Method for increasing the thousand-grain weight of rice

Abstract

The present application belongs to the field of agricultural biotechnology, and relates to a method for increasing the grain weight per 1000 grains and / or grain thickness of a gramineous crop, which can increase the grain thickness and weight per 1000 grains of a gramineous crop such as rice by down-regulating, inactivating, weakening the function of or knocking out the transcription factor GTW5 gene, and is helpful for cultivating a new high-yield rice variety.

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology and relates to the use of transcription factor GTW5 in improving grain yield of gramineous crops, and more particularly to a method for using the transcription factor GTW5 gene to improve grain thickness and thousand-grain weight in rice. Background Technology

[0002] Rice (Oryza sativa L.) is one of the world's most important food crops, with approximately half of the global population relying on it as a staple food. However, with rapid population growth, urbanization, declining arable land, water scarcity, and global climate change, global rice production has reached a bottleneck in recent years. Therefore, how to further increase rice yields and ensure food security on limited arable land has become a crucial issue.

[0003] Rice yield is a complex trait influenced by multiple factors. The yield per rice plant has three important components: the number of effective panicles per plant, the number of grains per panicle, and the grain weight. Rice grain shape, including grain length, grain width, and grain thickness, directly determines the thousand-grain weight, thus affecting yield. Furthermore, grain shape is also an important appearance quality trait, directly impacting the processing quality of rice. Rice grain shape is a quantitative trait controlled by nuclear and cytoplasmic genes and is also influenced by the environment. 1 With the cloning of the first granulation gene GS3 2 To date, many important QTLs (Quantitative Trait Locus) controlling grain shape have been identified using natural populations through map-based cloning and GWAS (Genome-wide Association Study) methods. In addition, many grain shape genes have been cloned from grain shape mutant materials. Functional studies of these genes have revealed their involvement in different pathways, primarily including the G protein signaling pathway, the ubiquitin-proteasome pathway, the MAPK (Mitogen-Activated Protein Kinase) cascade pathway, the plant hormone pathway, the transcription factor pathway, and the epigenetic modification pathway, with these pathways interacting with each other. These genes mainly regulate grain shape by influencing glume cell proliferation or cell elongation.

[0004] In rice, GS3 is a major gene controlling grain length and weight, and a minor gene controlling grain width and thickness. GS3 is a negative regulator of rice grain shape; when its function is lost, rice grains become longer. 2GS3 has four domains: an N-terminal PEBP-like / OSR domain, a transmembrane domain, a TNFR / NGFR family cysteine ​​enrichment domain, and a C-terminal VWFC domain. These domains play different roles in rice grain shape regulation. The OSR domain negatively regulates grain length, while the VMFC and TNFR domains inhibit the OSR domain. 3 GW2 is a major gene controlling grain width and weight, encoding a cyclic E3 ubiquitin ligase. When GW2 is lost, ubiquitin cannot be transferred to its target protein, preventing the substrate that should be degraded from being specifically recognized. This promotes the division of the floret shell cells, increasing the width of the floret shell, indirectly increasing the grain filling rate and the size of the endosperm. 4 GSE5 / qSW5 / GW5 is a major-effect QTL controlling rice grain width. GW5 / GSE5 encodes a calmodulin-binding protein. 5,6,7,8 In wide-grained varieties, grain size is regulated by controlling the expression level of GW5 through a 1212bp deletion. GW5 protein is a novel positive regulator of brassinolide signaling, interacting with glycogen synthase kinase GSK2 and inhibiting its activity. GW5 inhibits GSK2 autophosphorylation and GSK2 phosphorylation of OsBZR1 and DLT, affecting the accumulation of unphosphorylated OsBZR1 and DLT proteins in the cell nucleus, thereby regulating the expression levels of brassinolide response genes and growth responses, thus influencing grain width and grain weight. 6 GSE5 can interact with rice calmodulin OsCaM1-1, controlling grain width by regulating the proliferation of glume cells. 5 TGW6 encodes indole-3-acetic acid (IAA)-glucose hydrolase. TGW6 from Nipponbare rice hydrolyzes IAA-glucose into free IAA and glucose, influencing the timing of syncytiocytosis transition by controlling IAA supply, thereby limiting endosperm cell number and grain length. Loss of TGW6 function in Kasalath rice results in pleiotropic effects on the source organ, thus increasing rice yield. 9 GL7 / GW7 / SGL7 is a major-effect QTL for controlling rice grain length and width. 10,11 GL7 / GW7 / SGL7 encodes a homologous protein of Arabidopsis thaliana TONNEAU1. Upregulation of GW7 enhances longitudinal cell division and weakens transverse cell division in grains, resulting in elongated grains. OsSPL16 / qGW8 can inhibit its expression by binding to the GTAC element of GL7 / GW7 / SGL7. 10 Copy number variations in GL7 / GW7 / SGL7 upregulate the expression levels of GL7 / GW7 / SGL7 and downregulate the neighboring negative regulator Os07g0603400, resulting in elongated kernels and improved kernel appearance.12 GLW7 / OsSPL13 is a gene controlling rice grain length and weight, cloned using GWAS. The presence of its 5'-UTR tandem repeat sequence decreases OsSPL13 expression, resulting in smaller rice grains. ChIP experiments showed that it can interact with SRS5, which encodes tubulin. 13 .

[0005] Rice grain shape is a complex trait that affects both yield and quality. While many major genes related to grain length, width, and thousand-grain weight have been cloned, fewer genes related to grain thickness have been cloned. Grain thickness is difficult to measure and is highly susceptible to environmental influences. Therefore, using natural populations to mine grain thickness-related QTLs and study their function and molecular mechanisms is of great significance. Furthermore, to obtain a large amount of DNA polymorphism, most genetic populations are currently constructed between species and subspecies to improve the efficiency of QTL mapping. However, this can sometimes make it difficult to assess the breeding value of a QTL in japonica rice germplasm resources. In addition, significant differences in genetic background make it difficult to detect minor QTLs. Therefore, using closely related varieties from the same subspecies for QTL mapping can detect minor QTLs and assess their breeding potential. Summary of the Invention

[0006] In this study, we selected two closely related japonica rice varieties as parental materials. Through linkage analysis, we located the gene GTW5, which negatively regulates grain thickness and thousand-grain weight. GTW5 encodes a transcription factor located in the cell nucleus and regulates grain shape by controlling cell number. This gene, GTW5, has potential as a target gene for increasing rice yield. Based on this discovery, the present invention includes the following technical solutions.

[0007] This invention provides a method for increasing the thousand-grain weight and / or grain thickness of gramineous crops, comprising the following steps: downregulating, inactivating, weakening or knocking out the expression of the transcription factor GTW5 (Grain Thickness and Weight on Chromosome 5, GTW5) gene in the chromosomes of gramineous crops.

[0008] The above-mentioned grass crops are selected from the following group: rice, wheat, corn, barley, oats, rye, sorghum, and millet, with rice being the preferred grass crop.

[0009] Preferably, the aforementioned gramineous crop is rice, selected from japonica rice and indica rice.

[0010] In one embodiment, the aforementioned gramineous crop is the japonica rice variety Koshihikari or the japonica rice variety LG31. The amino acid sequence of the transcription factor GTW5 derived from the japonica rice variety Koshihikari is shown in SEQ ID NO:1, and the NCBI accession number is Os05g0564500 or LOC_Os05g48990. The amino acid sequence of the transcription factor GTW5 derived from the japonica rice variety LG31 is shown in SEQ ID NO:4, and the NCBI accession number is LOC9266766.

[0011] Peptide SEQ ID NO:1 is a highly homologous mutant of peptide SEQ ID NO:4. The difference between the two lies in the amino acid residue at position 443. The former is V (valine, Val), while the latter is M (methionine / methionine, Met).

[0012] The nucleotide sequence of the GTW5 gene containing introns from the japonica rice variety Koshihikari is SEQ ID NO:3, and the nucleotide sequence of its coding region, i.e., the CDS sequence, is SEQ ID NO:2; the nucleotide sequence of the GTW5 gene containing introns from the japonica rice variety LG31 is SEQ ID NO:6, and the nucleotide sequence of its coding region, i.e., the CDS sequence, is SEQ ID NO:5.

[0013] That is, the gene encoding peptide SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, and the gene encoding peptide SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6 are SNP molecular marker sequences. The difference between the two SNP marker sequences is the 1327th base (G / A) in the coding region (CDS) nucleotide sequence, where the former is G and the latter is A.

[0014] Preferably, the above-mentioned transcription factor GTW5 gene is used as a target gene for breeding high-yield new rice varieties.

[0015] In one implementation, the above method can be carried out in the following manner:

[0016] (1) Knock out the GTW5 gene in the chromosomes of wild-type grasses;

[0017] (2) Down-regulate the expression level of the GTW5 gene in the chromosomes of wild-type grasses;

[0018] (3) Replace the GTW5 gene in the chromosomes of wild-type grasses with a GTW5 mutant that encodes a gene with lost or downregulated function; and / or

[0019] (4) Block, suppress or interfere with the expression of the GTW5 gene in the chromosomes of wild-type grasses.

[0020] (5) Molecular marker-assisted breeding: GTW5 of the japonica rice variety Longjing 31 (LG31) was introduced into other varieties.

[0021] Optionally, the above method (2) is selected from the following group:

[0022] (2-1) Mutations in the promoter region and / or coding region of the GTW5 gene lead to downregulation of the expression level of the GTW5 gene;

[0023] (2-2) Mutations in the upstream regulators of the GTW5 gene lead to a downregulation of GTW5 expression; or

[0024] (2-3) Introduce GTW5 interacting proteins into wild-type grasses to alter the function of the GTW5 gene.

[0025] In one implementation, the above methods can be carried out through gene editing technology, antisense nucleic acids, and transcriptional regulation.

[0026] The gene editing technologies mentioned above can be selected from the following group: homologous double crossover, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, and MuGENT.

[0027] In one embodiment, the method for constructing transgenic plants may include the following steps: constructing a knockout vector of the GTW5 gene SEQ ID NO:3 of other rice varieties, such as Koshihikari, using the CRISPR / Cas9 genome editing system; then transferring the knockout vector into rice cells and integrating it into the chromosome by infecting rice callus tissue with Agrobacterium tumefaciens; and screening for cells, tissues, or organs that have successfully knocked out the GTW5 gene to regenerate plants.

[0028] Optionally, using base editing technology developed based on the CRISPR / Cas9 system, the G at position 1327 in rice varieties such as Koshihikari can be replaced with the A base, thereby enabling Koshihikari to express the GTW5 gene SEQ ID NO:5 or SEQ ID NO:6 derived from Longjing 31 (LG31). Traditional recombinant plasmid transformation protocols can be implemented together with gene editing technologies such as the CRISPR system.

[0029] In another implementation, for example, when the grass crop is rice, since the GTW5 gene of Longjing 31 has a stronger regulatory effect on grain thickness and thousand-grain weight, molecular marker-assisted breeding technology can be used to design the G / A difference at base 1327 as a single nucleotide polymorphism (SNP) molecular marker. In the hybrid offspring of Koshihikari and Longjing 31 (LG31), Koshihikari background materials with SEQ ID NO:5 or SEQ ID NO:6 of the GTW5 gene from Longjing 31 (LG31) can be screened.

[0030] This invention screened and obtained a SNP molecular marker gene GTW5 linked to thousand-grain weight, derived from the japonica rice varieties Koshihikari and LG31. The GTW5 gene regulates grain shape by controlling cell number, and negatively regulates grain thickness and thousand-grain weight in rice. The GTW5 gene from LG31 shows a more significant regulatory effect on grain thickness and thousand-grain weight. Therefore, the GTW5 gene can be used as a target gene to promote the improvement of gramineous crops and to breed high-yielding new varieties. Attached Figure Description

[0031] Figure 1 The results of map-based cloning to identify the GTW5 gene (NCBI accession number Os05g0564500) are shown.

[0032] Figure 2 This paper presents the grain type phenotypic analysis of two genotype NILs (near-isogenic lines) of the japonica rice varieties Koshihikari and Longjing 31 (LG31): NIL-GTW5LG31 and NIL-gtw5Koshihikari. A: Phenotype of hulled grain thickness between NIL-GTW5LG31 and NIL-gtw5Koshihikar. Scale bar, 1 cm. B: Phenotype of brown grain thickness between NIL-GTW5LG31 and NIL-gtw5Koshihikar. Scale bar, 1 cm. C: Comparison of differences in grain thickness between NIL-GTW5LG31 and NIL-gtw5Koshihikar (n=24). D: Comparison of differences in brown grain thickness between NIL-GTW5LG31 and NIL-gtw5Koshihikar (n=24). E: Comparison of the difference in thousand-grain weight between NIL-GTW5LG31 and NIL-gtw5Koshihikar (n=24). F: Comparison of the difference in thousand-grain weight of brown rice between NIL-GTW5LG31 and NIL-gtw5Koshihikar (n=24). The t-test showed significant differences, *P<0.05, **P<0.01, ***P<0.001.

[0033] Figure 3 The results show the grain type identification of the complementary transgenic lines of gtw5 in line NIL-GTW5LG31. A: Phenotype of grain thickness with husk in NIL-GTW5LG31 and two complementary transgenic lines. Scale bar, 1 cm. B: Phenotype of brown rice grain thickness in NIL-GTW5LG31 and two complementary transgenic lines. Scale bar, 1 cm. C: Comparison of differences in grain thickness between NIL-GTW5LG31 and two complementary transgenic lines (n=24). D: Comparison of differences in brown rice grain thickness between NIL-GTW5LG31 and two complementary transgenic lines (n=24). E: Comparison of differences in thousand-grain weight between NIL-GTW5LG31 and two complementary transgenic lines (n=24). F: Comparison of differences in thousand-grain weight of brown rice between NIL-GTW5LG31 and two complementary transgenic lines (n=24). *P<0.05, **P<0.01, ***P<0.001.

[0034] Figure 4 The NIL-GTW5 strain was shown to investigate the effects of the GTW5 gene on cell division and grain size. LG31 and NIL-gtw5 Koshihikari Cytological analysis. Among them, A: NIL-GTW5 LG31 (Above) and NIL-gtw5 Koshihikari (Bottom) Semi-thin section of the glumes of the small flower, scale bar, 100 μm. B: Enlarged image of the area within the black box in Figure A, NIL-GTW5. LG31 (Left) and NIL-gtw5 Koshihikari (Right), scale bar, 500μm. C: NIL-GTW5 LG31 (Left) and NIL-gtw5 Koshihikari Scanning electron microscopy observation of mature seeds (right), scale bar, 1 mm. D: NIL-GTW5 LG31 (Left) and NIL-gtw5 Koshihikari Scanning electron microscopy observation of the outer surface of the glumes (right), scale bar, 100 μm. E: NIL-GTW5 LG31 and NIL-gtw5 Koshihikari Comparison of the number of outer parenchyma cells (n=3). F: NIL-GTW5 LG31 and NIL-gtw5 Koshihikari Comparison of outer thin-walled cell sizes (n=3). G: NIL-GTW5 LG31 and NIL-gtw5 Koshihikari Comparison of the transverse number of cells on the outer surface of the glumes (n=10). H: NIL-GTW5 LG31 and NIL-gtw5 KoshihikariComparison of transverse size of cells on the outer surface of glumes (n=10). *P<0.05, **P<0.01, ***P<0.001.

[0035] Figure 5 The image shows an in situ hybridization of GTW5 to examine the spatiotemporal expression patterns of the GTW5 gene. In this image, A represents GTW5 in NIL-GTW5. LG31 In situ hybridization in Sp7 during floret development, scale bar, 50 μm. B:GTW5 in NIL-GTW5 LG31 In situ hybridization of Sp8e during floret development, scale bar, 100 μm. C:GTW5 in NIL-GTW5 LG31 In situ hybridization of Sp8l during floret development, scale bar, 200 μm. D: In situ hybridization of the negative control sense, scale bar, 100 μm. E: GTW5 in NIL-gtw5 Koshihikari In situ hybridization in Sp7 during floret development, scale bar, 100 μm. F: GTW5 in NIL-gtw5 Koshihikari In situ hybridization in Sp8e during floret development, scale bar, 100 μm. G:GTW5 in NIL-gtw5 Koshihikari In situ hybridization in Sp8l during floret development, scale bar, 200 μm. In situ hybridization of H. positive control Histone 4, scale bar, 100 μm. le: lemma; lo: sap leaf; st: stamen; ca: carpel; pa: palea; ov: ovule; Sp: floret development stage; Sp8e: early floret development; Sp8l: late floret development.

[0036] Figure 6 The grain type phenotypes of lines Koshihikari, BIL-LG31-1, and BIL-LG31-2 are shown. A: Comparison of hulled grain thickness among Koshihikari, BIL-LG31-1, and BIL-LG31-2 (n=12). B: Comparison of brown rice grain thickness among Koshihikari, BIL-LG31-1, and BIL-LG31-2 (n=12). C: Comparison of hulled thousand-grain weight among Koshihikari, BIL-LG31-1, and BIL-LG31-2 (n=12). D: Comparison of brown rice thousand-grain weight among Koshihikari, BIL-LG31-1, and BIL-LG31-2 (n=12). *P<0.05, **P<0.01, ***P<0.001. Detailed Implementation

[0037] In our research on the discovery and evaluation of new genes for heterosis in rice, we cloned a rice thousand-grain weight-linked SNP molecular marker gene, GTW5, derived from the japonica rice varieties Koshihikari and LG31. GTW5 negatively regulates grain thickness and thousand-grain weight; inhibiting this gene may increase grain thickness and thousand-grain weight in rice seeds. GTW5 regulates grain shape by controlling cell number and can serve as a target for improving existing varieties using traditional breeding methods. The GTW5 gene derived from LG31... LG31 (NCBI accession number LOC9266766) is a rare variant that has differentiated in japonica rice. Using marker-assisted selection, GTW5 was selected... LG31 Introducing GTW5 into Koshihikari can increase grain thickness and thousand-grain weight, indicating that GTW5... LG31 The GTW5 gene, which can replace other rice varieties, has potential for increasing yield. This result suggests that the GTW5 gene could potentially serve as a target gene resource for breeding new high-yielding rice varieties.

[0038] The GTW5 gene of Koshihikari and LG31 encodes polypeptides SEQ ID NO:1 and SEQ ID NO:4, respectively. The only difference between the two is the difference between amino acid residues V and M at position 443. Therefore, they are highly conserved mutants of each other.

[0039] The coding gene SEQ ID NO:2 or SEQ ID NO:3 of GTW5 from Koshihikari and the coding gene SEQ ID NO:5 or SEQ ID NO:6 of GTW5 from LG31 are SNP molecular marker sequences. The difference between the two SNP marker sequences is the 1327th base (G / A) in the coding region (CDS) nucleotide sequence, where the former is G and the latter is A.

[0040] Those skilled in the art will anticipate that the suppression or mutation of the transcription factor GTW5 gene in other gramineous crops may also result in increased grain thickness and / or thousand-grain weight, thereby increasing the grain yield of transgenic plants.

[0041] As used herein, the terms “transgenic plant,” “genetically engineered plant,” and “(plant) mutant” have the same meaning, referring to plants that have been genetically modified from wild-type plants, especially those with increased seed thickness and / or thousand-grain weight by inhibiting the expression of the GTW5 gene. Correspondingly, the term “wild-type” in this article refers to unmodified, unmutated plants, such as the rice varieties Koshihikari and Longjing 31.

[0042] In the description of the technical solutions of this invention, the term "and / or" used in terms such as "A and / or B" or "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B, and / or C" is intended to cover each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0043] As used herein, the terms “(grain thickness / thousand-grain weight) improvement,” “increase,” or “enhancement” can mean an improvement of at least 10% compared to a reference level (e.g., wild-type rice), such as an improvement of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100%, or any improvement between 10% and 100%.

[0044] In this document, for the sake of simplicity, a protein, such as GTW5, is sometimes used interchangeably with the name of its encoding gene (DNA), GTW5. Those skilled in the art should understand that they represent different types of substances in different descriptive contexts. Their meanings are readily understood by those skilled in the art based on the context. For example, when describing the transcription factor function or class of a protein regulating grain thickness and / or thousand-grain weight, GTW5 refers to the protein; when used as a gene description, it refers to the gene encoding that protein.

[0045] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0046] Example

[0047] The examples involve the addition amount, content and concentration of various substances, and unless otherwise specified, the percentage content refers to the mass percentage content.

[0048] In the embodiments described herein, unless otherwise specified, the temperature generally refers to room temperature (15-30°C).

[0049] The molecular biology experiments in this embodiment, including plasmid construction, enzyme digestion, competent cell preparation, and transformation, were mainly conducted in accordance with *Molecular Cloning: A Laboratory Manual* (3rd Edition), edited by J. Sambrook and DW. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002. For example, the methods for competent cell transformation and competent cell preparation were both performed according to Chapter 1, page 96 of *Molecular Cloning: A Laboratory Manual* (3rd Edition). Specific experimental conditions could be determined through simple experiments if necessary.

[0050] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments can be made through simple experiments if necessary.

[0051] The primer synthesis and gene sequencing in this embodiment were commissioned to Sangon Biotech (Shanghai) Co., Ltd. and Beijing Qingke Biotechnology Co., Ltd.

[0052] Molecular biology methods and transgenic plant construction methods, including the construction of GTW5 overexpression plasmids, the construction of Agrobacterium-mediated transformation, and gene editing technology, are carried out using techniques commonly used in this field.

[0053] For example, the standard steps of genetic transformation are as follows.

[0054] 1. Callus Induction: Select mature and plump rice seeds, remove the husk; disinfect with 75% alcohol for 1-2 minutes, then discard the alcohol; rinse twice with sterile distilled water; soak in 0.15% mercuric chloride (containing 0.1% Tween-20) for 15-18 minutes, shaking several times during this period; discard the mercuric chloride, and rinse 5 times with sterile distilled water. Inoculate the sterilized seeds into the callus induction medium and culture at 32℃ under light for 5-10 days.

[0055] 2. Agrobacterium streak activation: Two days before infection, Agrobacterium was streaked on LB medium containing 50 mg / L kanamycin and incubated at 28°C.

[0056] 3. Agrobacterium suspension, infection, and co-culture: Before infection, activated Agrobacterium was scraped into suspension medium and cultured at 28°C with shaking at 180 rpm for 3–3.5 h. The bacterial concentration was then adjusted to OD600 = 0.1–0.2 using suspension medium. Callus tissue induced for 5–10 days was placed in the Agrobacterium suspension and infected for 1.5 min. The bacterial suspension was discarded, and the surface of the callus was blotted dry with sterile filter paper. The callus surface was covered with sterile filter paper and dried in a laminar flow hood for 30 min. After drying, the callus was transferred to co-culture medium covered with a layer of sterile filter paper, incubated overnight at 20°C in the dark, and then transferred to a 25°C incubator for further dark incubation for 2 days.

[0057] 4. Cleaning: After co-culturing, transfer the callus tissue to an empty sterile container using forceps. Wash the callus repeatedly with sterile distilled water 7-8 times, with the first 3 washes being quick and the subsequent 3-4 washes involving soaking for 3-5 minutes each. Finally, soak the callus in sterile distilled water containing 500 mg / L Cn for 30 minutes. Discard the solution, blot the surface of the callus as dry as possible with sterile filter paper, cover the callus surface with another layer of sterile filter paper, and air dry in a laminar flow hood for 1 hour.

[0058] 5. Screening: Place the cleaned callus on the screening medium and incubate at 32°C under light for 14 days.

[0059] 6. Differentiation: After 14 days of screening, the resistant callus was transferred to differentiation medium and cultured at 28°C (photocycle of 14h light / 10h dark).

[0060] 7. Rooting: When the resistant callus forms a 3-4 cm tall regenerated seedling on the differentiation medium, transfer it to the rooting medium for culture until a complete plant is formed.

[0061] Field rice planting survey

[0062] Wild-type rice varieties Koshihikari and LG31, along with transgenic lines NIL-GTW5LG31, NIL-gtw5Koshihikari, CP-gtw5Koshihikari, and CP-gtw5Koshihikari constructed by our research group, were planted at the Shanghai Songjiang Experimental Base of the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences, with 24 plants of each line for phenotypic evaluation and gene identification.

[0063] Some of the PCR primers used in the construction of the GTW5 transgenic lines in the examples are listed in Table 1.

[0064] Table 1. Some PCR primers used in the examples

[0065]

[0066]

[0067] In Table 1, "-F" in the name represents positive; "-R" represents negative.

[0068] Example

[0069] Experimental Materials and Methods

[0070] 1. Materials

[0071] Rice seeds from 573 backcross recombinant inbred lines were examined for grain length, width, thickness, and thousand-grain weight, and linkage analysis was performed. For grain phenotypic analysis, seeds from all tillers of a single plant were harvested, dried at 37℃ for one week, and empty, shriveled, and small / deformed grains were removed. 200 grains were randomly selected for analysis. Grain length and width with husk were determined using a Wanshen automated seed analyzer; grain thickness with husk was determined using a KORIDIAL CALIPER; brown rice grain length, width, and thickness were determined using a SATAKE automated seed analyzer; and grain weight was determined using an electronic balance.

[0072] 2. Scanning electron microscopy observation experiment

[0073] (1) Take 10 mature seeds, wash them, and place them in a 42℃ oven for 2-3 days to dry them thoroughly.

[0074] (2) Stick black double-sided tape on the copper platform, place the seeds on the double-sided tape, and vacuum spray gold coating;

[0075] (3) The sample was observed and photographed using a Hitachi S-2460 scanning electron microscope.

[0076] 3. Semi-thin section experiment

[0077] (1) Fixation of plant materials

[0078] Before the rice material heads, take one-third of the grains from the young panicle, cut off the appropriate tip with scissors, and place the grains in a centrifuge tube containing FAA fixative. Keep the centrifuge tube semi-sealed, and evacuate the tube to allow the material to sink to the bottom. After evacuation, replace the FAA fixative with fresh solution immediately and store at 4°C.

[0079] (2) Dehydration and embedding

[0080] Transfer the material to a 2 mL EP tube. Change solutions quickly and keep the experimental environment dry; use a dehumidifier on rainy days. Dehydrate the material sequentially with 30%, 50%, 70%, 80%, 90%, 95%, and 100% ethanol for 15 minutes each, inverting the EP tube several times and gently shaking it during each step. Then, dehydrate three times with 100% acetone for 20 minutes each time, inverting the EP tube several times and gently shaking it during each step. Afterwards, use 1 mL of a 1:3 (Epon812:acetone) mixture to slowly infiltrate for 3-4 hours with gentle shaking. Then, use 1 mL of a 1:1 (Epon812:acetone) mixture to slowly infiltrate for 3-4 hours or overnight by inverting the EP tube several times. Next, use 1 mL of a 3:1 (Epon812:acetone) mixture to slowly infiltrate for 4-8 hours by inverting the EP tube several times. Then, use 1 mL of pure Epon812 resin to slowly infiltrate overnight by inverting the EP tube several times. In the morning, use 1 mL of pure Epon812 resin to slowly infiltrate overnight by inverting the EP tube several times. Then, in the next morning, use pure Epon812 resin to slowly infiltrate. Embedding can be scheduled for the afternoon. When embedding, carefully pick the sample (which is very brittle and fragile) out of the resin with a toothpick, rub it on absorbent paper, and then place it at either end of the small groove on the embedding plate, not in the middle (the sectioning direction is from the outside in). Record the groove number corresponding to the sample.

[0081] Place the embedding plate steadily into the oven and adjust the oven temperature to polymerize the resin. Dry in the oven at 35℃ overnight, then at 48℃ for about 8 hours, and then at 60℃ for 48 hours.

[0082] (3) Slicing and selecting slices

[0083] Trim the resin block according to the tissue size, shaping the sides into a cone and the front into a cube or square. If there is excess resin, remove it with sandpaper. Slice the tissue using an ultramicrotome, transfer the slices to clean glass slides, spread and dry them on a heated stage; select slides containing the target material for the next stage of the experiment.

[0084] (4) Staining and mounting

[0085] After staining with 0.25% toluidine blue solution for 2 minutes, wash three times with water for 2 minutes each time, and dry. Mount with resin and observe under a microscope.

[0086] 4. In situ hybridization experiment

[0087] (1) Probe synthesis

[0088] When designing transcription templates, amplification primers should be designed at the 3' end of the candidate gene's CDS. The reverse primers should include a T7 polymerase promoter, be 500-800 bp in length, have a GC content of less than 60%, and require high specificity. The transcription template should not contain primer dimers or non-specific bands; if present, the gel should be excised and recovered. After PCR amplification, gel electrophoresis should be performed, and the gel should be excised and recovered at the highest possible concentration (total amount >= 10 ng).

[0089] (2) Organizational processing

[0090] The tissues were fixed, dehydrated, embedded, and sectioned. Fresh young rice panicles of appropriate size were placed in FAA fixative and sectioned using Leica fixative. Stepwise dehydration was performed using an ASP200S fully sealed automatic tissue dehydrator; embedding was performed using a Leica EG1150H paraffin embedding machine. The machine and embedding frame were preheated. After the paraffin in the paraffin chamber was completely melted, the embedding frame was removed, molten paraffin was added, and the material was placed into the embedding frame using preheated tweezers. The frame was then placed on a cold stage. After the paraffin was completely solidified, the sample name and time were labeled, and the material was stored at 4°C. The embedded material was removed and allowed to equilibrate at room temperature. The material was trimmed according to the size of the young spikelets, making it as small and flat as possible. Then, the material was continuously sectioned using a paraffin microtome, with each section being 7 μm thick. The sections were observed under a stereomicroscope. A paraffin ribbon containing the material was selected, and a suitable length was placed with the smooth side down on a poly-L-lysine slide. DEPC-treated distilled water was added to make the ribbon float, and the slide was spread on a 42°C spreader. After the ribbon was fully spread, excess water was removed, and the slide was dried overnight on a 42°C hot plate and stored at 4°C.

[0091] (3) Pre-hybridization treatment

[0092] The sections require dewaxing and rehydration. This involves dewaxing in xylene and graded ethanol, followed by soaking in pure water and DEPC-treated water. Next, the tissue is boiled with a retrieval solution and digested with proteinase K to expose nucleic acids.

[0093] (4) Hybridization

[0094] Prehybridization was performed in the prehybridization solution, followed by the addition of hybridization solution containing the probe, and hybridization was carried out overnight in an incubator. After hybridization, the sample was washed with SSC solutions of different concentrations to remove unbound probes.

[0095] (5) Detection

[0096] Finally, seal the slide by adding 2 drops of sealing agent, gently covering it with a coverslip to avoid air bubbles, and drying it overnight in a fume hood; observe and photograph under a microscope.

[0097] Experimental results

[0098] 1. Construction of the genetic population and identification of the granulation gene GTW5

[0099] In this laboratory, 573 backcross recombinant inbred lines (BILs) and 208 single-segment replacement lines (CSSLs) were constructed using the japonica rice varieties Koshihikari and LG31 as parents. Phenotypic and genotypic examinations of the 573 BILs for grain shape-related traits were conducted, and linkage analysis of the phenotype and genotype identified a locus on chromosome 5 controlling grain thickness and thousand-grain weight, named GTW5 (Grain Thickness and Weight on Chromosome 5). Using the CSSL population, candidate genes for GTW5 were identified through map-based cloning. This gene encodes a WOX (WUSCHEL-related homeobox) transcription factor. The identification process for the GTW5 gene is as follows: Figure 1 As shown.

[0100] The NCBI accession number for the gene GTW5 derived from Koshihikari is Os05g0564500 / LOC_Os05g48990, the nucleotide sequence of the whole gene is SEQ ID NO:3, the nucleotide sequence of the coding region (CDS) is SEQ ID NO:2, and the amino acid sequence of the encoded transcription factor GTW5 is shown in SEQ ID NO:1.

[0101] The NCBI accession number for the gene GTW5 derived from Longjing 31 is LOC9266766. The nucleotide sequence of the whole gene is SEQ ID NO:6, the nucleotide sequence of the coding region (CDS) is SEQ ID NO:5, and the amino acid sequence of the encoded transcription factor GTW5 is shown in SEQ ID NO:4.

[0102] The GTW5 gene from Koshihikari and the GTW5 gene from Longjing 31 are two SNP molecular marker sequences. The difference between the two SNP marker sequences is the 1327th base (G / A) in the coding region (CDS) nucleotide sequence. This SNP site causes the difference between peptide SEQ ID NO:1 and peptide SEQ ID NO:4 to be the V / M of the 443rd amino acid residue.

[0103] 2. Investigation of granule type traits in two NIL genotypes

[0104] To investigate the function of GTW5, during the fine mapping process, we constructed candidate genotypes for chromosome 5 with LG31 as the background, namely the LG31 genotype (NIL-GTW5). LG31 ) and Koshihikari genotype (NIL-gtw5) KoshihikariTwo near-isogenic lines were planted and harvested at the Shanghai Songjiang Experimental Base of the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences. The grain shape of the two NILs was then investigated. Figure 2 (AB), experiments found it to be similar to NIL-GTW5 LG31 In comparison, NIL-gtw5 Koshihikari The thickness of the husk-covered grains and the thickness of the brown rice grains decreased by 4.66% respectively. Figure 2 (C) and 4.36% ( Figure 2 In the middle (D), the thousand-grain weight of rice with husk and the thousand-grain weight of brown rice decreased by 4.49% respectively. Figure 2 (E) and 4.95% ( Figure 2 (F).

[0105] 3. Haplotype GTW5 in NIL-GTW5 LG31 Genetically modified verification in China

[0106] We will convert gtw5 in Koshihikari to NIL-GTW5 LG31 (This conversion is named CP-gtw5) Koshihikari ). with NIL-GTW5 LG31 In comparison, CP-gtw5 Koshihikari Both strains, whether hulled or brown rice, showed similar grain thickness. Figure 3 Both the AB content and the thousand-grain weight decreased. Compared with the control, CP-gtw5 Koshihikari -1 and CP-gtw5 Koshihikari The thickness of the shelled grains decreased by 8.3% and 7.1% respectively at -2. Figure 3 In the middle (C), the thickness of brown rice grains decreased by 5.2% and 5.3%, respectively. Figure 3 (D); the thousand-grain weight with shell decreased by 16.9% and 11.5% respectively. Figure 3 In the middle (E), the thousand-grain weight of brown rice decreased by 16.1% and 12.3% respectively. Figure 3 (F). The above results indicate that the gtw5 haplotype function from Koshihikari can complement NIL-GTW5. LG31 The phenotype of this organism resulted in a decrease in grain thickness, grain width, and thousand-grain weight.

[0107] In this transgenic experiment, the method for constructing the complementary vector includes the following steps.

[0108] Leaves of Koshihikari were collected, and genomic DNA was extracted using the CTAB method. Two pairs of segmented primers were designed. First, primer pairs P1300-CP-WOX9C-EcoR1-F1 and P1300-CP-WOX9C-R1 were used, followed by primer pairs P1300-CP-WOX9C-F2 and P1300-CP-WOX9C-BamH1-R2, to amplify the genomic DNA.

[0109] Forward P1300-CP-WOX9C-EcoR1-F1:

[0110] TATGACCATGATTACGAATTCGAACACATCAGAGCGTGCAAAC,

[0111] Reverse P1300-CP-WOX9C-R1: ATAGATGTTGTTGGTCAAAGTAGCATC.

[0112] Forward P1300-CP-WOX9C-F2:

[0113] CTTTGACCAACAACATCTATATAAAAGTAAGATGTTTTAAATAAAATGAGGTTG,

[0114] Reverse P1300-CP-WOX9C-BamH1-R2:

[0115] CAGGTCGACTCTAGAGGATCCCTTGAGCTCTACGCCCGAATC.

[0116] The PCR reaction conditions are as follows:

[0117] Pre-denaturation at 95℃ for 5 minutes;

[0118] 95℃ denaturation for 30s, 65℃ annealing for 30s, 72℃ extension (1min / 1kb), 3 cycles;

[0119] 95℃ denaturation for 30s, 63℃ annealing for 30s, 72℃ extension (1min / 1kb), 3 cycles;

[0120] 95℃ denaturation for 30s, 61℃ annealing for 30s, 72℃ extension (1min / 1kb), 3 cycles;

[0121] 95℃ denaturation for 30s, 58℃ annealing for 30s, 72℃ extension (1min / 1kb), 35 cycles;

[0122] Extend at 72℃ for 5 minutes, then store at 10℃.

[0123] Using the two PCR products mentioned above as templates, the same PCR program was used to amplify the PCR products with primer pairs P1300-CP-WOX9C-EcoR1-F1 and P1300-CP-WOX9C-BamH1-R2. The PCR products were then subjected to 1% agarose gel electrophoresis, and the bands were recovered from the gel. The pCAMBIA1300 vector was digested with the EcoR1 and BamH1 restriction enzymes and recovered by column chromatography. The PCR products recovered from the gel and the enzyme digestion products recovered from the column were ligated using a homologous recombinase (Novizan C112) at 37°C for 30 min. The ligation product was then transformed into competent E. coli cells, and single clones were selected for sequencing verification. The correctly sequenced plasmid was sent to Wuhan Boyuan Biotechnology Co., Ltd., and transgenic rice was obtained.

[0124] 4. The GTW5 gene affects cell division, thereby regulating grain size.

[0125] The size of plant organs is determined by both the number of cells resulting from cell division and the cell size resulting from cell elongation. Our previous research has shown that the size of rice grains is limited by the number and size of glume cells. To further investigate the effect of GTW5 at the glume cell level, we selected the top third of grains from the young panicle one day before heading for a semi-thin section experiment. Figure 4 (AB). Statistical analysis revealed that, compared with NIL-GTW5 LG31 In comparison, NIL-gtw5 Koshihikari The number of outermost thin-walled cells decreased significantly, but the cell size did not change. Figure 4 Medium EF).

[0126] To further investigate NIL-GTW5 LG31 and NIL-gtw5 Koshihikari Changes in cell number and size were observed in the epidermal cells of mature grain hulls using scanning electron microscopy. Figure 4 (CD). In the statistical analysis, the number of palea and lemma cells was counted based on the longest point on the transverse axis (grain length direction) and the widest point on the longitudinal axis (grain width direction). The analysis revealed that NIL-GTW5... LG31 and NIL-gtw5 Koshihikari There was no significant difference in cell number along the horizontal axis. Figure 4 (G), but in the vertical direction, it is similar to NIL-GTW5 LG31 In comparison, NIL-gtw5 Koshihikari The number of cells decreased significantly. Figure 4 (H). Furthermore, observing cell size at the same location in the center of the glume surface revealed NIL-GTW5. LG31 and NIL-gtw5 Koshihikari No significant difference ( Figure 4 (H).

[0127] The above results indicate that GTW5 regulates seed size by negatively controlling cell number, and has no significant effect on cell size.

[0128] 5. Spatiotemporal expression pattern of gene GTW5

[0129] To further investigate the specific expression period and site of GTW5 during spikelet development, sequence-specific primers were designed at the 3' end and 3' UTR region of GTW5 to prepare digoxigenin-labeled RNA probes for NIL-GTW5 expression. LG31 and NIL-gtw5 Koshihikari In situ hybridization was carried out on young spikelets at different stages.

[0130] In NIL-GTW5 LG31 and NIL-gtw5 Koshihikari GTW5 expression was similar in the middle stage. During the Sp7 stage of carpel primordia formation, GTW5 was expressed in the palea, lemma, stamen, and pistil. Figure 5 In the early Sp8 stage of ovule and pollen formation, GTW5 is expressed in the epidermal cells of the palea and lemma, as well as in the stamens and pistils. Figure 5 (B, F); with the differentiation of floral organs, the expression of GTW5 gradually decreases ( Figure 5 (C, G). In in situ hybridization experiments, the sense probe is used as a negative control (C, G). Figure 5 In the NIL-GTW5 assay, the marker gene Histone H4 (Marzluff & Duronio, 2002), used as a positive control, was used as a marker gene for cell division activity. LG31 Its high activity can be detected in the young spikelets. Figure 5 (H).

[0131] The above results indicate that GTW5 is expressed in the palea, lemma, pistil, and stamen during the development of young spikelets. The signal is more obvious in the palea and lemma in the early stage of Sp8, indicating that GTW5 regulates the development of palea and lemma and controls grain shape.

[0132] 6. GTW5 from LG31 is a rare variant site.

[0133] During population genetic analysis of GTW5 rice, the genotype "A" from LG31 was found to be a rare variant. In the entire rice genome, only one indica rice variety has the "A" genotype, while all others have the "G" genotype. In japonica rice, however, there is differentiation between the "A" and "G" genotypes, with the "A" genotype accounting for approximately 5%. Since the phenotype "A" corresponds to large grains, the aim was to evaluate the phenotypic effect of introducing this genotype into indica and "G" genotype varieties. Therefore, two BILs, BIL-79 and BIL-23, with a predominantly Koshihikari background and LG31 at the end of chromosome 5, were selected from 573 BILs. These BILs were repeatedly backcrossed with Koshihikari to evaluate GTW5 within the Koshihikari genome. LG31 Phenotypic effects.

[0134] Two generations of backcrossing and one generation of self-crossing were performed on BIL-79 and BIL-23, resulting in the names BIL-LG31-1 and BIL-LG31-2. Grain morphology was examined, revealing that compared to Koshihikari, BIL-LG31-1 exhibited a 2.3% increase in grain thickness, and BIL-LG31-2 showed a 4.3% increase in grain thickness. Figure 6 (AB); ultimately, this resulted in an increase in the thousand-grain weight of both BIL-LG31-1 and BIL-LG31-2. Figure 6 (CD). This shows that the GTW5 from LG31 has greater potential for increased production compared to the GTW5 from Koshihikari.

[0135] Although the above embodiments only use rice as an example to illustrate the technical solution of the present invention, the technical solution of the present invention is also applicable to other gramineous crops such as wheat, corn, barley, oats, rye, sorghum, and millet, without departing from the spirit of the present invention. Therefore, those skilled in the art can make various modifications or alterations to the present invention based on this, and the equivalent forms of various variations or modifications should also fall within the scope of the present invention.

[0136] References

[0137] 1.Li,N.&Li,Y.Signaling pathways of seed size control in plants.CurrOpin Plant Biol33,23-32(2016).

[0138] 2.Fan,C.et al.GS3,a major QTL for grain length and weight and minorQTL for grain width and thickness in rice,encodes a putative transmembraneprotein.Theor Appl Genet 112,1164-71(2006).

[0139] 3.Mao,H.et al.Linking differential domain functions of the GS3protein to natural variation of grain size in rice.Proc Natl Acad Sci U S A107,19579-84(2010).

[0140] 4.Song,X.J.,Huang,W.,Shi,M.,Zhu,M.Z.&Lin,H.X.A QTL for rice grainwidth and weight encodes a previously unknown RING-type E3 ubiquitinligase.Nat Genet 39,623-30(2007).

[0141] 5.Duan,P.et al.Natural Variation in the Promoter of GSE5 Contributesto Grain Size Diversity in Rice.Mol Plant 10,685-694(2017).

[0142] 6.Liu,J.et al.GW5 acts in the brassinosteroid signalling pathway toregulate grain width and weight in rice.Nat Plants 3,17043(2017).

[0143] 7.Shomura,A.et al.Deletion in a gene associated with grain sizeincreased yields during rice domestication.Nat Genet 40,1023-8(2008).

[0144] 8.Weng,J.et al.Isolation and initial characterization of GW5,a majorQTL associated with rice grain width and weight.Cell Res 18,1199-209(2008).

[0145] 9.Ishimaru,K.et al.Loss of function of the IAA-glucose hydrolase geneTGW6enhances rice grain weight and increases yield.Nat Genet 45,707-11(2013).

[0146] 10.Wang,S.et al.The OsSPL16-GW7 regulatory moduledetermines grainshape and simultaneously improves rice yield and grain quality.Nat Genet 47,949-54(2015).

[0147] 11. Yuexing Wang, GX, Jiang Hu1,5, Liang Jiang2,3, Hong Yu2,3, Jie Xu1, Yunxia Fang1, Longjun Zeng4, Erbo Xu1, Jing Xu1, Weijun Ye1, Xiangbing Meng2,3, Ruifang Liu1,4, Hongqi Chen1, Yanhui Jing2,3, Yonghong Wang2,3, Xudong Zhu1, Jiayang Li2,3 & Qian Qian1,4. Copy number variation at the GL7 locus contributes to grain size diversity in rice. Nature Genetics (2015).

[0148] 12. Zhou, Y. et al. Natural Variations in SLG7 Regulate Grain Shape in Rice. Genetics 201, 1591-9 (2015).

[0149] 13. Si, L. et al. OsSPL13 controls grain size in cultivated rice. Nat Genet 48, 447-56 (2016).

Claims

1. A method for increasing the thousand-grain weight and / or grain thickness of gramineous crops, characterized in that, The process includes the following steps: downregulating, inactivating, weakening or knocking out the expression of the transcription factor GTW5 (Grain Thickness and Weight on Chromosome 5, GTW5) gene in the chromosomes of grass crops.

2. The method as described in claim 1, characterized in that, The gramineous crops mentioned are selected from the following group: rice, wheat, corn, barley, oats, rye, sorghum, and millet.

3. The method as described in claim 1, characterized in that, The gramineous crop mentioned is rice, specifically japonica and indica rice.

4. The method as described in claim 3, characterized in that, The gramineous crop mentioned is the japonica rice variety Koshihikari or the japonica rice variety LG31. The amino acid sequence of transcription factor GTW5 derived from the japonica rice variety Koshihikari is shown in SEQ ID NO:1, and the NCBI accession number is Os05g0564500 or LOC_Os05g48990. The amino acid sequence of transcription factor GTW5 derived from the japonica rice variety LG31 is shown in SEQ ID NO:4, and the NCBI accession number is LOC9266766.

5. The method as described in claim 4, characterized in that, The nucleotide sequence of the GTW5 gene containing introns from the japonica rice variety Koshihikari is SEQ ID NO:3, and the nucleotide sequence of its coding region, i.e., the CDS sequence, is SEQ ID NO:2; the nucleotide sequence of the GTW5 gene containing introns from the japonica rice variety LG31 is SEQ ID NO:6, and the nucleotide sequence of its coding region, i.e., the CDS sequence, is SEQ ID NO:

5.

6. The method as described in claim 5, characterized in that, The transcription factor GTW5 gene is used as a target gene for breeding high-yield new rice varieties.

7. The method as described in claim 1, characterized in that, Implemented in the following manner: (1) Knock out the GTW5 gene in the chromosomes of wild-type grasses; (2) Down-regulate the expression level of the GTW5 gene in the chromosomes of wild-type grasses; (3) Replace the GTW5 gene in the chromosomes of wild-type grasses with a GTW5 mutant that encodes a gene with lost or downregulated function; and / or (4) Block, suppress or interfere with the expression of the GTW5 gene in the chromosomes of wild-type grasses.

8. The method as described in claim 7, characterized in that, Method (2) is selected from the following group: (2-1) Mutations in the promoter region and / or coding region of the GTW5 gene lead to downregulation of the expression level of the GTW5 gene; (2-2) Mutations in the upstream regulators of the GTW5 gene lead to a downregulation of GTW5 expression; or (2-3) Introduce GTW5 interacting proteins into wild-type grasses to alter the function of the GTW5 gene.

9. The method as described in claim 6, characterized in that, The steps are implemented through gene editing technology, antisense nucleic acids, and transcriptional regulation.

10. The method as described in claim 8, characterized in that, When the grass crop is rice, the GTW5 gene from Longjing 31 (LG31) SEQ ID NO:5 or SEQ ID NO:6 is used to replace the GTW5 gene in other rice varieties such as Koshihikari.

Images