID NO:621, SEQ ID NO:622, SEQ ID NO:69 ... SEQ ID NO:700, SEQ ID NO:702, SEQ ID NO:704, SEQ ID NO:706, SEQ ID NO:708, SEQ ID NO:710, SEQ ID NO:717, SEQ ID NO:719, SEQ ID NO:721 and SEQ ID NO:723 or sequences having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90% homology with them, and

[0975] Optionally, the box further includes an FMOS terminator selected from the group consisting of: SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:27, SEQ ID NO:30, SEQ ID NO:36, SEQ ID NO:48, SEQ ID NO:51, SEQ ID NO:54, SEQ ID NO:57, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:72, SEQ ID NO:75, SEQ ID NO:78, SEQ ID NO:81, SEQ ID NO:84, SEQ ID NO:87, SEQ ID NO:515, SEQ ID NO:519, SEQ ID NO:699, SEQ ID NO:701, SEQ ID NO:703, SEQ ID NO:705, SEQ ID NO:707, SEQ ID NO:709, SEQ ID NO:718, SEQ ID NO:720, SEQ ID NO:722 and SEQ ID NO:703. NO:724 or at least one of the sequences having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 90% homology with it.

[0976] 30. A plant produced by the method as described in 1-27.

[0977] 31. A plant cell containing a box as described in 28-29.

[0978] Although various FMOS modulation sequences have been disclosed above, those skilled in the art will be able to readily generate the FMOS modulation sequences as described in the claims using Examples 1-4 below.

[0979] Example

[0980] Example 1: Identification of candidates for FMOS modulation sequences

[0981] Candidates for use as FMOS regulatory sequences were identified by searching for genes in crop species or related species that meet two preliminary screening criteria:

[0982] 1. Moderate or high expression in tissues containing numerous de facto reproductive cells (floral tissues). This may include inflorescence primordia, branch meristems, floral meristems, or anther or ovule primordia that produce somatic (non-reproductive) cell types and germinal (reproductive) cell types. Exemplary FMOS candidates drive expression in anther and ovule cells (germinal cells, sporogenous cells or sporoblasts, pollen mother cells or megasporocytes) that have acquired reproductive cell fate. Exemplary FMOS candidates may also exhibit moderate or high expression in meiotic cells (sex mother cells) or post-meiotic gametophytic somatic cells: microspores, megaspores, or eggs and sperm that have undergone fertilization to produce the next generation.

[0983] 2. Exemplary FMOS candidates are not expressed or are expressed at very low levels in precursor stem cells that produce plant regions, including transformed tissues (in corn, this means embryonic and callus tissue). FMOS candidates should also be silent or poorly expressed in apical meristems. FMOS candidates should have low expression in very early inflorescence meristems—and may first be activated after the floral meristems have differentiated into spikelet pairs or floral meristems. Typical FMOS candidates are not expressed before flower development.

[0984] For maize genes, expression levels in SAM were classified as “low,” “medium,” or “high” based on normalized expression values ​​from an internal mRNASeq gene mapping study. In this study, quartiles were calculated using a complete matrix of normalized counts of all detected genes across 69 tissue / developmental stages. Quartiles provide thresholds for classifying individual gene expression values ​​as low (below the first quartile), medium (between the first and third quartiles), and high (above the third quartile). Protein expression values ​​from maize callus were obtained from Supplementary Table S3 in the following literature: Ge F et al. (2017) Metabolic and Proteomic Analysis of Maize Embryonic Callus induced from immature embryo. Scientific Reports 7(1):1004. This table contains a list of over 4,000 proteins identified in all three replicates of their proteomic analysis of maize embryo callus. If our candidate genes are not included in the list of proteins expressed in callus, their expression in callus is categorized as “off”. Similarly, rice callus protein expression values ​​were obtained from the following literature: Abiko M et al. (2013) Identification of proteins enriched in rice egg or sperm cells by single-cell proteomics. [Identification of proteins enriched in rice egg or sperm cells by single-cell proteomics] PLoS One. [PLOS ONE] July 25; 8(7):e69578. Supplementary Table S6 contains a list of proteins detected in rice callus by LC-MS / MS. As for maize genes, if our candidate genes are not included in the list of proteins expressed in callus, their expression is categorized as “off”. Similar criteria can also be used to evaluate candidates for dicotyledonous plants.

[0985] In addition to identifying candidate sequences by measuring expression, those skilled in the art can also identify candidate regulatory sequences based on gene expression data in plant tissue expression databases, known as gene maps, which show the expression of genes from many species in different tissues to evaluate regulatory sequence candidates.

[0986] Table 2 below presents the list of gene promoters selected by the applicant, as well as the construct design for the applicant's final test. All of these genes exhibit flower-preferred or flower-specific expression. RNA or protein expression levels of genes in callus or apical meristems of maize or rice tissues are also shown.

[0987] Table 2

[0988]

[0989]

[0990] Table 2. Gene expression profiles and construct designs of FMOS candidates (17 from corn; 7 from rice).

[0991] After analyzing gene maps, microarrays, and RNA-seq datasets from various tissues and data sources, the applicant selected eleven maize genes with reproductive lineage-specific expression for testing FMOS activity. The applicant also identified six rice genes (typically homologs of the maize genes we discovered) that exhibit similar expression patterns in rice. Exemplary nominations include promoters exhibiting high-preferred expression in anther and ovule primordia and / or germinal cells (sporogen cells, pollen mother cells, megasporocyte mother cells, or sex mother cells) of male and female reproductive organs.

[0992] Example 2. Production of a construct containing an FMOS modulation sequence

[0993] Once a candidate list of regulatory sequences is identified, activity is screened by constructing constructs to drive Cas9 expression using promoters and terminators and measuring the edit diversity produced in stably transformed plants (T0 plants) and their progeny (T1 plants).

[0994] Starting with the 19 FMOS candidates identified in Example 1, we designed 24 constructs, including different variants of the promoter sequence and 5′ untranslated region (UTR), terminator, and in some cases, the untranslatable first exon and intron, as well as the first 15 base pairs of the second exon (from the FMOS candidate gene), as regulatory sequences. These sequences collectively constitute the regulatory region flanking the Cas9 coding sequence and driving its expression. The guide RNA in all 24 constructs targets exon 2 of alcohol dehydrogenase I (ADH1, GRMZM2G442658) at a target site sequence of 5′-cggcaagccactgtcgatcg-3′ (SEQ ID NO:6). The selectivity marker was phosphogmannose isomerase (PMI), and we used mannose selection to re-obtain stably transformed maize inbred line NP2222.

[0995] Another control construct has a Cas9 driven by a constitutive CMP promoter.

[0996] Figure 1 A schematic diagram of vector 24301 (SEQ ID NO:1) is shown. Vector 24301 is used to transform immature corn embryos to produce multiple different edits in the ZmADH1 gene: promoter prZmAP1-01; terminator tZmAP1-01; guide RNA (gRNA) sequence; rsgRNAZmVLHP-01: single guide RNA (sgRNA) containing gRNA, tracRNA, and PolIII termination sequence; cPMI: PMI selectivity marker gene; cCas9: Cas9 nuclease gene; RB: right boundary of T-DNA; LB: left boundary of T-DNA; tNOS: carmine synthase terminator; cSpec: spectinomycin resistance gene.

[0997] Figure 3 This is a schematic diagram of vector 24224 (SEQ ID NO:10), which is used to transform immature corn embryos.

[0998] Figure 4 This is a schematic diagram of vector 24243 (SEQ ID NO:40), which is used to transform immature corn embryos.

[0999] Figure 5 This is a schematic diagram of vector 24265 (SEQ ID NO:19), which is used to transform immature corn embryos.

[1000] Figure 6 This is a schematic diagram of vector 24266 (SEQ ID NO:22), which is used to transform immature corn embryos.

[1001] Figure 7 This is a schematic diagram of vector 24269 (SEQ ID NO:25), which is used to transform immature corn embryos.

[1002] Figure 8 This is a schematic diagram of vector 24270 (SEQ ID NO:28), which is used to transform immature corn embryos.

[1003] Figure 9 This is a schematic diagram of vector 24289 (SEQ ID NO:31), which is used to transform immature corn embryos.

[1004] Figure 10 This is a schematic diagram of vector 24299 (SEQ ID NO:34), which is used to transform immature corn embryos.

[1005] Figure 11 This is a schematic diagram of vector 24300 (SEQ ID NO:85), which is used to transform immature corn embryos.

[1006] Figure 12 This is a schematic diagram of vector 24305 (SEQ ID NO:43), which is used to transform immature corn embryos.

[1007] Figure 13 This is a schematic diagram of vector 24306 (SEQ ID NO:46), which is used to transform immature corn embryos.

[1008] Figure 14 This is a schematic diagram of vector 24320 (SEQ ID NO:49), which is used to transform immature corn embryos.

[1009] Figure 15 This is a schematic diagram of vector 24426 (SEQ ID NO:52), which is used to transform immature corn embryos.

[1010] Figure 16 This is a schematic diagram of vector 24427 (SEQ ID NO:55), which is used to transform immature corn embryos.

[1011] Figure 17 This is a schematic diagram of vector 24428 (SEQ ID NO:58), which is used to transform immature corn embryos.

[1012] Figure 18 This is a schematic diagram of vector 24454 (SEQ ID NO:61), which is used to transform immature corn embryos.

[1013] Figure 19 This is a schematic diagram of vector 24455 (SEQ ID NO:64), which is used to transform immature corn embryos.

[1014] Figure 20 This is a schematic diagram of vector 24458 (SEQ ID NO:67), which is used to transform immature corn embryos.

[1015] Figure 21 This is a schematic diagram of vector 24459 (SEQ ID NO:70), which is used to transform immature corn embryos.

[1016] Figure 22 This is a schematic diagram of vector 24460 (SEQ ID NO:73), which is used to transform immature corn embryos.

[1017] Figure 23 This is a schematic diagram of vector 24548 (SEQ ID NO:76), which is used to transform immature corn embryos.

[1018] Figure 24 This is a schematic diagram of vector 24602 (SEQ ID NO:79), which is used to transform immature corn embryos.

[1019] Figure 25 This is a schematic diagram of vector 24688 (SEQ ID NO:82), which is used to transform immature corn embryos.

[1020] The promoters and terminators used in various vectors, along with their sequence information, are listed below. Example 3. Transformation of plants using expression cassettes containing FMOS regulatory sequences.

[1021] For each construct, we sent 10 to 20 single-copy T0 events (except for 24265, which had a low transformation frequency and produced only two events) to the greenhouse. We sampled seedlings and examined single copies of the PMI and Cas9 transgenes, as well as editing at the ADH1 target site. We also examined PMI and Cas9 expression in seedling leaves.

[1022] We found that almost all constructs behaved as expected—with one transgenic copy according to qPCR (see secondary Taqman assay data below) and the ADH1 target site was edited in the control construct (vector 24224, see Taqman score 0 [both copies edited] or 1 [one copy edited, one WT]), but not in most FMOS candidate constructs (see Taqman score 2 [both copies still WT, or not edited]). Furthermore, most FMOS candidate constructs showed PMI expression in leaves but no Cas9 expression—further demonstrating that expression control was limited to vegetative tissues. This was evident in every construct tested, although not in every event. For example, in 13 of the 13 events (transformed plants) with control construct 24224, the ADH1 target site was edited (both copies of the ADH1 gene were edited in 8 of these plants), and Cas9 expression was more than 1000x higher than the control gene.

[1023] In contrast, the ZmAGO18A (ARGONAUTE 18A) promoter / terminator combination in construct 24269 showed editing in only two of the seventeen events, and expression exceeding 1000x in only one event. Therefore, the FMOS candidate worked as desired in 15 of the 17 events. Based on our database and literature analysis, the Aris gene exhibits highly specific expression in germinal sporogenous cells of corn anthers and ovules. When the regulatory sequence was used to drive Cas9, editing did not occur in callus tissue in most events, and Cas9 expression was restricted, which is the desired performance among the FMOS regulatory sequence candidates.

[1024] Similarly, in constructs with the ZmAP1 promoter / terminator, we found no events with editing in seedling leaf Taqman samples, and Cas9 expression in leaves was very low. Therefore, these two regulatory regions represent promising FMOS candidates because they allow transformed plants to remain unedited during vegetative development. Likewise, most of the other regulatory regions we tested, apart from the rice OsMEL1 promoter and terminator in constructs 24305 and 24243, performed well in this seedling analysis. We tested both versions, and in most events, editing occurred during callus or early vegetative meristem, resulting in edited ADH1 in leaves.

[1025] Table 3

[1026]

[1027]

[1028]

[1029]

[1030]

[1031]

[1032] Table 3. FMOS constructs tested, including leaf editing data (generated by Taqman qPCR assays) and qRT data from seedling leaves. The Taqman assays were qPCR runs against a standard internal control, which happened to be ADH1 (different from the region targeted by the guide RNA; therefore, the control assays were unaffected by any minor gene editing that might have occurred). For both transgene assays and target site PCR assays, a Taqman qPCR score of "1" indicates the presence of one "wild-type" copy of the gene (or transgene). This was determined by in-plate comparison with control tissue. A score of "2" indicates the presence of two "wild-type" copies. A score of "0" indicates the presence of zero wild-type copies; in other words, both target sites were edited. For the quantitative reverse transcriptase (qRT)-PCR data (two columns on the right of the table), the expression of the two transgene PMIs and Cas9 was scored against the internal standard assay. The numbers provided in these two columns represent fold changes relative to the internal control.

[1033] Based on a consistent wild-type ADH1 Taqman score of "0" or "1" in each event, the control construct exhibited efficient editing in leaves, implying that one or two copies of the ADH1 target site carried a novel mutation induced by the editing mechanism. In contrast, the FMOS candidate largely maintained the integrity of the ADH1 target site, likely due to low expression of Cas9 protein in callus, meristem, and immature leaves. Low expression of Cas9 RNA and Cas9 protein in the FMOS promoter construct was validated by examining qRT-PCR and ELISA data for each event. Two versions of the rice MEL1 promoter (meiosis terminated at leptotene stage 1) triggered numerous events in which editing was present in leaves, but with low Cas9 expression; the editing was likely due to Cas9 expression in callus or vegetative meristem when Cas9 paired with the OsMEL1 regulatory region. This is an example of a candidate regulatory sequence with a unique meiosis-specific phenotype; however, it is not an ideal FMOS candidate due to its early expression in callus or vegetative meristem. We discarded plants or structures that showed editing in callus or vegetative meristems (as shown in leaves). Since leaves originate from meristems, we inferred that leaf editing implies meristem editing.

[1034] We focus on using FMOS regulatory sequences to generate events in flowers with multiple edits (as determined by tassel editing and mosaicism assays discussed in Example 4 and illustrated in Table 4).

[1035] Example 4. Generate multiple unique edits and confirm the flower enrichment expression of the editing machine.

[1036] Two assays—one for male inflorescence editing and the other for mosaicism—were used to illustrate the performance of the FMOS regulatory sequence. Both assays indicated the presence of editing at the ADH1 target site. The first assay was a pollen ADH1 biochemical assay using dehydrogenase staining, which could be used to rapidly provide efficient readouts of adh1 function from pollen collected from up to 48 different locations on the male inflorescence. The second assay was target-side DNA-seq via next-generation sequencing (NGS), performed only on male inflorescence samples from T0 events that showed highly edited locations in the adh1 pollen assay screening. The NGS assay revealed the diversity of editing at the target site. Therefore, by combining data from the first and second screenings, we were able to generate a very high-quality dataset showing the efficiency of floral editing and the degree of mosaicism in different parts of the male inflorescence. The NGS data of the promoter were then analyzed by mutation type and location on the male inflorescence to calculate a mosaicism score, which approximates the average number of different editing events detected in a given male inflorescence at T0 event.

[1037] Figure 26a The procedure describes sampling the male spikelets from each event for measurement. Male spikelets from each event are sampled 24–48 times. The spikelets are harvested at the pre-flowering stage, and the upper part and anthers of the florets are placed in the wells of a 96-well plate in the standard order, as shown – the positions are identical in each plate. If we do not have enough lateral branches to fill rows C and D or rows G and H, we simply stop at the number of lateral branches we have in each event.

[1038] To quantify the degree of editing and the diversity of editing events in the tassel, 24 to 48 spikelets (florets) were taken from different locations on the tassel (each tassel has hundreds of spikelets), and the three anthers of the upper florets of each spikelet were halved using tweezers and placed into the wells of a 96-well ADH1 staining plate. Each well of the plate contained 800 μl of 0.1 M Tris-HCl (pH 6.7) at room temperature. The three lower florets from each spikelet were placed into the corresponding wells of a 96-well DNA sequencing plate for storage at -80°C. The pollen in the staining plate was stained for ADH1 activity using the protocol of Wisman et al., Genetic and molecular characterization of an Adh-1 null mutant, Mol Gen Genet, 1991 226:120-128 (which we adapted for 96-well plate screening to enable high-throughput analysis of different parts of the floret).

[1039] In summary, the staining plates were frozen overnight at -20°C and thawed for 2–3 hours. Pollen was collected by pipetting through a 96-well 40 μm nylon mesh sintered filter plate. The collected pollen was aspirated and placed in a 96-well collection plate; each well contained 400 μL of MTT staining buffer, which contained 94% v / v 0.1 M Tris-HCl, 6% v / v ethanol, 0.3 g / L nicotinamide adenine dinucleotide (NAD), 0.2 g / L 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), and 40 mg / L methyl phenazine sulfate (PMS). The plate was then covered and incubated at 28°C in the dark for one hour. Wild-type pollen stained purple. Pollen that had lost ADH1 activity remained unstained (clear). ADH1 is not required for pollen development, survival, or fertilization. 11% of non-viable pollen was detected in the WT control sample. Samples with <1% ADH1-positive pollen were rated as fully edited; samples with >90% ADH1-positive pollen were rated as unedited. Partially edited entries were characterized by the percentage of ADH1-positive pollen in the wells, with estimated increments of 5% (i.e., 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, and 95%). The mean percentage was normalized (-11%, based on controls). Editing diversity was assessed by the frequency of different %ADH1+ brackets. Constructs with mosaicism and high editing efficiency were nominated for NGS to further illustrate editing diversity.

[1040] Table 4

[1041]

[1042] Table 4. ADH1 staining scores (average of hundreds of samples). These data encouraged us to focus our pollen sequencing efforts on three constructs, 24301, 24320, and 24269, which had the highest hypothetical edited pollen counts. Eight of the twelve FMOS promoters showed <50% editing. The percentage of edited adh1 pollen was calculated for events that did not show editing in leaf samples. The percentage of edited pollen was calculated by subtracting %WT ADH1+ pollen from 100. This number was then normalized by subtracting 11% (which is the average percentage of unstained pollen in WT samples).

[1043] Despite being predicted to express in germinal lineages, Table 4 shows eight FMOS promoter candidates that showed >50% WT pollen upon ADH1 staining. One possible reason for this is that those FMOS candidates exhibited flower expression rather than germinal expression. Although we used many high-quality expression datasets, in many cases, the samples contained a mixture of germinal and somatic cells. Another possible explanation is low expression activity in heterologous environments due to missing chromatin features or distal sequences. Cis-enhancers may be hundreds of kilobases away from the genes they enhance in corn. FMOS promoter selection can be further aided by improved RNAseq data from specific germline cells and by utilizing chromatin profiling studies (such as ChIP-seq, ATAC-seq, DNAse I-seq, MNase-seq, or other data types). Therefore, this would lead to the design of chimeric promoters with different enhancers, promoters, introns, and terminators to induce highly specific expression in germ cells.

[1044] ADH1 staining also helps to examine the degree of mosaicism in ADH1 gene editing. By examining 24 to 48 samples at different locations on the tassel, we can see that the degree of editing varies. For example, Table 5 below shows the ADH1 pollen staining results for construct 24320 for 14 events (more than 7 plates). In the first event GVG00887355, some anther samples had more WT pollen than other anther samples (5% in well B7) (40% in well A4). This is a sign of mosaicism—if the editing occurs very early in development, all wells will have “0%” WT pollen, as is the case with the control CMP promoter (see Table 6).

[1045] Table 5

[1046]

[1047]

[1048] Table 5 shows examples of pollen staining results. This is for 14 events from construct 24320. The numbers in each well represent the percentage of stained (unedited) pollen. Some events, like GVG00887372, did not have much editing, but 11 of the 14 events had efficient editing. The prevalence of some samples with high and low editing levels in the plate indicates mosaicism.

[1049] Table 6

[1050]

[1051]

[1052] Table 6. Control construct 24224 (CMP constitutive promoter) is shown in pollen with 100% editing.

[1053] Table 7

[1054]

[1055]

[1056] Table 7. ADH1 staining results for 24305 showed premature Cas9 expression in many events, as indicated by editing assay data in leaves (scores of 0 or 1). This resulted in a lack of mosaicism in the tassels (most / all pores in these events showed nearly 100% editing).

[1057] Table 7a

[1058]

[1059]

[1060] Table 7a. ADH1 staining results for 24460. Thirteen of the 15 events showed highly efficient editing. The prevalence of some samples with both high and low editing levels in the plate indicates mosaicism.

[1061] ADH1 assays are an inexpensive, first-pass screening method for determining editing diversity, while DNA sequencing of ADH1 target sites is a more specific assessment. In this example, we sequenced only pollen constructs that exhibited >50% ADH1 editing, indicating little or no leaf editing by ADH1 staining assays. For those selected events in constructs 24301, 24320, 24460, 24305, and 24269, anther samples were removed from a -80°C freezer and genomic DNA was extracted. PCR amplification of ADH1 target sites was performed on each sample. The PCR amplicon was sent for next-generation sequencing. A cutoff of 1% read abundance was set for sequences considered “true”.

[1062] In this article, we present molecular analytical pathways developed and implemented internally to enable high-throughput screening and characterization of genome editing events, including high-throughput TaqMan analysis, Sanger and ICE analysis, next-generation sequencing (NGS), and genome editing analysis.

[1063] Embeddedness scoring method 1:

[1064] A three-step procedure can be used to directly measure the FMOS activity of any promoter driving nucleases and / or guide RNA to determine the "mosaic score" via mosaicism scoring method 1. This procedure can be used to calculate the mosaicism score for each T0 event or progeny plant. This scoring method can be used for any flowering plant or crop.

[1065] Step 1) Sample one or more inflorescences or inflorescence portions (i.e., anthers and carpels) of T0 four times to up to several hundred times. Create a map of the inflorescence or the whole plant, indicating the origin of different samples for tracing. The nature of this map may vary depending on the plant. In corn, we arrange it according to the male spikelet branches. In soybeans or tomatoes, flower branches or flower clusters can be used.

[1066] Step 2) Perform NGS on these samples, set a 1% cutoff value for the reads, and create a separate botanical atlas for each edit obtained.

[1067] Step 3) Calculate the mosaic score using these maps as follows: Count the first edit once, and all subsequent edits (if adjacent to samples with the same edit in the same branch / cluster) are counted only if the percentage of reads differs from the percentage of adjacent reads by >15% (reads with a percentage less than 10% can be excluded from the adjacent criteria). Sum all counted edits for all edit types (alleles) across the entire plant and divide by the number of samples. This gives the mosaic score for the plant. The mosaic score equals the number of unique edits identified per sample.

[1068] The applicant considers an embedding score greater than 0.5 to be a "functional" FMOS promoter. A score greater than 2 should be considered "good". A score greater than 5 should be considered "very good" FMOS promoters. A score greater than 10 should be considered "excellent" FMOS promoters. A score greater than 15 should be considered "elite" FMOS promoters.

[1069] The following provides an example of mosaic scores measured in maize using mosaicism scoring method 1.

[1070] High-throughput TaqMan filtering

[1071] For edit site analysis, target-specific primers were designed to be positioned flanking the intended edit region, with the target-specific probe placed at the edit site. Quantitative real-time PCR was performed for copy number analysis in high-throughput screening of genome editing events. Two copies of the target site indicated no editing, one copy indicated one allele was edited, and zero copies indicated both alleles were edited. Real-time PCR was established in 384-well plates. The reaction was repeated multiple times to simultaneously amplify the target gene and the endogenous control gene. For each sample, a TaqMan assay was set up by combining 3 μl of extracted genomic DNA with a 3 μl master mix containing Jumpstart Taq ReadyMix (Sigma) (supplemented with primers and probes, each with a final concentration of 300 nM and 100 nM respectively). Heat-seal the 384-well plate and perform real-time PCR using an ABI 7900 Real-Time PCR instrument or a Life Technologies Quant Studio Flex 7 instrument with the following parameters: 95°C for 5 minutes, 95°C for 5 seconds, and 60°C for 30 seconds for 40 cycles. Perform post-run data analysis according to the manufacturer's instructions.

[1072] For allele substitution / target insertion analysis, unique TaqMan assays can also be designed to suit specific purposes (not described in this article).

[1073] NGS (Next-Generation Sequencing) and Genome Editing Analysis Approach

[1074] GNS and genome editing analysis were used to characterize the events.

[1075] Genome editing analyses are designed to use NGS data to detect and characterize target sequence changes or allele substitutions.

[1076] The applicant performed the following analytical tasks:

[1077] • Retrieve Illumina reads from the NGS resource library

[1078] • Revise and read the passage

[1079] • Merge paired end reads

[1080] • Segment sampling (instead of using all segments)

[1081] • Compare the merged read segments with the WT reference.

[1082] • Compare the WT reference with a reference that has the desired allele substitution (allele substitution events only).

[1083] • Invoke variants in a reference with the desired allele substitution (allele substitution events only)

[1084] • Mutation between calling a single read segment and the WT reference

[1085] • The existence and location of the identification part comparison

[1086] • Identify common variations in reading segments

[1087] • Determine the mutation frequency and remove low-frequency mutations.

[1088] • Identify variant-induced frameshifts

[1089] • Assess the impact of phased insertion of missing data on the reading frame

[1090] • Identify haplotype

[1091] • Production Results Report

[1092] • Archive the results in the NGS repository

[1093] However, others may prefer other methods to evaluate their approaches.

[1094] DNA was extracted and purified using a standard 96-well plate laboratory protocol. If the sample volume is limited, such as a small number of pollen grains, the amounts of extraction and elution buffers were reduced accordingly. Target-specific primers were designed to be located flanking the target editing region. For Adh1 editing analysis, target-specific primer 1 (FE4228) for CTAACTCGTTGAGTGGCCCTG (SEQ ID NO:546) and target-specific primer 2 (FE4229) for CAGATAAGCCGCCAAGAAGG (SEQ ID NO:546) were designed. NGS universal TAG sequences were added to the designed target-specific primers.

[1095] Establish PCR reactions in 96-well plates using a high-fidelity polymerase (e.g., Q5). For each PCR reaction, add 12.5 μL of 2x Q5 hot-start high-fidelity master mix, 1.25 μL of primer 1, 1.25 μL of primer 2, 4 μL of DNA, and 6 μL of H2O, and mix. PCR amplification is run under the following conditions:

[1096]

[1097] The PCR products were checked for quality and diluted with H2O at a ratio of 1:50 or 1:100 for next-generation sequencing. In NGS library preparation, nested PCR was performed to add sample-specific barcodes and sequencing tags to each sample. Up to 384 barcoded samples were pooled together and sequenced by Miseq at 2 x 250 bp or 2 x 300 bp paired end reads.

[1098] To capture low-frequency outlier edits, the default analysis parameters were adjusted accordingly; for example, the "Number of reads analyzed" was increased to >= 1000, and the "Minimum percentage of variation" was decreased to <1%. A lower "Minimum percentage of variation" setting may result in more false-positive SNPs. To aid in the assessment of false positives, some WT samples were included in the procedure and analysis.

[1099] Adh1 target reference used in NGS analysis (SEQ ID NO:548):ctaactcgttgagtggccctgtttctcggacgtaaggcctttgctgctccacacatgtccattcgaattttaccgtgtttagcaaggg cgaaaagtttgcatcttgatgatttagcttgactatgcgattgctttcctggacccgtgcagctgcggtggcatgggaggccggcaagccactgtcg atcgaggaggtggaggtagcgcctccgcaggccatggaggtgcgcgtcaagatcctcttcacctcgctctgccacaccgacgtctacttctgggag gccaaggtatctaatcagccatcccatttgtgatctttgtcagtagatatgatacaacaactcgcggttgacttgcgccttcttggcggcttatctg

[1100] Sanger sequencing and ICE analysis approach

[1101] As an alternative to NGS, others may prefer Sanger sequencing and CRISPR Edit Inference (ICE) (developed by Synthego Inc.) for high-throughput sequencing analysis of genome editing events. Primer design, PCR, PCR product purification, and Sanger sequencing follow standard laboratory protocols.

[1102] To use this data to estimate mosaicism, it is important that we determine which edits are likely independent (e.g., occurring in different cells of the developing plant) and which are considered part of a putative clonal sector (originating from a single cell where the edit initially occurred). Better FMOS activity will be associated with the former—more independent edits (occurring later in plant development)—rather than the latter—edits detected as part of the same clonal-derived cell sector. To do this, for each edit (e.g., mutation, variant, transgenic event), the edit is mapped onto a tassel plot. This plot is referred to as the “tassel plot” for each variant. See Table 8 for good evidence of our edit assessments in practice. For this example, four-base-pair deletions (a very common overall edit) from two different events in TCGA are shown, including the locations in sample plates and 96-well plates. To understand and manage mosaic sector patterns, we convert the original sequence reads (as shown in Table 8) into tassel plots (as shown in Table 9) to facilitate proximity / neighborhood analysis.

[1103] Table 8

[1104]

[1105] Table 8 shows the sequence information for two events: 182: missing TCGA.

[1106] Table 9

[1107]

[1108] Table 9. Male spike plot for allele (or edit) "deleted TCGA": Cells represent the location of spikelet samples on male spikes containing the edit, and the percentage of all NGS reads of those samples for both events.

[1109] Table 9 shows the spikelet plots, containing the same information as in Table 8. Edits 182: deletion of TCGA for both events were found at multiple locations across different parts of the spikelet, including the central spike and lateral branches. The percentage in each cell represents the fraction of reads containing that sequence and corresponds to one well in a 96-well plate. Each well represents a different spikelet. Each well also has other distinct edits, which appear in other spikelet plots not shown in this paper. This mutation occurs at different locations on the spikelet, but some adjacent portions of the central spike from both events may show sectors from the same single edit event in the early stages of plant or spikelet development. To standardize the process for all events and constructs, and thus to be able to compare which constructs serve as optimal FMOS promoters, we set the following rules: Examining the spikelet plots, starting from the bottom of each spikelet, the first mutation is always considered a unique mutation. Moving upwards from the first mutation, other mutations are only counted if their abundance is less than 10% or if their abundance differs from the previous spikelet by more than 15%. In other words, the first edit found in a given column (in the tassel plot, the column represents the tassel branch or central spike) is counted; subsequent edits are also counted unless the same edit is represented in the previous cell, where the percentage of representation in the NGS data between the two samples is within + / - 15% (this is based on the idea that such edits with similar abundance are more likely to be part of a contiguous sector). Edits with <10% representation are excluded from the 15% rule because their rarity indicates they are not part of a contiguous sector. Using this rule, edits shown in bold italics in Table 9 cannot be considered independent of previous edits and are therefore not counted. For this sequence mutation in Table 9, seven independent edits were identified for MSKE181002A045A and 17 independent edits for MZKE181002A151A.

[1110] For each event, the total number of independent edits (all edits) was calculated, and the result was divided by the total number of samples assessed by NGS (typically 12 samples for the central spike plus 6 samples for each lateral branch, but the total number varies for different events). This calculation provides us with the mean of independent edits for each sampled spikelet, and this mean is considered the “mosaic score.” For constitutive promoter CMP, when only one (homozygous) or two (biallelic) edits were detected throughout the tassel, the mosaic score for events sampled 24 to 48 times would be in the range of 0.021–0.083. Regarding FMOS promoters, first-pass analysis revealed several events that showed no edits in pollen ADH1 assays and few or no edits in NGS data—these are likely events where transgene expression was almost completely silenced—and gave extremely low mosaic scores (0.0–0.1). After removing these events (MZKE181800A021A, MZKE181800A056A, MZKE181800A074A, MZKE182000A005A, MZKE182000A029A, MZKE182000A031A) from the analysis, the mosaicism scores of the five FMOS promoters evaluated by NGS ranged from 1.24 (prZmAgo18A-01, construct #24269) to 11.79 (prZmBde1-02, construct #24230). Therefore, through this conservative analysis, the mosaicism of these FMOS promoters shows a value approximately 15 times (1.24 / 0.083) to 561 times (11.79 / 0.021) higher than that achievable by commonly used promoters. Given that not all male and female spikes were sampled for NGS, this is certainly an underestimation. Similarly, floral mosaicism in this paper is defined as the number or frequency of distinct (diverse) edits in the reproductive cells of an event: these higher mosaicism scores clearly indicate a high degree of diversity in the edits within the male spike, and therefore higher FMOS promoter activity. Likewise, the mosaicism score represents the average number of distinct edits detected in the spikelet sample.

[1111] Figure 26b The mosaicism score for each of the five constructs we evaluated using NGS data is shown. Table 10 shows the mosaicism scores for events from an exemplary FMOS promoter based on NGS data.

[1112] Table 10

[1113]

[1114]

[1115] FMOS activity was further confirmed by sequencing of T1 progeny seeds: up to 100 seeds germinated from each of the five events in constructs 24301, 24320, 24269, and 24460. Taqman spectroscopy revealed the zygosity of the target site in ADH1. (Table 11)

[1116] Table 11

[1117]

[1118] Table 9b. Summary of Taqman scores for T1 descendants (from five event pools) of the four FMOS constructs. A Taqman score of 0 indicates that both copies were edited; a score of 1 indicates heterogeneity; and a score of 2 indicates "WT / WT" or no editing.

[1119] The total number of edited alleles in the offspring was calculated by adding the number of offspring with one copy of the edited ADH1 to 2* (the number of offspring with two copies of the edited ADH1). The predicted number of edits from the male side was then subtracted (this was determined by multiplying the paternal edit rate [from Table 4] by the number of sampled offspring plants); and the difference between the total number of edited alleles and the predicted paternal edit rate for each construct was then divided by the total number of offspring to provide a proxy for the maternal edit rate.

[1120] Using this method, maternal editing rates were found to be 61%, 73%, 62%, and 61% for 24301, 24320, 24269, and 24460, respectively. Other instances may have different editing rates, such as at least 50%, at least 55%, at least 60%, at least 70%, and at least 80%. Therefore, the prZmBde1-02 promoter in construct 24320 was most efficient in editing female cells (in the female ear), although prOsAP1-01 (24460) was best in editing male cells (85% male cell editing rate in the male ear). To understand the diversity of editing found in offspring, DNA was extracted from offspring with one or two edited ADH1 alleles. The PCR products at the target site were sequenced. In most cases, a double peak was observed starting from the target site. To clarify the Sanger sequencing results, the two alleles were distinguished using the CRISPR Edit Inference (ICE) program (Sanger Inc.).

[1121] Tables 12 and 13 illustrate the T0 pollen ADH1 staining and sequencing results from 50 T1 progeny individuals of vector 24269, event number MZKE181002A135A. No editing was observed in the leaves for this event, and ADH1 staining appeared to indicate good FMOS activity. We did not perform NGS sequencing but examined the T1 progeny; most individuals were biallelic, possessing two distinct edits inherited from both maternal (egg cell) and paternal (pollen grain / sperm cell) flowers. In some cases, no edits were found, or the inherited edits were identical, but this is the exception rather than the rule. This is just one example of the hundreds of similar results obtained from this promoter and other tested FMOS regulatory systems.

[1122] Table 12. Pollen ADH1 staining data for event MZKE181002A135A (constructor 24269)

[1123]

[1124] Table 13

[1125]

[1126]

[1127]

[1128]

[1129]

[1130]

[1131]

[1132]

[1133]

[1134]

[1135]

[1136]

[1137] S = Sample #

[1138] Table 14 illustrates the sequencing results of T1 progeny from vector 24301, event numbers MZKE18100A050A, MZKE18100A063A, MZKE18100A064A, MZKE18100A078A, and MZKE18100A084A. Most individuals were biallelic, possessing two distinct edits inherited from both the maternal (egg cell) and paternal (pollen grain / sperm cell) flowers. In a few cases, no identical edits were found or the inherited edits were not identified.

[1139] Table 14

[1140]

[1141]

[1142]

[1143]

[1144]

[1145]

[1146]

[1147]

[1148]

[1149]

[1150]

[1151]

[1152]

[1153]

[1154]

[1155]

[1156]

[1157]

[1158]

[1159]

[1160]

[1161] S# = Sample#

[1162] Table 15 illustrates the sequencing results of T1 progeny from vector 24320, event numbers MZKE18200A019A, MZKE18200A028A, MZKE18200A045A, MZKE18200A057A, and MZKE18200A064A. Most individuals were biallelic, possessing two distinct edits inherited from both maternal (egg cell) and paternal (pollen grain / sperm cell) flowers. In some cases, no edits were found, or the inherited edits were identical.

[1163] Table 15

[1164]

[1165]

[1166]

[1167]

[1168]

[1169]

[1170]

[1171]

[1172]

[1173]

[1174]

[1175]

[1176]

[1177]

[1178]

[1179]

[1180]

[1181]

[1182]

[1183] S# = Sample#

[1184] Table 16 summarizes the sequencing results of T1 progeny from vector 24460, event numbers MZKE184306A030A, MZKE184306A047A, MZKE184306A060A, MZKE184306A062A, and MZKE184306A104A. Most individuals were biallelic, possessing two distinct edits inherited from both maternal (egg cell) and paternal (pollen grain / sperm cell) flowers. In some cases, no edits were found, or the inherited edits were identical. Information from the E1 progeny was used to calculate the frequency of maternal edits.

[1185] Table 16

[1186]

[1187]

[1188]

[1189]

[1190]

[1191]

[1192] The total number of different edits produced in the offspring was identified, for example, at least one nucleotide difference. These four data types were combined, including leaf editing rate, ADH1 staining data, and pollen mosaicism score, and used to assess the FMOS regulatory system and understand the temporal and tissue specificity of FMOS constructs.

[1193] Of the 24 FMOS constructs tested, five appeared to be highly efficient based on pollen NGS data. Therefore, we examined some events of these five via NGS and evaluated T1 progeny. Based on pollen NGS and mosaicism score analysis, we identified three of these five as very high-quality FMOS constructs: 24320 (prZmBde1-02), 24301 (prZmAP1-01), and 24460 (prOsAP1-01). In T0 leaf samples, these constructs gave low or zero editing in most events and exhibited highly diverse editing in tassels and progeny – resulting in an average floral mosaicism score above 3 for most events (based on mosaicism scores, calculated since each tassel has at least 100 spikelets and each spikelet will undergo at least 3 editing events, predicting over 300 different editing events throughout the tassel). The CMP constitutive promoter (construct 24224) showed 100% editing in the leaves. These events also revealed near 100% editing in the tassels via ADH1 staining. No edited sequences were analyzed in different tassel samples. For several other constructs, while there was little or no evidence of editing in the leaves, the editing efficiency in the tassels was also quite low via ADH1 staining. This could be because the promoter is not very strong in the natural state, or it is strong in the natural state but not very specific to the germinal tissues that produce pollen. Perhaps the necessary cis or trans-enhancer sequences were not captured in regions targeting promoter and / or terminator selection.

[1194] One cassette in vector 24320 uses prZmBde1-v2, a highly expressed flower-specific promoter extracted from the natural corn BEARDED EAR1 gene IDZm00001d017614, as the FMOS promoter. Cas9 in the construct is driven by the natural ZmBde1 promoter sequence from B73v5 for specific expression in early inflorescence meristems (from in situ hybridization data by Thompson et al., 2009). The sequence used includes the promoter, first exon, first intron, and a partial second exon. This is a total of 5741 bp of regulatory sequences, including a 2000 bp upstream promoter sequence + 209 bp 5'UTR, a 182 bp first exon, a large first intron (3332 bp), and a partial 15 bp second exon ending with a 3 bp start codon. Two bp changes were used to remove the ATG start codon in the exon and a BbsI site for cloning, which did not disrupt any motifs at transcription factor binding sites, as determined by Nsite. The terminator sequence following Cas9 also comes from the natural ZmBde1 terminator, consisting of 828 bp downstream of the stop codon, including a 324 bp 3′ untranslated region. Zero of the fourteen events containing this construct showed any editing in the leaves. While three events showed minimal editing in the tassel, ten events showed efficient editing of the ADH1 gene in the pollen, and large editing diversity was observed in the NGS data of these events (mosaic score = 11.79). Extensive editing diversity was also inherited in T1 seeds (maternal editing score = 73%). Versions of this promoter lacking the first intron were used to express Cas9 with tNOS (construct 24265) or the natural ZmBde1 terminator (construct 24266), but neither combination showed efficient editing as determined by ADH1 staining. Therefore, for this construct, the expression of the flower is improved when the first intron is included as part of the promoter.

[1195] Another FMOS cassette in vector 24301 contained prZmAP1-v1, a highly expressed flower-specific promoter extracted from the natural corn APETALA1 gene (ID Zm00001d007949). The promoter sequence is 2846 bp, consisting of a 520 bp upstream sequence + 220 bp 5' UTR, a 185 bp first exon, a large intron (2846 bp), and a 15 bp second exon ending with a 3 bp start codon. The terminator tZmAP1-v1 is a 953 bp regulatory sequence, consisting of a 324 bp 3' UTR and a 629 bp downstream sequence. Eleven of the fourteen events showed no editing in leaves (two seedling leaf samples were tested), while the other three events showed only very low percentages of editing. In ADH1 staining, eleven plants showed very high levels of editing. The mosaic score of the male spike, based on sequencing of PCR products from the ADH1 target site in 48 anther samples, was 4.16, indicating high diversity of editing in the T0 male spike. The maternal editing score was 61%. The T1 progeny exhibited different editing. Another embodiment may include the rice version of this promoter tested, derived from the OsAPETALA1 gene (Os07t01089000-02), construct 24660. This promoter also performed well in leaf sampling and ADH1 pollen staining assays. We examined four events by NGS, and the different editing found in the data resulted in a mosaic score of 5.86. The T1 progeny also showed a wide variety of editing results.

[1196] Another FMOS cassette in vector 24460 contains prOsAP1-v1, a highly expressed flower-specific promoter extracted from the natural rice APETALA1 gene (IDOs07g01820 or Os07t01089000-02). The promoter sequence contains a 2000 bp upstream sequence + 124 bp 5' UTR, a 185 bp first exon (with the ATG at the 5' end changed to AAG to ensure translation does not start prematurely), followed by a first intron (2416 bp), and a 15 bp second exon ending with a 3 bp start codon. The terminator tZmAP1-v1 is a 1000 bp regulatory sequence comprising a 361 bp 3' UTR and a 629 bp downstream sequence. Fifteen of the fifteen events showed no editing in leaves (two seedling leaf samples were tested), while thirteen events showed very high levels of editing in ADH1 staining. The male inflorescence mosaicism score, based on sequencing of ADH1 target site PCR products from up to 48 anther samples per event, was 6.01, indicating high diversity of editing in T0 male inflorescences. The maternal editing score was 61%. T1 progeny exhibited distinct editing – we found that the diversity in T1 matched that seen in other highly functional FMOS constructs 24320 and 24301 (both with events producing more than 20 different mutant alleles in their T1 progeny); similarly, 24460 had events producing more than 20 different mutant alleles in its T1 progeny.

[1197] Another FMOS construct, 24269, contains prZmAGO18A-v1, a highly expressed germinal cell-specific promoter extracted from the maize ARGONAUTE18A gene (ID Zm00001d006351). Cas9 in the construct is driven by the natural ZmAGO18A promoter sequence, comprising a 1,225 bp upstream sequence, a first exon containing a complete 5' UTR, and 755 bp introns up to the first 15 bp of exon 2. The terminator consists of a 1,116 bp sequence downstream of the stop codon, including the 3' UTR stop codon (including the 3' UTR). Thirteen of the fifteen events showed no editing in leaves, while these thirteen events also showed effective editing and moderate mosaicism in pollen ADH1 staining. T1 seed data indicated high diversity of inherited editing in offspring (62% of edits were maternally derived). However, many edits in offspring were not. The fact that so many offspring carry the same edited sequence leads to the hypothesis that the editing occurs in certain events early in meristem development—so much so that most T0 events carry the same edit. Indeed, this hypothesis is supported by NGS analysis—using our novel mosaicism scoring method to analyze NGS data, we found a mosaicism score significantly lower than other FMOS promoters—only 1.24. While this is still at least 14-fold higher than pervasive or constitutive promoters, it is 3 to 10-fold lower than other FMOS promoters. These analyses confirm both the robustness of our assay pathway and the ability of the mosaicism scoring process to precisely elucidate how certain FMOS promoters perform relative to others.

[1198] Finally, to confirm the enrichment of flower tissue expression and reveal the flower development stage in which these promoters drive high expression of editing enzymes, we performed qRT-PCR on T1 plants carrying a copy of the FMOS promoter editing construct. We tested three events from constructor 24320 (prZmBde1-02: events MZKE182000A057A, MZKE182000A064A, and MZKE182000A028A), three events from constructor 24301 (prZmAP1-01: events MZKE181800A050A, MZKE181800A033A, and MZKE181800A073A), and three events from constructor 24269 (prZmAGO18A-01: events MZKE181002A088A, MZKE181002A080A, and MZKE181002A121A). We tested the expression of a constitutively promoter-controlled PMI selective marker (phosphomannose isomerase). Figure 41 ) and the expression of Cas9 controlled by the FMOS promoter ( Figure 42The qRT assay used positive control gene elongation factor 1α to normalize for all sample types. We collected samples from juvenile (<3cm) tassels before flower formation, anthers (<1mm) before meiosis, juvenile (<3cm) female primordia, and unfertilized R1 stage kernels.

[1199] like Figure 41 As shown, the expression of the selective biomarker gene PMI was demonstrated by qRT-PCR. PMI gene expression was observed in all events across all constructs. Although levels varied across different floral tissues (most abundant in anthers), levels were fairly equivalent between events and constructs. Figure 42 As shown, the expression of the nuclease Cas9 was demonstrated by qRT-PCR. The Cas9 gene was expressed in all events across all constructs, although for 24269, expression was considerably low across all tissue types. This is likely because construct 24269 uses prZmAGO18a, which is specific to germinal cells (premeiotic cells), which are very rare compared to all somatic cells in these tissues. Therefore, the Cas9 signal can be diluted by extracting total RNA from the entire inflorescence. In contrast, Cas9 using prZmBde1-02 (24320) and ZmAP1-01 (24301) showed high expression in floral tissues (including male and female (tassels, anthers, spikes, and grains). It was fairly equivalent across different events of the construct. Example 5: Maintaining FMOS promoter efficacy under promoter modification.

[1200] As taught by the applicant, FMOS promoters can be readily modified while still retaining FMOS activity, as illustrated in Examples 1-4 above. For instance, prZmBde1 was modified to remove domains lacking a significant flower transcription factor binding motif and not located upstream or downstream of the transcription or translation initiation site. To test whether these domains were non-essential for FMOS activity, we removed them, reconstructed the construct, and retested them using the same methods described in Examples 2 and 3. For example, we constructed promoter prZmBde1-03 (SEQ ID NO: 615) by removing 1,696 bp from the intron (iZmBde1-01) within prZmBde1-02 (SEQ ID NO: 538) in construct 25002. We generated ten events, and 8 out of 10 events showed no editing in the leaf (Taqman assay of 2, meaning both copies of ADH1 were unedited). Of these eight events, seven showed predominantly negative ADH1 pollen assays in most spikelet samples (indicating a good degree of editing) (Table 17). Of these seven events, we performed NGS on three (GVG01189795, GVG01189803, and GVG01192964) and found a mean mosaicism score of 11.72.

[1201] Table 17. Leaf determination and pollen ADH1 staining scores for ten events from construct 25002. Truncation of the ZmBde1-02 promoter, in which a large portion of the introns were removed.

[1202]

[1203]

[1204] We germinated 100 self-pollinating T1 progeny from three events (GVG01189795, GVG01189803, and GVG01192964) and performed PCR sequencing on a subset of target sites. We discovered dozens of different edits and a wide variety of editing outcomes from both male and female T1 inflorescences. As illustrated in Table 18 below (from event GVG01189803), we found that different individuals typically contained multiple edits in 50% of reads: in other words, T1 plants are often biallelic, receiving two different edits—one from the male gametophyte (pollen-derived or spike-derived) and the other from the female gametophyte (egg-derived or spike-derived). In some cases, the edits received from both males and females were identical in these T1 progeny.

[1205] Table 18. T1 editing results in promoter 25002, event GVG1189803.

[1206]

[1207]

[1208]

[1209]

[1210]

[1211]

[1212]

[1213]

[1214]

[1215]

[1216]

[1217]

[1218]

[1219]

[1220] For construct 25002, the T0 tassel mosaicism score and T1 diversity are essentially equivalent to the untruncation promoter in Example 4. Therefore, prZmBde1-02 and prZmBde1-03 (40% shorter) are roughly equivalent to the FMOS promoter.

[1221] Interestingly, when we truncated the ZmBde1-02 promoter in a slightly different way, we obtained another effective FMOS promoter in construct 25003 (SEQ ID NO:539). In construct 25003, we included the promoter prZmBde1-04 (SEQ ID NO:616), which removed 2,337 bp from the intron (iZmBde1-01) within prZmBde1-02. In terms of total length, this promoter is less than 60% of the length of ZmBde1-02 (the similarity will be less than 60% due to the large gap in intron 2 removed in the truncated promoter prZmBde1-04). Despite this large missing segment, we found that 12 out of 12 events were not edited in the leaves (maintaining specificity), and in most spikelet samples, 7 events were predominantly negative by ADH1 pollen assays (indicating good editing in the tassel) (Table 14), while 5 out of 12 events did not show good editing in the tassel by ADH1 assays.

[1222] Table 19 shows leaf assays and pollen ADH1 staining scores for 10 events from construct 25003, which contains prZmBde1-04, a truncated form of the ZmBde1-02 promoter in which a large portion of the introns are removed, and the removed portion constitutes more than 40% of the total prZmBde1-02 regulatory sequence.

[1223] Table 19

[1224]

[1225]

[1226] Using ADH1 staining, we performed NGS on four of the seven events with strong editing in the tassel (GVG01191002, GVG01191008, GVG01191010, and GVG01191012) and found mosaicism. We germinated 100 self-pollinating T1 progeny from three events (GVG01191002, GVG01191010, and GVG01191012) and performed PCR sequencing on a subset of target sites. We identified more than 20 different edits in the self-pollinating progeny of these events. As illustrated in Table 20 below for event GVG01191002, we identified nine different alleles in only 15 progeny by PCR-seq. In most cases, the edits found were different (biallelic T1), although in some cases they were identical (homozygous T1 progeny).

[1227] Table 20 summarizes the T1 PCR sequencing data of construct 25003 event GVG01191002, showing the ADH1 target site editing in 15 progeny.

[1228] Table 20

[1229]

[1230]

[1231] In yet another instance, we removed 300 bp from the very beginning of the promoter prZmBde1-02 and 1,696 bp from the first intron to obtain prZmBde1-07 (SEQ ID NO: 619) in construct 25006 (SEQ ID NO: 542). Seventeen events were generated, and none showed evidence of leaf editing. However, by ADH1 staining of the male spike, 15 / 17 events showed at least moderate levels of editing (Table 21), and based on ADH1 staining, 5 / 17 events showed high levels of editing. Events GVG01195902, GVG01195903, GVG01195904, GVG01195891, and GVG01195894 had an average staining rate of 14%. Assuming a small percentage of unstained pollen is dead (as can be seen from the approximately 10% unstained negative control [WT pollen]), then approximately 75%–85% of the pollen was edited. NGS was performed on the corresponding male spike samples from events GVG01195902, GVG01195904, and GVG01195894, and these samples produced a mean mosaic score of 11.88.

[1232] Table 21 shows the leaf determination and pollen ADH1 staining scores for ten events from construct 25006, which is a truncated form of the ZmBde1-02 promoter, in which a large portion of the introns are removed and the first 300 bp of the 5′ end of the promoter are also removed.

[1233] Table 21

[1234]

[1235]

[1236]

[1237] One hundred T1 self-pollinated progeny from events GVG01195902, GVG01195904, and GVG01195894 were germinated, and the gRNA target sites of a subset were sequenced by PCR. We identified more than 20 different edits in the self-pollinated progeny from these events. In most cases, the edits found were distinct (biallelic T1), although in some cases they were identical (homozygous T1 progeny).

[1238] Comparing these modified promoter results with construct 24320 (prZmBde1-02), we found that T0 leaf editing, pollen staining, NGS diversity, E1 diversity, and mosaicism score did not affect FMOS activity through all measures. A minor exception was the decrease in FMOS activity we did see in construct 25003, which removed an 8 bp sequence corresponding to the putative transcription factor binding motif of rice transcription factor Leafless1 (LFL1). Interestingly, considering all Bde1 promoter explorations, it becomes clear that even the entire intron is not necessary—in fact, a large portion of the intron can be removed, and the promoter still functions as an FMOS promoter. Furthermore, at least the first 300 bp of the promoter we initially captured in prZmBde1-02 is not required. A large portion of the intron, 2,337 bp (prZmBde1-04), can be removed, and still good FMOS activity is obtained, although the mosaicism score does decrease by a few points, likely due to the absence of the OsLFL1 site. Figure 38 An overview of the truncated promoters is provided. Overall, 25002 achieved an average score of 11.7 (compared to 11.8 for 25320); 25003 scored 9.1; and 25006 scored 11.9. Constructs 25004 and 25005 performed poorly in terms of conversion or editing frequency.

[1239] As can be seen, the FMOS promoters developed using Examples 1-5 can be easily modified in various ways while still retaining FMOS promoter efficacy. Furthermore, the methods disclosed herein can be readily used to determine whether modifications to the FMOS promoters identified using Examples 1-5 negatively impact FMOS activity. For example, in construct 24460, the rice AP1 regulatory sequence performed well as an FMOS promoter; however, in prOsAP1-02 (construction 25007), a large portion of the intron was removed; in prOsAP1-03 (construction 25008), a large portion of the promoter was removed; and in prOsAP1-04, both portions were removed (from the intron and the promoter). In all three constructs, FMOS activity was reduced because some events showed editing in the leaves (ADH1 leaves had TaqMan scores of 0 or 1). However, further characterization through ADH1 pollen staining, NGS analysis of tassel and spikelet samples, and T1 progeny analysis revealed that FMOS activity was significantly preserved in some cases where the leaf Taqman score was 0. For example, in construct 25007, leaf Taqman scores were 0 or slightly above 0 in 12 out of 13 events, indicating some editing in the leaves. We hypothesized that this meant the bud meristem had also been edited, and therefore the tassels and spikelets would not be mosaic. However, if we look at the pollen staining data, we see that some samples retained ADH1 activity—exemplifying FMOS activity—rather than what we typically see in constitutive promoter cases (Table 22).

[1240] Table 22 shows the pollen ADH1 staining assay data. The percentages shown in the wells of these plates represent the proportion of sampled pollen that was ADH1+.

[1241] Table 22

[1242]

[1243]

[1244] In addition, we examined the T1 data from event GVG01195930, which scored 0 in the T0 leaf Taqman, and found extensive and diverse editing in the major biallelic progeny summarized in Table 23 below.

[1245] Table 23

[1246]

[1247]

[1248] Similarly, construct 25008, event GVG01195946, yielded pollen NGS data with a mosaicism score of 4.97 and T1 data showing very broad diversity of edits (Table 24). Table 24 summarizes the diversity of E1 edits from event GVG01195946, which is a truncated form of prOsAP1, namely prOsAP1-03, which removes approximately 1kb from the promoter.

[1249] Table 24

[1250]

[1251]

[1252] Similarly, construct 25009 (SEQ ID NO: 545) of the modified form of prOsAP1 (SEQ ID NO: 622) removed more than 52% of the promoter (a total of 2.4 kB was removed from the 4.6 kB promoter), and all four events produced good editing diversity, with NGS data showing a large number of edits / samples. For a small example of NGS data, see Table 25; the mosaicism score for this event GVG01195812 is 5.92. For GVG01195906, the score is 6.38, and for GVG01195915, the score is 5.63. Table 25 summarizes the NGS data for event GVG01195812, which shows some edits in the leaves but still retains FMOS activity, as demonstrated in the table, where a wide variety of edits were found in the tassels; at least 5 or 6 edits were found in each pollen sample. The mosaicism score for this event is 5.92.

[1253] Table 25

[1254]

[1255]

[1256]

[1257]

[1258]

[1259]

[1260]

[1261] In summary, the truncated promoter prOsAP1-01 maintained FMOS activity. Figure 39The truncated promoter prOsAP1 is shown in the following constructs: in construct 25007 (average mosaicism score of 4.9); in construct 25008 (average mosaicism score of 4.9); and in construct 25009 (average mosaicism score of 6.0). These are all good performances compared to the baseline (6.0) of construct 24460.

[1262] In another example, prZmAP1-01 (SEQ ID NO:2) was modified to remove domains lacking a significant floral transcription factor binding motif and located in the promoter. To test whether these domains were non-essential for FMOS activity, we removed them, then reconstructed the construct and retested them using the exact same methods described in Examples 2 and 3. For example, we constructed the promoter prZmAP1-03 (SEQ ID NO:614) by removing 1,746 bp (46%) from the prZmAP1-01 promoter (SEQ ID NO:537) of construct 24997. We generated 11 events, of which 8 scored "2" in leaf Taqman assays (i.e., they were not edited), and 5 of these events appeared unedited at the tassel stage (see Table 26 below), while 3 of these events appeared to have FMOS activity, as assessed by ADH1 pollen. Furthermore, one event had a leaf Taqman score of "0" and pollen ADH1 staining that appeared to be constitutive promoter (all samples were "0"). Both events scored "1" in the leaf test.

[1263] Table 26 shows ADH1 staining data for 11 events from construct 24997 (truncated prZmAP1). The score represents the proportion of pollen grains that were ADH1 positive in each sample.

[1264] Table 26

[1265]

[1266]

[1267] By ADH1 pollen staining, three events, GVG01189786, GVG01189784, and GVG01189781, scored "2" and exhibited good FMOS epigenetic activity. The latter two were sent for NGS analysis of tassels and spikelets and T1 progeny analysis. Additionally, NGS analysis of tassels and spikelets was performed on event GVG01189790, which scored "1" (heterozygous) and showed FMOS activity through ADH1 staining. The mosaicism scores of the three events were similar, but GVG01189790 had the lowest score (4.33), followed by the events with better FMOS indicators at the T0 stage (GVG01189781 at 4.75 and GVG01189784 at 5.58). In the T1 analysis, numerous different edits were observed in the progeny of each of these two events. Values ​​similar to those seen for the original prZmAP1-01 were present.

[1268] Compare the mosaicism score of the original promoter with its truncated form. Figure 26c As you can see, there is no change in the score between prZmAP1-01 (constructor 24301) and the truncated prZmAP1-03 (constructor 24997); there is no change in the score between prZmBde1-02 and prZmBde1-03 and prZmBde1-07 (25002 and 25006 respectively), while the score of prZmBde1-04 (25003) has decreased slightly; the score between prOsAP1-01 (24460) and prOsAP1-02, prOsAP1-03 and prOsAP1-04 (25007, 25008 and 25009 respectively) has not changed much, except that 25008 has decreased slightly.

[1269] We also recalculated the mosaicism score using a different formula (Mosaic Method 2) to re-examine the results of the NGS datasets for all constructs. As mentioned earlier, we used a spike plot for each allele type (or edit type). Starting from the bottom of each spike, the first mutation was always considered a unique mutation. Moving upwards from the first mutation, other mutations were only counted if their abundance differed from the previous spikelet sample by more than 15%. Mutations with an abundance <10% also followed this rule (previously, they were excluded from this rule; see Example 4). For each event, the total number of unique edits (across all edits) was calculated, and the resulting value was divided by the total number of samples evaluated by NGS. Therefore, this 'mosaicism score' represents the average of the unique edits for each spikelet sample. The mosaicism score for each event was calculated. Figure 26dThe mosaicism scores using mosaicism method 2 (which is more conservative and may underestimate actual editorial diversity) are shown – the overall trend is the same as before. Table 26d shows the mosaicism scores using mosaicism method 2, which subjects editors with <10% abundance to a <15% adjacency rule (see above and Example 4 for explanation). Unless otherwise specifically indicated, all mosaicism scores in the claims are calculated using mosaicism method 1.

[1270] The following provides a detailed description of exemplary carrier constructs that include expression boxes according to various embodiments of the present invention.

[1271]

[1272]

[1273]

[1274]

[1275]

[1276]

[1277]

[1278]

[1279]

[1280]

[1281]

[1282]

[1283]

[1284]

[1285]

[1286]

[1287] The following section summarizes truncated promoters and introns.

[1288]

[1289]

[1290]

[1291] Example 6: Effective allelic substitution (homology-directed repair) of Cas9 driven by the FMOS promoter

[1292] Embodiments of the present invention can also be used for allelic substitution, including improving the efficiency of allelic substitution. Five constructs suitable for allelic substitution are described below. All five designs use the same donor DNA and guide RNA sequence targeting the herbicide-resistant acetyllactate synthase (ALS) gene GRMZM2G143008 on chromosome 5. The donor DNA contains approximately 1000 bp of sequence highly homologous to the endogenous corn gene. Near the center of the donor sequence are several SNPs that differ between the donor and endogenous sequences, including an SNP that induces the change of amino acid 568 in the ALS coding sequence from tryptophan to leucine. This well-known mutation confers resistance to broad-spectrum common herbicides. Therefore, the use of the ALS target provides a dominant genetic trait for successful editing (allelic substitution). Several events can be performed on each of the following six construct designs, and the T1 progeny can be sprayed with imazapyr herbicide (312 ml / ha Pursuit). Plants that survived herbicide treatment were sampled, and putative allele substitution alleles were amplified and sequenced.

[1293] The first design uses the FMOS promoter to drive Cas9 expression, providing a guide RNA driven by the rice U3 promoter and a copy of the DNA donor for homology-driven repair in the T-DNA vector. Alternatively, a guide RNA target site flanking the DNA donor in the T-DNA can be included, allowing the donor to be released from the T-DNA insertion site and used as a repair template for homology-directed repair at the target site (e.g., in the ALS gene). Vector construct 25123 (SEQ ID NO: 88) is an example.

[1294] The second, third, and fourth designs use two different FMOS promoters: one drives Cas9 expression (preferably active before or during meiosis in one or both of the male and female reproductive organs (anthers and carpels); the other drives the expression of splice mRNA that produces the trans-acting replication factors Rep and RepA from the genus Mastrevirus. In this example, we use the wheat dwarf virus Rep / RepA coding sequence (see design below). Rep / RepA induces rolling circle amplification of donor DNA located between the long intergenic region (LIR) and short intergenic region (SIR) of the same virus, where migration protein genes and capsid protein genes are typically found. We place a ZsGreen sequence between the LIR and SIR, which is typically the location of the Rep / RepA genes. The exact locations of ZsGreen and the DNA donor may differ; for example, their positions may be interchanged.

[1295] Rep / RepA expression can be driven by constitutive promoters, but more typically by FMOS promoters. This can be useful because, in some cases, sustained induction of RepA expression is associated with negative effects on overall plant fitness, health, and seed production. In many instances, Rep / RepA is expressed during a very short time window in the germinal cell lineage and then turned off just as Cas9, Cas12a, or other targeted nuclease expression begins (using a second FMOS promoter). This design restricts Rep / RepA expression to a short time window (preventing toxicity to the plant) but allows sufficient time for DNA donor amplification before nuclease expression begins. In many instances, Rep / RepA is expressed approximately one or two days, or even just a few hours, before the nuclease (Cas9) is edited. In the design described below, the early anther primordium-specific FMOS promoter prZmAGO18A (which exhibits low or moderate expression, particularly in germinal cells of anthers and ovules) is used to drive Rep / RepA gene expression. Expression of the Cas9 nuclease is controlled by the regulatory region of the prZmBde1-02 promoter, which is active during flower specialization, pre-meiosis, and meiosis. The construct also contains the DNA donor sequence we intend to use for allelic substitution, which includes homologous arms with high sequence similarity to the cleavage site in the natural target locus, as well as LIR, ZsGreen, and SIR sequences within the same loop. The action of the RepA protein will lead to amplification via rolling circle amplification, resulting in a large number of single-stranded DNA donor molecules, which may become double-stranded due to the activity of the host DNA polymerase. When double-stranded, the loop can be cleaved by Cas9 and the guide RNA (see vector AR-SDN2_REP_NoCut). Figure 33 (AR-SDN2_REP_NoCut(SEQ ID NO:186). Optional one or more guide RNA target sites may also be located flanking the donor sequence, such as in the vector AR-SDN2_REP_2Cuts( Figure 32 (SEQ ID NO:#187) and vector AR-SDN2_REP_1cut( Figure 31 In (SEQ ID NO:188) - these sites can be cleaved by nucleases, linearized, and / or release a circular donor, which can make them suitable for participation in recombination (homology-directed repair) after Cas9 cleavage of the target site. A feature map of SEQ ID#XYZ (AR-SDN2_REP_CUT) is shown below. In some embodiments, it is also desirable to express the promoter driving RepA at less than 50% of the promoter driving CRISPR. For example, in embodiments where phytotoxicity is observed or where an increased event occurrence rate is desired, it may be desirable to reduce RepA expression.

[1296] In another example, the MSCA1 (MS22) promoter (prZmMSCA1-01) (SEQ ID NO:717) (GRMZM2G442791) and terminator 1ZmMSCA1-01 (SEQ ID NO:718), which drive expression during a very short window of flower development, were used to express Rep / RepA. This expression was quickly shut off because this gene is only responsible for the specialization of germ cells in anthers and ovules. Several hours later, the prZmAGO18A FMOS promoter turned on Cas9 expression in newly differentiated germinal cells in anthers and ovules during the pre-meiotic stage. In other designs, the FMOS promoter prOsMEL1 (SEQ ID NO:41 or 42) and terminator tOsMEL1 (SEQ ID NO:44 or 45) were used to drive the expression of targeted nucleases. In another design, a hypothetical FMOS promoter and terminator with high expression from the following genes: protein phosphoglycan 4 (ppg4) (GRMZM2G032528) with prZmPPG4-01 (SEQ ID NO:719) and tZmPPG4-01 (SEQ ID NO:720); NADH dehydrogenase (GRMZM2G158188) with a promoter (SEQ ID NO:721) and a terminator (SEQ ID NO:722); or CID11 (GRMZM2G173428) with a promoter prZmCID11 (SEQ ID NO:723) and a terminator tZmCID11 (SEQ ID NO:724) can be used to drive the expression of nucleases (highly expressed, highly enriched germinal cell genes). In yet another design, many flower and germinal cell-specific genes were identified from the following article on the initial germinal cell population in flowers (Kelliher and Walbot (2014) Germinal Cell Initials Accommodate Hypoxia and Precociously Express Meiotic Genes, Plant Journal 77(4)639-652.), and from this source, two highly specific genes were selected: ideally, low or moderately expressed genes that could drive the expression of Rep / RepA, which becomes active slightly earlier in development than the second promoter, which is expressed at a higher level and used to express nucleases.

[1297] Figure 27One embodiment is illustrated, involving the use of a guide RNA target site flanking the donor sequence preceding the LIR and SIR. Sequential activation of RepA and Cas9 in the flower triggers high-copy donor DNA, which can be used for allelic substitution at the target site via homologous recombination. In this case, the target site is shown in the ALS target gene (GRMZM2G143008 on chromosome 5). This version has a gRNA cleavage site that linearizes the amplified DNA donor replicon.

[1298] Figure 28 Another embodiment is described, which is similar to Figure 27 This embodiment includes two guide RNA target sites in the replicon located flanking the DNA donor sequence. This will completely release the amplified DNA donor from the LIR, ZsGreen, and SIR sequences after cleavage by Cas9 and guide RNA.

[1299] Figure 29 Another embodiment is described, which is similar to Figure 27 The embodiment differs in that the donor DNA has no gRNA target site on its flanks, thus keeping the amplified donor sequence circular and unlinearized.

[1300] Figure 30Another embodiment is illustrated, which also uses two FMOS promoters, but without viral elements in this case. Instead, the first FMOS promoter (prAGO18a-01) drives the expression of a reverse transcriptase (RT) enzyme that specifically interacts with the reverse transcriptase RNA (e.g., Ec86), while the second FMOS promoter drives the expression of Cas9 or another targeting nuclease (SEQ ID AR-SDN2_RETRON). The donor DNA in this construct is generated in the cell from a reverse transcriptase-donor RNA-guide RNA chimeric transcript controlled by the rice U3 promoter. Reverse transcription of the reverse transcriptase sequence and the donor RNA results in the covalently linking of the donor DNA sequence to the guide RNA. This method of allele substitution using reverse transcriptases, also known as CRISPEY (Sharon, E., Chen, SA.A., Khosla, NM, Smith, JD, Pritchard, JK, and Fraser, HB (2018) FUNCTIONAL GENETIC VARIANTS REVEALED BY MASSIVELY PARALLEL PRECISE GENOME EDITING [Massively Parallel Precision Genome Editing Reveals Functional Genetic Variations] Cell [Cell] 175(2):544-557), delivers abundant donor DNA to the target site to form sites for guide RNA and Cas9 double-strand breaks. In this example, at the embryonic or callus stage, we used the FMOS promoter to improve the efficiency of allele substitution success, instead of the standard use of CRISPEY (presumably a method that remains very inefficient and may be phytotoxic). Figure 44 A schematic diagram of the vector AR-SDN2_RETRON (SEQ ID NO:697) is shown, which is another reverse transcriptase-based instance according to various aspects of this disclosure.

[1301] The above discussion Figure 32 A schematic diagram of the vector AR-SDN2_REP_2Cuts (SEQ ID NO:187) is shown, which is an example of a vector suitable for allelic substitution. Additional features of the vector AR-SDN2_REP_2Cuts are further described in the notes below.

[1302]

[1303]

[1304]

[1305]

[1306]

[1307] Multiple constructs were constructed to test different allelic substitution designs using a replicon containing donor DNA, optionally side-mounted with a guide RNA target site, a Rep or RepA gene cassette controlled by one FMOS promoter, a Cas9 or another nuclease cassette driven by another FMOS promoter, and a selectability marker cassette. Allelic substitution frequencies in these preferred constructs were determined as described by measuring the editing frequency produced in stable transformed plants (T0 plants) and the number of successful allelic substitutions produced in progeny (T1 plants). The guide RNA in these constructs targets exon 2 of the acetolactate synthase (ALS, GRMZM2G143008) gene with a target site sequence of 5′-CAAGTATGTGTGCGCTCTGT-3′ (SEQ ID NO:6). The selectability marker was a phosphomannose isomerase (PMI) controlled by a constitutive promoter, with mannose selection used to re-obtain stable transformed maize inbred line NP2222. For each construct, approximately 10 single-copy T0 events were identified after seedling sampling confirmed that the ADH1 target site was not edited, and the construct was grown to maturity. PMI and Cas9 expression in leaves was also examined by qRT-PCR. The plants were then cross-pollinated and self-pollinated.

[1308] Embryo rescue is performed, followed by Taqman assay for successful allele replacement, or mature seeds are planted and the germinating plants are sprayed with a standard concentration of herbicide such as Pursuit (e.g., imazapyr) at a concentration of at least 200 mL / ha to determine the frequency of plant survival (as survival may be due to successful allele replacement). Samples are collected and tested using a Taqman assay to determine if the donor has replaced the target sequence: a positive result indicates a likely successful replacement. These survivors are sequenced to confirm that they indeed represent fully SDN2-edited alleles.

[1309] As mentioned above, such allelic substitution can be very challenging in plants, for example, because non-homologous end joining pathways are highly favorable for DNA repair. By using the FMOS promoter to drive the editing mechanism, these challenges can be overcome and allelic substitutions can be easily generated in most T0 events. The applicant's disclosure can save significant time and resources. Compared to existing technologies, using this technology (in some instances) allows for relatively easy execution of five to ten events and restoration of allelic substitutions in the T1 generation. This improvement can be attributed (at least in part) to two factors. First, by generating mosaic T0 plants with hundreds to thousands of edits, each T0 plant has a significantly better chance of producing at least one or more T1 seeds with allelic exchanges. The diversity of mutations inherited in the seeds reduces the overall effort and resources required in the process—a few events can be performed and seeds screened for the correct edits. Screening can then be performed using sequencing as needed. Sequencing 1000 T1 seeds requires less time, resources, and labor than generating 1000 T0 events. This is primarily because sequencing is relatively fast and inexpensive. In short, the FMOS regulatory system, particularly the FMOS promoter, offers significant advantages. A second reason the FMOS promoter can improve allelic substitution efficiency is that homologous recombination machinery can be expressed in germinal lineage cells before and during meiosis. Allelic substitution requires these factors that promote homologous repair, but these factors are not highly expressed in callus or vegetative tissues when most constitutive promoters express and edit Cas9. For at least these reasons, the applicant believes that the FMOS promoter is significantly superior to constitutive promoters in allelic substitution.

[1310] Exemplary Example:

[1311] 1. A method for generating multiple unique allelic substitutions in T1 seeds of plants, the method comprising:

[1312] a) Transforming at least one expression cassette into plant cells or plant tissues, wherein the at least one expression cassette contains

[1313] Nucleic acids that encode DNA-modifying enzymes

[1314] Optionally, a nucleic acid encoding at least one guide RNA (gRNA)

[1315] Target nucleic acid (donor DNA),

[1316] A replication promoter that is operatively linked to donor DNA to drive donor DNA replication.

[1317] as well as

[1318] FMOS (Fragmented Mosaic Metallic) control sequence, wherein the FMOS control sequence

[1319] (i) at least one of the DNA-modifying enzymes mediating the expression of the enzyme in the floral primordium cells and floral reproductive organs, and

[1320] (ii) mediating unique allelic substitution in at least one of the floral primordia and the floral reproductive organs; and

[1321] b) Regenerate the plant cells or plant tissues into T0 plants with multiple T1 seeds, wherein the T1 seeds contain multiple unique allele substitutions.

[1322] 2. The method as described in 1, wherein the DNA-modifying enzyme is a site-directed nuclease selected from the group consisting of: macro nucleases (MN), zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), Cas9 nucleases, Cpf1 nucleases, dCas9-FokI, dCpf1-FokI, chimeric Cas9-cytidine deaminase, chimeric Cas9-adenine deaminase, chimeric FEN1-FokI and Mega-TAL, nickase Cas9 (nCas9), chimeric dCas9 non-FokI nucleases and dCpf1 non-FokI nucleases.

[1323] 3. The method as described in 1, wherein

[1324] The DNA-modifying enzyme is either Cas9 nuclease or Cpf1 nuclease, and

[1325] The at least one expression cassette contains a nucleic acid encoding a gRNA, wherein the nucleic acid encoding the gRNA is operatively linked to an FMOS promoter or a second promoter.

[1326] 4. The method of any one of the above, wherein the at least one expression box further comprises at least one LIR.

[1327] 5. The method as described in any of the above, wherein the method further comprises:

[1328] The T1 seeds are grown to produce multiple T1 plants, and

[1329] Measure at least one phenotype in T1 generation plants, and

[1330] Plants of the T1 generation are selected based on measurements of at least one phenotype, wherein the selected plants have allelic exchange.

[1331] 6. The method as described in 5, the method further comprising crossing the selected plants of the T1 generation with the unique edit with plants without the unique edit to produce offspring with the unique edit.

[1332] 7. The method as described in any of the above, wherein the FMOS regulatory sequence is mediated in at least one of the inflorescence, microsporocyte, anther, stamen, felt layer, megasporocyte, pistil, ovary, style and stigma.

[1333] 8. The method as described in any one of the preceding embodiments, wherein the FMOS regulatory sequence mediates the expression of the DNA-modifying enzyme in the floral primordium and the floral reproductive organs in greater quantities than in the vegetative tissue, and wherein the FMOS regulatory sequence mediates the expression of the DNA-modifying enzyme in the floral primordium and the floral reproductive organs in greater quantities than in the seed (relative amounts, such as at least 2 times or at least 3 times more, as described in the other embodiments).

[1334] 9. The method as described in any of the above, wherein the FMOS control sequence comprises an FMOS promoter and an FMOS terminator.

[1335] 10. An FMOS promoter, which may be selected from those described herein.

[1336] 11. An FMOS terminator, which may be selected from those described herein.

[1337] 12. The method of any one of the preceding methods, wherein the plurality of unique allele substitutions comprises at least one of the following: at least 5, at least 10, at least 15, and at least 20 unique allele substitutions.

[1338] 13. The method as described in any of the preceding methods, wherein the at least one expression cassette does not contain a naturally translatable exon for the FMOS regulatory sequence. The FMOS promoter may include at least one of the following: modified to remove at least a portion of a first natural exon, a first intron, and a second exon of the start codon, wherein said portion of the second exon is untranslatable. Further, in some instances, the FMOS promoter may be modified to include, for example, ubiquitin introns to enhance FMOS activity.

[1339] 14. The method as described in any of the above, wherein the FMOS modulation sequence

[1340] (i) The expression of the DNA-modifying enzymes mediated in the floral reproductive organs of both male and female flowers, and

[1341] (ii) Multiple allele substitutions are mediated in the floral reproductive organs of both male and female flowers.

[1342] 15. The method as described in any of the above, the method further comprising measuring the number of edits in at least one of the T0 flower, T0 spike, and seed of the T0 plant.

[1343] 16. At least one expression box as described in any one of 1-15 above.

[1344] 17. A plant produced by the method as described in 1-15.

[1345] 18. A plant cell containing at least one expression cassette as described in 16.

[1346] Example 7: Effective Expression Modification via FMOS Promoters (Promoter Bashing)

[1347] Embodiments of the present invention can also be used to alter gene expression. For example, the FMOS promoter driving engineered nucleases can pair with multiple guide RNAs targeting the gene's regulatory region (promoter, terminator, 5′ or 3′ untranslated region, intron, cis enhancer, or cis repressor).

[1348] Therefore, constructs have the ability to induce novel mutations at multiple sites in the gene regulatory region within the flower, resulting in small and large insertions and deletions, as well as rearrangements in some cases. This has many effects on how genes are regulated. In some germinal lineages, and consequently in some T1 progeny seeds, this will lead to stable downregulation, stable upregulation, or alteration of gene tissue specificity or performance under different genetic backgrounds. The idea of ​​designing multiple guide RNAs into the gene regulatory region is called promoter re-hitting, but significant improvements can be made using FMOS promoters. Therefore, the combination of an FMOS promoter (or FMOS regulatory region) driving Cas9 with the promoter re-hitting concept is a major improvement over promoter re-hitting using constitutive promoters. For background information on promoter re-hitting, see Rodrl'guez-Leal et al., 2017, Cell 171, 470-480, October 5, 2017.

[1349] Traditional promoter heavy-hitting concepts involve generating large edit diversity within a region. This disclosure improves promoter heavy-hitting by using FMOS promoters to generate diversity more efficiently and quickly with minimal cross-comparison effort.

[1350] To demonstrate the effectiveness of expression alterations via the FMOS promoter, a construct was generated using the maize APETALA1 (ZmAP1) promoter to drive Cas12a activity, which paired with multiple guide RNAs targeting the following regulatory sequences that mediate transgene expression encoding 5-enolpyruvate-shikimate-3-phosphate (EPSP) synthase (EPSPS), conferring resistance to the herbicide glyphosate. In this case, the regulatory sequences of the EPSPS gene included the enhancer of the Scrophularia mosaic virus (FMV) promoter (eFMV), the enhancer of the cauliflower mosaic virus 35S promoter (e35S), the maize ubi1 promoter (prZmUbi158), and the Ω5'UTR leader sequence of tobacco mosaic virus (eTMV). The aim of this experiment was to determine whether editing certain enhancer or promoter sequences using the FMOS promoter could generate a series of novel EPSPS expression alleles. We identified a total of eight guide RNAs designed to pair with the nuclease Cas12a. These eight guide RNAs should be capable of uniquely editing the regulatory sequences of the EPSPS transgene: two targeting the eFMV enhancer, two targeting the e35S enhancer, three targeting the prUbi158 promoter, and one targeting the eTMV translation enhancer. In the construct, guide RNA expression is driven by a constitutive Ubi4 promoter derived from sugarcane, with each guide RNA flanked by two self-cleaving ribozymes (hammerhead and HDV) for efficient processing. The vector also contains PMI as a selectability marker.

[1351] Construct 25068 (SEQ ID NO:535) is a binary CRISPR construct that targets EPSPS events in the JHAX background to reduce the expression levels of EPSPS trait genes. The expression of the endonuclease LbCas12a (formerly known as LbCpf1) is driven by the corn Apetala1 promoter (prZmAP1-02) and terminator (tZmAP1-01), enabling specific expression in early and late male and female inflorescences. The crRNA cassette contains eight multiplex crRNAs driven by the sugarcane ubiquitin 4 promoter prSoUbi4-02; targeting eFMV, e35S, prZmUbi158, and eTMV, with each crRNA flanked by two self-cleaving ribozymes (hammerhead and HDV) for efficient RNA processing guidance.

[1352]

[1353]

[1354]

[1355]

[1356]

[1357] We transformed NP2222 plants homozygous for the event transgene using construct 25068 via Agrobacterium-mediated immature embryo transformation, following a standard protocol. Several events were sent to a greenhouse, grown to maturity, and backcrossed with “wild-type” plants to produce BC1 (backcross 1) generation seeds. Different mutant sets were re-obtained in BC1 seedlings obtained through embryo rescue or planting. DNA extraction and analysis were performed using a target-specific Taqman assay designed to detect edits in five targets (see Table 27 for details). Three distinct editing patterns were identified in seedlings from backcrossed females carrying event UR228452062 (also known as GVG01191245) carrying construct 25068. We isolated 100 embryos, but several failed to germinate, so we ultimately tested the Taqman assay on only 30 plants. Of these 30 plants, plants numbered 3, 78, and 92 each contained a single mutation. Plant 3 contained a 2 bp deletion at the 35S enhancer site. Plant 78 contains an 8 bp deletion at FMV target site 1. Plant 92 contains a 5 bp deletion at FMV target site 1. These plants all have a single copy of the FMOS edit box and possess distinct edits re-acquired in the offspring of this backcross event.

[1358] Table 27

[1359]

[1360] Many other edited alleles were created in this way and re-acquired in BC1. Therefore, we created different allele sets for the EPSPS gene promoter. Plants containing these alleles were placed in a greenhouse and grown to maturity and then self-pollinated. In the BC1-(self-pollination) generation, homozygous plants carrying these three new expression alleles were grown alongside wild-type and original EPSPS events, and their expression changes due to different edit sets in different events could be assessed by qRT-PCR. Lines with reduced expression could then be further examined (e.g., using agronomic assays and herbicide application to examine the tolerance levels and agronomical performance of those plants compared to the original construct).

[1361] Exemplary Example:

[1362] 1. A method for altering the expression of a target gene in plant T1 seeds, the method comprising:

[1363] a) Transforming at least one expression cassette into plant cells or plant tissues, wherein the at least one expression cassette contains

[1364] Nucleic acids that encode DNA-modifying enzymes

[1365] A nucleic acid encoding at least one guide RNA (gRNA), wherein the at least one guide RNA targets the regulatory region of the target gene, and

[1366] FMOS (Fragmented Mosaic Metallic) control sequence, wherein the FMOS control sequence

[1367] (i) at least one of the DNA-modifying enzymes mediating the expression of the enzyme in the floral primordium cells and floral reproductive organs, and

[1368] (ii) mediating multiple edits in the regulatory regions of the target gene in at least one of the floral primordia and the floral reproductive organs; and

[1369] b) Regenerate the plant cells or plant tissues into T0 plants with multiple T1 seeds, wherein the T1 seeds contain multiple unique edits in the regulatory regions of the target genes, thereby generating multiple target gene expression profiles.

[1370] 2. The method as described in 1, wherein the plurality of unique edits are selected from the group consisting of: plurality of unique base insertions and plurality of unique base deletions.

[1371] 3. The method of any one of the above, wherein the DNA-modifying enzyme is a site-directed nuclease selected from the group consisting of: Cas9 nuclease, Cpf1 nuclease, dCas9-FokI, dCpf1-FokI, chimeric Cas9-cytidine deaminase, chimeric Cas9-adenine deaminase, chimeric FEN1-FokI and Mega-TAL, nickase Cas9 (nCas9), chimeric dCas9 non-FokI nuclease and dCpf1 non-FokI nuclease.

[1372] 4. The method as described in any one of the above, wherein the DNA-modifying enzyme is a Cas9 nuclease or a Cpf1 nuclease.

[1373] 5. The method as described in any one of the preceding methods, wherein the regulatory region of the targeted gene comprises at least one of a promoter, a terminator, a 5′ or 3′ untranslated region, an intron, a cis-enhancer, and a cis-repressor.

[1374] 6. The method as described in any of the above claims, wherein the method further comprises:

[1375] The T1 seeds are grown to produce multiple T1 plants, and

[1376] Measure at least one phenotype in T1 generation plants, and

[1377] The T1 generation plants are selected based on measurements of at least one phenotype, wherein the selected plants have unique editing in the regulatory region of the target gene.

[1378] 7. The method as described in 6, the method further comprising crossing the selected plants of the T1 generation with the unique edit with plants without the unique edit to produce offspring with the unique edit.

[1379] 8. The method as described in any of the above, wherein the FMOS regulatory sequence is mediated in at least one of the inflorescence, microsporocyte, anther, stamen, felt layer, megasporocyte, pistil, ovary, style and stigma.

[1380] 9. The method as described in any of the above, wherein the FMOS control sequence comprises an FMOS promoter and an FMOS terminator.

[1381] 10. The FMOS promoter and terminator may be any of those promoters and terminators disclosed herein.

[1382] 11. The method as described in 1, wherein the plurality of unique edits comprises at least one of the following: at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95 unique edits.

[1383] 12. The method as described in any of the preceding methods, wherein the at least one expression cassette does not contain a naturally translatable exon for the FMOS regulatory sequence. The FMOS promoter may include at least one of the following: modified to remove at least a portion of a first natural exon, a first intron, and a second exon of the start codon, wherein said portion of the second exon is untranslatable. Further, in some instances, the FMOS promoter may be modified to include, for example, ubiquitin introns to enhance FMOS activity.

[1384] 13. The method as described in any of the above, wherein the FMOS modulation sequence

[1385] (i) The expression of the DNA-modifying enzymes mediated in the floral reproductive organs of both male and female flowers, and

[1386] (ii) Multiple editing is mediated in the floral reproductive organs of both male and female flowers.

[1387] 14. The method of any one of the preceding embodiments, wherein the FMOS regulatory sequence mediates the expression of the DNA-modifying enzyme in the floral primordium and the floral reproductive organs in greater qua...

Claims

1. A method for generating multiple unique edits in T1 seeds of plants, the method comprising: a) Transforming at least one expression cassette comprising SEQ ID NO:25 into plant cells or plant tissues, wherein the at least one expression cassette contains The nucleic acid encoding the DNA-modifying enzyme composed of SEQ ID NO:4 Optionally, a nucleic acid encoding at least one guide RNA (gRNA), and FMOS (Fragmented Mosaic Metallic) control sequence, wherein the FMOS control sequence (i) at least one of the DNA-modifying enzymes mediating the expression of the enzyme in the floral primordium cells and floral reproductive organs, and (ii) mediating multiple edits in at least one of the floral primordia and the floral reproductive organs; as well as b) Regenerating the plant cells or plant tissue into a T0 plant with multiple T1 seeds, wherein the T1 seeds contain multiple unique edits. The FMOS modulation sequence is composed of SEQ ID NO:26 and SEQ ID NO:

27.

2. The method of claim 1, wherein the plurality of unique edits are selected from the group consisting of: plurality of unique allelic substitutions, plurality of unique base insertions, and plurality of unique base deletions.

3. The method of claim 1, wherein The DNA-modifying enzyme is a Cas9 nuclease composed of SEQ ID NO:4, and The at least one expression cassette contains a nucleic acid encoding a gRNA, wherein the nucleic acid encoding the gRNA is operatively linked to an FMOS promoter or a second promoter.

4. The method of claim 3, wherein The unique editing is allele substitution, and The at least one expression cassette further comprises donor DNA.

5. The method of claim 4, wherein the at least one expression cassette further comprises a replication promoter operatively linked to the donor DNA to drive replication of the donor DNA.

6. The method of claim 4, wherein the at least one expression cassette further comprises at least one LIR.

7. The method of claim 1, wherein the method further comprises The T1 seeds are grown to produce multiple T1 plants, and Measure at least one phenotype in T1 generation plants, and The T1 generation plants are selected based on measurements of at least one phenotype, wherein the selected plants have unique edits and contain donor DNA.

8. The method of claim 7, wherein the method further comprises The insertion sites of the donor DNA in the selected plants of the T1 generation were sequenced. The insertion sites of the donor DNA in the unselected plants of the T1 generation were sequenced, and The insertion site sequence of the selected plant is compared with the insertion site sequence of the unselected plant.

9. The method of claim 1, wherein the FMOS regulatory sequence is mediated in at least one of the inflorescence, microsporocyte, anther, stamen, felt layer, megasporocyte, pistil, ovary, style and stigma.

10. The method of claim 1, wherein the FMOS modulation sequence mediates... The DNA-modifying enzyme is present in the floral primordia and the floral reproductive organs at at least one of the following multiples more than in the vegetative tissues: at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 21 times, at least 2 2 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times At least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, at least 74 times, up to At least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times, and The DNA-modifying enzyme in the floral primordia and the floral reproductive organs in at least one of the following multiples compared to that in the seeds: at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 21 times, at least 22 times. At least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, at least 47 times, at least 48 times At least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, at least 74 times. At least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times.

11. The method of claim 1, wherein the plurality of unique edits comprises at least one of the following: at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95 unique edits.

12. The method of claim 1, wherein the at least one expression cassette does not contain exons that are naturally translatable for the FMOS regulatory sequence.

13. The method of claim 1, wherein the FMOS modulation sequence (i) The expression of the DNA-modifying enzymes mediated in the floral reproductive organs of both male and female flowers, and (ii) Multiple editing is mediated in the floral reproductive organs of both male and female flowers.

14. The method of claim 13, wherein The expression of the DNA-modifying enzyme in the male floral reproductive organs is at least one multiple of the following in the floral primordia and the floral reproductive organs compared to the vegetative tissue: at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, and so on. At least 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times. At least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times. At least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times, and The expression of the DNA-modifying enzyme in the female floral reproductive organs is at least one multiple of the following in the floral primordia and the floral reproductive organs compared to the vegetative tissue: at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, and so on. At least 20 times less, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times At least 46 times, at least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 7 3 times, at least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times.

15. At least one expression cassette consisting of SEQ ID NO:25 for generating at least 15 unique edits in T1 seeds of plants. The expression box includes: The nucleic acid encoding the DNA-modifying enzyme composed of SEQ ID NO:4 Optionally, a nucleic acid encoding at least one guide RNA (gRNA), and Flower mosaic (FMOS) promoter, wherein the FMOS promoter (i) at least one of the DNA-modifying enzymes mediating the expression of the enzyme in the floral primordium cells and floral reproductive organs, and (ii) mediating multiple edits in at least one of the floral primordia and the floral reproductive organs, and (iii) Mediating The DNA-modifying enzyme is expressed in at least one of the following quantities at least 2 times more than in the vegetative tissue than in the floral primordia and the floral reproductive organs: at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 21 times. At least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, up to At least 47 times less, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, at least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times, and The DNA-modifying enzyme is expressed in at least one of the following quantities at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 21 times, or more than in the seed. At least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 27 times, at least 28 times, at least 29 times, at least 30 times, at least 31 times, at least 32 times, at least 33 times, at least 34 times, at least 35 times, at least 36 times, at least 37 times, at least 38 times, at least 39 times, at least 40 times, at least 41 times, at least 42 times, at least 43 times, at least 44 times, at least 45 times, at least 46 times, up to At least 47 times, at least 48 times, at least 49 times, at least 50 times, at least 51 times, at least 52 times, at least 53 times, at least 54 times, at least 55 times, at least 56 times, at least 57 times, at least 58 times, at least 59 times, at least 60 times, at least 61 times, at least 62 times, at least 63 times, at least 64 times, at least 65 times, at least 66 times, at least 67 times, at least 68 times, at least 69 times, at least 70 times, at least 71 times, at least 72 times, at least 73 times, to At least 74 times, at least 75 times, at least 76 times, at least 77 times, at least 78 times, at least 79 times, at least 80 times, at least 81 times, at least 82 times, at least 83 times, at least 84 times, at least 85 times, at least 86 times, at least 87 times, at least 88 times, at least 89 times, at least 90 times, at least 91 times, at least 92 times, at least 93 times, at least 94 times, at least 95 times, at least 96 times, at least 97 times, at least 98 times, at least 99 times, and at least 100 times. Furthermore, the FMOS promoter described therein is composed of SEQ ID NO:

26.

16. The expression box as claimed in claim 15, wherein The DNA-modifying enzyme is a Cas9 nuclease composed of SEQ ID NO:4; The box contains a nucleic acid encoding a gRNA, wherein the nucleic acid encoding the gRNA is operatively linked to the FMOS promoter or the second promoter consisting of SEQ ID NO:26; The cartridge further includes donor DNA and a replication promoter operatively linked to the donor DNA to drive replication of the donor DNA; and The FMOS promoter is mediated in at least one of the following: inflorescence, microsporocyte, anther, stamen, felt layer, megasporocyte, pistil, ovary, style, and stigma.

17. The expression box of claim 15, wherein the expression box further comprises an FMOS terminator consisting of SEQ ID NO:27.

Images