Method for improving salt tolerance of plant roots

CN122811235APending Publication Date: 2026-09-25CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610297402.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-03-24
Filing Date
2026-03-12
Publication Date
2026-09-25

AI Technical Summary

Benefits of technology

[0027]本研究通过对植物体内WNK及MAP4K蛋白激酶家族成员进行突变,发现WNK-MAP4K信号轴在调控根系盐胁迫响应中的关键作用。实验结果表明,特异性调控这些激酶的表达水平可显著降低根系对盐胁迫的敏感性,并诱导根系产生向低盐区域定向生长的趋避反应,从而在盐渍化生境中提高其生物量。值得注意的是,WNK多重突变体在常规培养条件下未表现出明显的生长发育异常,但在100 mM NaCl胁迫处理中,与野生型对照形成鲜明对比,其主根生长方向发生显著偏转。我们通过失活水稻中WNK4基因,发现OsWNK4的突变能够显著增强水稻苗期的耐盐能力,表明某些WNK蛋白激酶或者MAP4K蛋白激酶失活可以提高植物根系和植株耐盐性,为培育耐盐胁迫植物新品种提供了基因资源,具有应用前景。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses the use of WNK protein kinase or MAP4K protein kinase which can interact with WNK protein kinase and is modified by WNK phosphorylation in improving the salt tolerance of plant roots, and the change of the activity of the MAP4K protein kinase can improve the salt tolerance of plant roots, thereby providing a gene resource for cultivating new plant varieties resistant to salt stress.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology and relates to the use of WNK protein kinase or MAP4K protein kinase that can interact with WNK and be phosphorylated by WNK in improving the salt tolerance of plant roots. Background Technology

[0002] Abiotic stresses (such as drought, high salinity, and low temperature) pose a significant threat to global food security. Plants enhance their tolerance to salt stress primarily through two adaptive strategies: first, by actively regulating intracellular free sodium ion concentration through vacuolar compartmentalization or plasma membrane efflux mechanisms, thereby reducing organelle damage and maintaining normal growth and development; second, by regulating root tropism in response to sodium ions, optimizing the spatial distribution of roots in heterogeneous salt environments. Since sodium ions in saline-alkali soils often exhibit a non-uniform distribution, plants can guide root extension towards low-sodium regions by dynamically adjusting the root's sodium ion sensitivity threshold. This is of great significance for improving crop yields in saline-alkali farmland.

[0003] In nature, abiotic stresses such as drought, high salinity, and chilling injury induce osmotic stress responses in plants (Assmann et al., 2016; Hasegawa et al., 2000; Thomashow, 1999). In the laboratory, researchers typically simulate osmotic stress using high concentrations of mannitol, sorbitol, polyethylene glycol (PEG), sugars, sodium chloride, and dehydration treatments. Therefore, artificially simulated osmotic stress inevitably leads to some non-endogenous results. For example, mannitol is both a sugar metabolite and a fungal metabolite (Patel et al., 2016), and sodium chloride, in addition to osmotic stress, also causes ion stress (Zhou et al., 2024b). Summary of the Invention

[0004] Our research group integrated phosphorylogomics data after treatments with mannitol (Lin et al., 2020; Wang et al., 2020), dehydration (Umezawa et al., 2013), salt stress (Wang et al., 2020), and cold stress (Wang et al., 2020) to identify a class of protein kinases, MAP4Ks, simultaneously activated by four osmotic stress mimicking mechanisms. Through genetic and biochemical analysis, we have preliminarily elucidated that the WNK-MAP4K kinase cascade participates in the early osmotic stress response in plants. Specifically, this invention provides the following technical solution.

[0005] This invention primarily provides the use of WNK protein kinase, or MAP4K protein kinase that interacts with WNK (With No Lysine (K) kinase or With-No-Lysine kinase, WNK) protein kinase and is phosphorylated by WNK, in improving the salt tolerance of plant roots, i.e., salt stress resistance.

[0006] In one implementation, WNK and MAP4K form a WNK-MAP4K signaling axis, which participates in the early osmotic stress response of plants through the WNK-MAP4K kinase cascade reaction and regulates the direction of root growth under salt stress.

[0007] The aforementioned plants can be crop plants, model plants, monocotyledonous plants, dicotyledonous plants, plants with crassulacean acid metabolism (CAM) photosynthesis, plants with C3 photosynthesis, plants with C4 photosynthesis, annual plants, greenhouse plants, horticultural flowering plants, perennial plants, switchgrass plants, maize plants, biomass plants, or sugarcane plants.

[0008] In some of the above-mentioned embodiments, the plants are selected from the group consisting of: switchgrass, miscanthus, alfalfa, sweet sorghum, sorghum, sugarcane, energy sugarcane, elephant grass, corn, cassava, cowpea, wheat, barley, oats, rice, soybean, oil palm, safflower, sesame, tobacco, flax, cotton, sunflower, flaxseed, rapeseed, Ethiopian mustard, mustard greens, pearl millet, millet, foliage plants, Arabidopsis thaliana, oilseeds, vegetable crops, forage crops, industrial crops, woody crops, or biomass crops.

[0009] When the plant is Arabidopsis thaliana, the WNK protein kinases are selected from the following group: WNK1 (20025 version NCBI accession number AT3G04910), WNK5 (20025 NCBI accession number AT3G51630), WNK8 (20025 NCBI accession number AT5G41990), and WNK9 (20025 NCBI accession number AT5G28080); the MAP4K protein kinase is a combination of MAP4K1 (20025 NCBI accession number AT1G53165), MAP4K4 (20025 NCBI accession number AT5G14720), and MAP4K5 (20025 NCBI accession number AT4G24100), i.e., MAP4K1 / 4 / 5.

[0010] When the plant is rice, the WNK protein kinase is selected from the group consisting of: WNK1 (version LOC_Os07g38530, 2025 NCBI accession number LOC_Os05g01780), WNK3 (version LOC_Os07g08750, 2025 NCBI accession number LOC_Os02g45130), WNK5 (version LOC_Os07g08750, 2025 NCBI accession number LOC_Os02g45130), and WNK5 (version LOC_Os07g08750, 2025 NCBI accession number LOC_Os07g08750). The preferred versions are g39520, WNK6 (2025 NCBI login number LOC_Os11g06140), WNK7 (2025 NCBI login number LOC_Os11g02300), WNK8 (2025 NCBI login number LOC_Os12g02250), WNK9 (2025 NCBI login number LOC_Os12g06490), and OsWNK4 (2025 NCBI login number LOC_Os02g45130).

[0011] As a specific implementation method, the application is a method for improving the salt tolerance of plant roots by targeting the above-mentioned WNK or MAP4K genes, or a method for breeding new varieties of salt-tolerant plants, including the following steps: downregulating, inactivating, weakening or knocking out the expression of WNK or MAP4K genes in the chromosomes of wild-type plants.

[0012] In one embodiment, inactivation of the WNK or MAP4K gene causes activation of protein kinase SnRK2, for example, activation of ABA (abscisic acid) downstream core protein kinase SnRK2.

[0013] Preferably, the downregulation, inactivation, weakening or knockout of the WNK or MAP4K gene expression causes the plant's taproot to change its growth direction toward a low-salt environment, enabling the plant to grow even in a high-salt environment.

[0014] Alternatively, methods to improve the salt tolerance of plant roots, i.e., salt stress resistance, can be implemented in the following ways:

[0015] (1) Knock out the WNK or MAP4K gene described in the chromosome of wild-type plants, such as the gene cluster MAP4K1 / 4 / 5 in Arabidopsis thaliana;

[0016] (2) Downregulate the expression level of genes WNK or MAP4K in the chromosomes of wild-type plants, such as the gene cluster MAP4K1 / 4 / 5 in Arabidopsis thaliana;

[0017] (3) Replace the WNK or MAP4K gene in the chromosome of wild-type plants with a WNK or MAP4K mutant that has lost or downregulated coding function, for example, the gene cluster MAP4K1 / 4 / 5 in Arabidopsis thaliana; and / or

[0018] (4) Block, inhibit or interfere with the expression of genes WNK or MAP4K in the chromosomes of wild-type plants, such as the gene cluster MAP4K1 / 4 / 5 in Arabidopsis thaliana.

[0019] Furthermore, the above method (2) can be selected from the following group:

[0020] (2-1) Mutations in the promoter region and / or coding region of genes WNK or MAP4K, such as the gene cluster MAP4K1 / 4 / 5 in Arabidopsis thaliana, lead to downregulation of the expression level of genes WNK or MAP4K, such as the gene cluster MAP4K1 / 4 / 5 in Arabidopsis thaliana.

[0021] (2-2) Mutations in upstream regulators of genes WNK or MAP4K, such as the MAP4K1 / 4 / 5 gene cluster in Arabidopsis thaliana, lead to downregulation of the expression levels of genes WNK or MAP4K, such as the MAP4K1 / 4 / 5 gene cluster in Arabidopsis thaliana; or

[0022] (2-3) Introduce the interacting proteins of WNK or MAP4K, such as MAP4K1 / 4 / 5 in Arabidopsis thaliana, into wild-type plants to alter the function of the gene WNK or MAP4K, such as the gene cluster MAP4K1 / 4 / 5 in Arabidopsis thaliana.

[0023] Furthermore, the mutation in the coding region described in the above method (2-1) is a frameshift mutation, which leads to the inactivation or loss of function of the WNK or MAP4K, such as MAP4K1 / 4 / 5 in Arabidopsis thaliana.

[0024] Preferably, the above methods (1), (2), (3) and / or (4) are implemented through gene editing technology, antisense nucleic acid, and transcriptional regulation.

[0025] While it is theoretically possible to improve the salt tolerance of plant roots by inducing mutations in the plant genome, such as by overexpressing exogenous genes like WNK or MAP4K mutants, the steps of downregulating, inactivating, weakening, or knocking out the expression of WNK or MAP4K genes in the chromosomes of wild-type plants, such as the MAP4K1 / 4 / 5 gene cluster in Arabidopsis thaliana, are preferably implemented through gene editing technology, antisense nucleic acids, and transcriptional regulation.

[0026] In one implementation, the gene editing technology described above may be selected from the group consisting of: homologous double crossover, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, and MuGENT.

[0027] This study investigated the crucial role of the WNK-MAP4K signaling axis in regulating root salt stress response by mutating members of the WNK and MAP4K protein kinase families in plants. Experimental results showed that specifically regulating the expression levels of these kinases significantly reduced root sensitivity to salt stress and induced a tendency for roots to grow towards lower salinity areas, thereby increasing biomass in saline habitats. Notably, while the WNK multiple mutants did not exhibit significant growth and developmental abnormalities under conventional culture conditions, they showed a marked deviation in taproot growth direction compared to the wild-type control under 100 mM NaCl stress treatment. Furthermore, by inactivating the WNK4 gene in rice, we found that mutations in OsWNK4 significantly enhanced salt tolerance in rice seedlings, indicating that inactivation of certain WNK or MAP4K protein kinases can improve root and plant salt tolerance, providing genetic resources for breeding new salt-tolerant plant varieties with promising applications. Attached Figure Description

[0028] Figure 1 This section presents the analysis and identification of MAP4K protein kinases discovered through integrated phosphatomics. A: The Venn diagram integrates published phosphatomics data on mannitol (Lin et al., 2020; Wang et al., 2020), dehydration (Umezawa et al., 2013), salt stress (Wang et al., 2020), and cold stress (Wang et al., 2020) treatments. A total of 103 proteins showed phosphorylation levels induced by mannitol, dehydration, salt stress, and cold stress simultaneously. B: Further functional annotation revealed that only 14 of the 103 proteins are protein kinases, and three of these belong to the MAP4K protein family.

[0029] Figure 2 The growth phenotypes of different combinations of Arabidopsis MAP4K family members mutants are shown. A: A summary table of information on phosphorylation induced by four treatments (mannitol, dehydration, salt, and cold) for different members of the MAP4K family; B and C: Growth phenotypes of different combinations of MAP4K family members mutants. Figure B is a photograph taken 13 days after germination, scale bar 2 cm; Figure C is a photograph taken 35 days after growth in a short-day incubator, scale bar 2 cm.

[0030] Figure 3This analysis demonstrates the crucial role of MAP4K in plant responses to osmotic stress. A: Cumulative transpiration water loss from detached rosette leaves of 5-week-old WT Col-0, MAP4k1 / 2 knockout double mutants, and MAP4k1 / 4 / 5 triple mutants; B: Survival statistics of 7-day-old WT Col-0, MAP4k1 / 4 / 5 triple mutants, and MAP4k7 / 9 / 10cr4k8 quadruple mutants after dehydration-rehydration. 7-day-old wild-type and mutant seedlings were transferred from a clean bench to a new petri dish lid, then the clean bench was fanned at level 3 for 75 minutes before being transferred back to the culture medium and placed in an incubator. Results were photographed and analyzed one week later. C and D: Wild-type and mutant seedlings grown on 1 / 2 MS plates for 3-4 days were transferred to 1 / 2 MS plates or 1 / 2 MS plates containing 100 mM mannitol or 75 mM NaCl and grown for two weeks before being photographed.

[0031] Figure 4 The results showed that the gene knockout mutant map4k1 / 4 / 5 exhibited a right-handed spiral growth phenotype under salt stress. In section A: Three- to four-day-old wild-type Col-0 and gene knockout mutant map4k1 / 4 / 5 were transferred from 1 / 2 MS plates to 1 / 2 MS plates or 1 / 2 MS plates containing 50, 75, or 100 mM NaCl and grown for one week; In section B: Three- to four-day-old wild-type Col-0 and mutant map4k1 / 4 / 5 were transferred from 1 / 2 MS plates to 1 / 2 MS plates or 1 / 2 MS plates containing 75 mM NaCl, and photographs were taken at time points using a stereomicroscope.

[0032] Figure 5 The study showed that the SnRK2 gene knockout mutation suppressed right-handed motor function in the map4k1 / 4 / 5 mutant under salt stress. The map4k1 / 4 / 5snrk2.2 / 3 / 6 hexaple mutant and the map4k1 / 4 / 5snrk2.2 / 3 / 6(+-)5.5 mutant were obtained by hybridization of map4k1 / 4 / 5 and snrk2.2 / 3 / 6. Among them, the SnRK2.6 mutant in the map4k1 / 4 / 5snrk2.2 / 3 / 6(+-)5.5 mutant was heterozygous, while the other five genes were homozygous. Wild-type and mutant seedlings grown in 1 / 2 MS plates for 3-4 days were transferred to 1 / 2 MS plates or 1 / 2 MS plates containing 75 mM NaCl, and photographed after 7 days of growth.

[0033] Figure 6This study demonstrated that exogenous application of ABA could inhibit right-handed chiral movement in the map4k1 / 4 / 5 mutant under salt stress. Wild-type Col-0 and the map4k1 / 4 / 5 mutant seedlings, aged three to four days, were transferred to 1 / 2 MS plates or plates containing 0.5 μM ABA and 75 mM NaCl, or both, and photographed after two weeks of growth.

[0034] Figure 7 The analysis of the right-handed chiral movement and cell wall-related phenotype of the mutant map4k1 / 4 / 5 under salt stress was presented. Specifically, 3-4 day old wild-type Col-0 and mutant map4k1 / 4 / 5 cells were transferred to 1 / 2 MS plates or 1 / 2 MS plates containing 75 mM NaCl, and simultaneously subjected to 75 mM NaCl and 1 mM EGTA or 10 mM EGTA (A), 1 mM BA, 3 mM BA, 5 mM BA (B), and 10 mM Ca... 2+ (C) The image was taken 5-7 days after growth on 1 / 2 MS plate.

[0035] Figure 8 The results show that the sodium ion content in the mutant map4k1 / 4 / 5 under salt stress is consistent with that of the wild type. Specifically, after 9-day-old wild-type Col-0, map4k1 / 4 / 5, and sos1 seedlings were transferred to 1 / 2 MS medium or 1 / 2 MS medium containing 75 mM NaCl and grown for 12 hours, the sodium ion content in Arabidopsis seedlings was detected by ICP-MS.

[0036] Figure 9 This study demonstrates the interaction between protein kinase WNK and MAP4K, and the phosphorylation of MAP4K. A: MAP4K can interact with WNK. After immunoprecipitation of the MAP4K1, 4, and 5 complexes from 9-day-old 35Spro:MAP4K1-Myc, 35Spro:MAP4K4-Myc, and 35Spro:MAP4K5-Myc transgenic seedlings, mass spectrometry was performed to detect potential interacting proteins. Data on the potential interacting proteome of MAP4K4, 5, 6, 7, 8, and 9 were obtained from (Pan et al., 2024). B: The prokaryotic recombinant protein WNK can phosphorylate MAP4K.

[0037] Figure 10The study showed a phenotype of altered taproot growth direction in the mutant wnk1 / 5 / 8-1 / 9 under salt stress. Wild-type Col-0 seedlings (3-4 days old) and mutant wnk1 / 5 / 8-1 / 9 were transplanted to 1 / 2 MS plates or 1 / 2 MS plates containing 50 mM NaCl, 75 mM NaCl, or 100 mM NaCl and then photographed after 5 days of growth.

[0038] Figure 11 The comparison of salt tolerance phenotypes between rice Oswnk4 mutant and wild-type rice ZH11 seedlings is shown. The left image shows seedlings grown in normal hydroponic nutrient solution; the wild-type is to the left of the dotted line, and the Oswnk4 mutant is to the right. The right image shows seedlings treated with 120 mM NaCl for 8 days; the wild-type is to the left of the dotted line, and the Oswnk4 mutant is to the right. Detailed Implementation

[0039] This study reveals for the first time that the Arabidopsis WNK-MAP4K kinase cascade pathway participates in salt stress response by regulating taproot growth direction. Phylogenetic analysis shows that the key components of this pathway, WNK and MAP4K protein kinases, are highly conserved throughout the evolution from bryophytes to angiosperms, suggesting a potentially universal biological function in regulating salt stress-induced root directional growth. This discovery provides a new target for genetic improvement of crop salt tolerance. Based on this theoretical potential, we have conducted functional verification of rice WNK-MAP4K homologs, aiming to provide a molecular basis for stress resistance breeding in gramineous crops.

[0040] Based on the function of MAP4K1 / 4 / 5, members of the MAP4K kinase family in the model species Arabidopsis thaliana, in negatively regulating root growth and salt tolerance, it is reasonable to expect that MAP4K protein kinase members in many plants with the same function and characteristics, such as interacting with WNK and being phosphorylated by WNK, are also likely to negatively regulate root growth and salt tolerance.

[0041] Therefore, MAP4K mutants that knock out this type of MAP4K gene can improve the salt tolerance of plant roots and plants, thus enabling mutant plants to grow in high-salt environments.

[0042] As used herein, the terms "mutant plant," "mutant plant," "transgenic plant," and "genetically engineered plant" all have the same meaning: plants that have been genetically engineered to exhibit root salt tolerance by knocking out or suppressing the MAP4K gene, either from wild-type (WT) plants or existing plants with a normal phenotype. Correspondingly, the term "wild-type (WT)" refers to existing plants with a normal phenotype and expressing the normal MAP4K gene.

[0043] In some implementations, the term “(salt tolerance / salt stress resistance) improvement” or “enhancement” may mean an improvement of at least 10% compared to a reference level (such as normal plants), for example, an improvement of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100%, or any improvement between 10% and 100%, or an improvement of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times compared to a reference level.

[0044] In this document, for the sake of simplicity, the names of certain proteins, such as MAP4K1 / 4 / 5, and their encoding genes (DNA) are sometimes used interchangeably. Those skilled in the art should understand that they represent different substances in different descriptive contexts. Their meanings are readily understood by those skilled in the art based on the context. For example, when describing the function or category of MAP4K protein kinase members, MAP4K1 / 4 / 5 refers to the protein; when describing it as a gene, it refers to the gene encoding that protein.

[0045] There are various techniques for implementing the knockout, inactivation, and / or non-expression of MAP4K genes such as MAP4K1 / 4 / 5 in plants. These techniques can be used individually or in combination. For example, one inactivation method is to mutate the MAP4K encoding gene, causing an alteration in the amino acid sequence of the polypeptide and / or termination of translation.

[0046] In the description of the technical solutions of this invention, the term "and / or" used in terms such as "A and / or B" or "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B, and / or C" is intended to cover each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0047] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the invention.

[0048] Example

[0049] The examples involve the addition amount, content and concentration of various substances, and unless otherwise specified, the percentage content refers to the mass percentage content.

[0050] In the embodiments described herein, unless otherwise specified, the temperature generally refers to room temperature (15-30°C).

[0051] The molecular biology experiments in this embodiment, including plasmid construction, enzyme digestion, competent cell preparation, and transformation, were mainly conducted in accordance with *Molecular Cloning: A Laboratory Manual* (3rd Edition), edited by J. Sambrook and DW. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002. For example, the methods for competent cell transformation and competent cell preparation were performed according to Chapter 1, page 96 of *Molecular Cloning: A Laboratory Manual* (3rd Edition). Specific experimental conditions could be determined through simple experiments if necessary.

[0052] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments can be made through simple experiments if necessary.

[0053] The primer synthesis and gene sequencing in the examples were commissioned to Sangon Biotech (Shanghai) Co., Ltd. and BGI Genomics.

[0054] Molecular biology methods and transgenic plant construction methods, including the construction of CRISPR-Cas9 system plasmids with gene knockout of MAP4K1-9, SnRK2 and WNK, and gene editing technology, are carried out using techniques commonly used in the field.

[0055] Some of the PCR primers used in the examples are listed in Table 1.

[0056] Table 1. Some PCR primers used in the examples

[0057] Primer name Sequence (5'-3') MAP4K1-F ATGGATGATGTTGCTGGTTT MAP4K1-R TCAACTTTGGTTAAGATCAC MAP4K4-F ATGGAATCGGGTTCAGAGAA MAP4K4-R TCAATCATTTCTGTGTGTTAAT MAP4K5-F ATGGGGTTTCGACTTGTTCTC MAP4K5-R TTAGTGTTCGCGACCCGTGA WNK8-F ATGGCTTCTGGTTCTGGATT WNK8-R TCAAGAGATGTTAACTGCT

[0058] In Table 1, "-F" in the name represents positive; "-R" represents negative.

[0059] Example 1: Screening of proteins and genes affecting salt stress resistance in Arabidopsis thaliana

[0060] In our research on the National Science and Technology Major Project for Agricultural Biotechnology Breeding, entitled "Discovery of New Genes Tolerant to Abiotic Stress and Evaluation of Breeding Value," we used Arabidopsis thaliana, a model species, as our research object. We integrated published phosphorylogomics data on mannitol (Lin et al., 2020; Wang et al., 2020), dehydration (Umezawa et al., 2013), salt stress (Wang et al., 2020), and cold stress (Wang et al., 2020) treatments using Venn diagrams. We found that the phosphorylation levels of a total of 103 proteins were simultaneously induced by mannitol, dehydration, salt stress, and cold stress.

[0061] like Figure 1As shown in Figure A, 103 proteins in Arabidopsis thaliana are simultaneously induced by high concentrations of mannitol, dehydration, salt stress, and cold stress, resulting in phosphorylation modification. We believe these 103 proteins may avoid interference from ion stress, such as that caused by salt stress, and may be core components of the plant's osmotic stress response. Furthermore, after functional annotation of these 103 proteins, we selected those annotated as kinases, including members of the MAP4Ks family, B3 RAF family, B4 RAF family, SnRK2 family, NDR3, PDK2, PRP4KA, and RBB1.

[0062] See Figure 1 In the B group, 14 proteins have been annotated as kinases. Of these, AT4G05150's function remains unannotated, while the functions of the other 13 protein kinases have been studied to some extent. For example, SnRK2.10 and B3, B4 RAF play crucial roles in osmotic stress responses (Fujii et al., 2011; Lin et al., 2020; Soma et al., 2020; Takahashi et al., 2020). CKL2 regulates ABA (abscisic acid) and stomatal closure under drought (Zhao et al., 2016). The function of NDR3, belonging to the AGC protein kinase family, has been less studied, but its homologs NDR2, 4, and 5 have been reported to interact with downstream components of the MAP4K3 / SIK1 signaling group, MOB1A and B, to regulate pollen development and germination (Zhou et al., 2020). PDK2 is a core element regulating AGC protein kinases, modulating polar auxin transport by regulating AGC1 subfamily protein kinases (Xiao et al., 2020). PRP4KA regulates miRNA production by phosphorylating Serrate proteins (Wang et al., 2022b; Zhou et al., 2024a). RBB1 (REGULATOR OF BULB BIOGENESIS1) regulates vacuolar formation in Arabidopsis (Bassham et al., 2015), but its specific biological significance remains unclear. Recently, Guo Yan's research group at China Agricultural University discovered that under salt stress, the free1 mutant formed many small vesicles, which helped it accumulate excess sodium ions, thereby alleviating sodium ion toxicity (Liu et al., 2025). This may provide clues for understanding the role of RBB1 in plant osmotic stress responses. The remaining three protein kinases belong to the MAP4K protein family: MAP4K1, 4, and 5. Therefore, we speculate that MAP4K1, 4, and 5 may be new core regulatory elements in plant responses to osmotic stress.

[0063] Example 2: Obtaining the MAP4K gene knockout mutant

[0064] To investigate the functional characteristics of MAP4Ks protein kinases in response to osmotic stress, we ordered WNK single-gene knockout mutants and single-gene knockout mutants of individual members of MAP4K1-9 from NASC (see website https: / / www.arashare.cn / index / Product / index) according to the "Domestic Arabidopsis Mutant Ordering Guide". Multiple mutants were obtained through hybridization and the transgenic Arabidopsis were identified as having correct mutations at the genomic and transcriptional levels.

[0065] The growth phenotypes of single-gene knockout mutants and multi-gene mutants were compared with those of wild-type Arabidopsis thaliana Col-0.

[0066] Example 3: Growth phenotypes of different combinations of MAP4K family mutants

[0067] Based on the approach of integrating phosphatomics, we discovered that the phosphorylation levels of three proteins, MAP4K1, 4, and 5, are simultaneously induced by high concentrations of mannitol, dehydration, salt stress, and cold stress. Therefore, we believe that MAP4K1, 4, and 5 may represent a novel class of core components responding to osmotic stress.

[0068] Furthermore, we carefully analyzed the specific details of the 10 members of the MAP4K protein family based on integrated phosphatomics data. Figure 2 (A). We found that different members of the MAP4K family responded to different simulated osmotic stresses. Further, we carefully analyzed the phosphorylation modification levels of 10 members of the MAP4K family in response to high concentrations of mannitol, dehydration, salt stress, and cold stress. Members MAP4K7, 8, 9, and 10 did not respond to these four stresses. Surprisingly, after salt stress treatment, only members MAP4K1, 4, and 5 showed changes in phosphorylation modification levels, consistent with our understanding of the core elements of osmotic stress. Different members of the MAP4K family responded differently to the stresses. For example, members MAP4K1, 3 (also known as SIK1), 4, and 5 responded to simulated osmotic stress from mannitol; members MAP4K1, 2, 4, 5, and 6 responded to simulated osmotic stress from cold treatment; and members MAP4K1, 4, 5, and 6 responded to simulated osmotic stress from dehydration treatment. Figure 2 (A). Therefore, based on the structure of integrated phosphatomics, we constructed a series of mutants, including the map4k1 / 2 double mutant, the map4k1 / 4 / 5 triple mutant, the map4k1 / 2 / 4 / 5 / 6 quintuplet mutant, and the map4k7 / 9 / 10cr4k8 quadruple mutant (A). Figure 2(B and C). Due to the dwarfism, wrinkled rosette leaves, and severe flower development defects in the map4k4 / 5 / 6 triple mutant (Vu et al., 2021), we did not consider it. The map4k7 / 9 / 10cr4k8 quadruple mutant was obtained by editing MAP4K8 using CRISPR-Cas9 technology in the map4k7 / 9 / 10 background; the remaining mutant combinations were obtained through hybridization.

[0069] Example 4: Study on the response of MAP4K to osmotic stress in plants

[0070] Because the map4k1 / 2 / 4 / 5 / 6 quintuplet mutant exhibits severe developmental defects, it was not included in subsequent studies. We primarily assessed these mutants using classical osmotic stress response phenotypes, such as the relative water loss rate of detached leaves, survival rate under dehydration stress, and overall plant growth phenotype under high concentrations of mannitol and NaCl. Consistent with the integrated phosphamic data, the map4k7 / 9 / 10 cr4k8 quadruple mutant showed no significant difference in survival rate under dehydration stress or between the map4k7 / 9 / 10 and wild-type Col-0 under high concentrations of mannitol and NaCl treatment. Figure 3 This suggests that, on the one hand, MAP4K7, 8, 9, and 10 may indeed not be involved in the plant's osmotic stress response; on the other hand, it may indicate a limitation of our experimental system, for example, MAP4K7, 8, 9, and 10 are expressed at relatively high levels in floral organs, while our experimental system mainly focuses on the rosette leaves of seedlings and mature seedlings.

[0071] Furthermore, we analyzed whether the map4k1 / 2 and map4k1 / 4 / 5 mutant materials responded to osmotic stress treatment. We found that the water loss rate of detached leaves was significantly faster with map4k1 / 2 compared to wild-type Col-0. This suggests that MAP4K1 / 2 may be involved in regulating stomatal movement under osmotic stress. The water loss rate of detached leaves of the map4k1 / 4 / 5 triple mutant was essentially the same as that of the wild type, indicating that MAP4K1 / 2 is the main MAP4K protein family member regulating the relative water loss rate of detached leaves.

[0072] The survival rate of the mutant map4k1 / 4 / 5 under dehydration stress was only about 10%, which is significantly different from the survival rate of wild-type Col-0, which is about 70%. This indicates that MAP4K1 / 4 / 5 is the main protein in the MAP4K family that regulates dehydration tolerance. Further observation of the growth phenotype in high-concentration mannitol and NaCl media revealed that the map4k1 / 4 / 5 triple mutant showed no significant difference from wild-type Col-0 after two weeks of growth on 1 / 2 MS medium containing 100 mM mannitol. This further suggests that MAP4K3 / SIK1 plays an irreplaceable role in mannitol-mimicked osmotic stress signaling. The creation of the map4k1 / 4 / 5 / sik1 quadruple mutant may help answer whether MAP4K is involved in mannitol-mimicked osmotic stress signaling.

[0073] Surprisingly, after two weeks of growth on 1 / 2 MS medium containing 75 mM NaCl, the taproot of MAP4K1 / 4 / 5 completely veered to one side. Meanwhile, the taproot of the wild-type Col-0 at the same time showed only a slight rightward shift. This indicates that under salt stress, MAP4K1 / 4 / 5 plays a crucial role in regulating taproot growth direction. This salt-avoidance growth tendency allows the mutant plant to grow in high-salt environments, thus enhancing its salt tolerance.

[0074] Example 5: The mutant map4k1 / 4 / 5 exhibits right-handed spiral growth under salt stress.

[0075] Based on the classic physiological phenotype of osmotic stress response, we found that the primary root growth direction of the map4k1 / 4 / 5 triple mutant deviated to the right under salt stress. Next, we conducted a concentration gradient experiment, transferring 3-4 day old wild-type Col-0 and mutant map4k1 / 4 / 5 cells to 1 / 2 MS medium containing 0, 50, 75, or 100 mM NaCl and growing them for one week. Figure 4(A). We found that on 50 mM NaCl medium, the taproot of map4k1 / 4 / 5 began to deflect to the right; while on 75 mM NaCl medium, the taproot of map4k1 / 4 / 5 grew horizontally to the right of the ground; and even on 100 mM NaCl medium, the taproot of map4k1 / 4 / 5 grew spirally. This phenotype appears to resemble chiral movement in plants (Nakamura et al., 2020). Chiral movement in plants is defined as follows: when observing at the growth or movement end, if the spiral direction is indicated by the four fingers of the right hand and the direction pointed to by the right thumb, it is a right-handed spiral, also known as right-handedness; otherwise, it is left-handedness. Therefore, using a stereomicroscope to magnify the roots of Arabidopsis thaliana seedlings and observe them over time, we found that the taproot of map4k1 / 4 / 5 began to spiral approximately 4-6 hours after treatment with 75 mM NaCl, the spiral growth was clearly visible after 12 hours, and the phenotype was visible to the naked eye after 24 hours. Based on the spiral growth direction, the change in the primary root growth direction of map4k1 / 4 / 5 under salt stress can be defined as salt-induced right-handed movement in plants.

[0076] Example 6: SnRK2 mutations inhibit right-handed chiral growth of map4k1 / 4 / 5 under salt stress

[0077] Previously, our lab discovered that salt avoidance in the taproot of Arabidopsis thaliana was also caused by a right-handed spiral, leading to the taproot's deviation from salt stress (Yu et al., 2022a). Salt avoidance in plant taproots is due to uneven salt concentrations on both sides, and the specific molecular mechanism is as follows: uneven salt concentrations induce asymmetric accumulation of ABA (abscisic acid) on both sides of the taproot. The side with higher ABA content activates the downstream core protein kinase SnRK2. The activated SnRK2 kinase modifies the microtubule-binding protein SP2L through phosphorylation, thereby regulating microtubule relocation and driving the cell to twist and spiral. Therefore, we hypothesize that the right-handed spiral growth of the taproot in the map4k1 / 4 / 5 mutant under salt stress may also be caused by the hyperactivation of the ABA-downstream protein kinase SnRK2.

[0078] We obtained the F2 population by hybridizing the map4k1 / 4 / 5 triple mutant and the snrk2.2 / 3 / 6 triple mutant, and isolated the map4k1 / 4 / 5snrk2.2 / 3 / 6 hexaple mutant and the map4k1 / 4 / 5snrk2.2 / 3 / 6 (+-, where SnRK2.6 is heterozygous and the other 5 genes are homozygous mutants) 5.5 mutant. Using the enhanced right-handed chirality phenotype of the map4k1 / 4 / 5 triple mutant under salt induction as a positive control, we found that under salt stress, the taproot growth direction of the map4k1 / 4 / 5snrk2.2 / 3 / 6 (+-) 5.5 mutant and the map4k1 / 4 / 5snrk2.2 / 3 / 6 hexaple mutant was basically consistent with that of the wild-type Col-0. The above results indicate that salt stress-induced enhanced right-handed chirality in the map4k1 / 4 / 5 triple mutant is due to SnRK2 protein kinase hyperactivation. Figure 5 ).

[0079] In salt avoidance experiments, Christa Testerink's lab found that when 5 μM ABA (abscisic acid) was applied simultaneously to the salt-containing medium side, the taproot of Arabidopsis thaliana grew normally downwards without moving away from salt stress (Lamers et al., 2023). Further research revealed that exogenous ABA application inhibits the plant's salt avoidance response by suppressing its salt response (Lamers et al., 2023). We also observed a similar phenomenon by adding an additional 0.5 μM ABA to 75 mM NaCl medium. Compared to 75 mM NaCl medium without additional ABA, the taproot growth direction of the map4k1 / 4 / 5 mutant on 1 / 2 MS medium with both ABA and NaCl was similar to that of the wild-type Col-0. Figure 6 This aligns with the findings of Christa Testerink's lab, which showed that exogenous application of ABA inhibits the plant salt response.

[0080] Example 7: Right-handed chiral movement and cell wall involvement under salt stress in mutant map4k1 / 4 / 5

[0081] Chiral movement, a type of plant growth movement, is theoretically determined by the interaction between the cell wall and turgor pressure (Ali et al., 2023). Recently, Professor Pengcheng Wang's research group at Southern University of Science and Technology reported that EGTA (ethylene glycol bis(2-aminoethyl ether)tetraacetic acid) and high concentrations of mannitol can induce similar phosphorylation modifications in Arabidopsis seedling proteins; for example, both EGTA and mannitol can induce an increase in the abundance of MAP4K1 / 4 / 5 phosphorylation (Sang et al., 2024). Previous studies have also shown that sodium ions may replace calcium ions in the cell wall, thereby disrupting cell wall integrity (Feng et al., 2018). EGTA is a commonly used reagent for chelating calcium ions in solution, thus prompting us to link cell wall calcium ions with chiral movement under salt stress. First, when we added different concentrations of EGTA to 75 mM NaCl medium, we found that salt stress-induced chiral movement was inhibited when EGTA was added within a certain concentration range. However, when the EGTA concentration reached 10 mM, Arabidopsis seedlings died (…). Figure 7 (A). When we added boric acid (BA), a reagent that promotes pectin and calcium ion cross-linking and enhances cell wall rigidity, to 75 mM NaCl medium, we unexpectedly found that BA could enhance salt stress-induced chiral movement. Figure 7 (B). When different concentrations of calcium ions were added to the 75 mM NaCl medium, we found that when 10 mM calcium ions were added, salt stress-induced right-handed hand movement under map4k1 / 4 / 5 salt stress was almost completely inhibited, approaching the wild-type level. Figure 7 (C)

[0082] Example 8: WNK interacts with MAP4K and phosphorylates MAP4K

[0083] The map4k1 / 4 / 5 triple mutant exhibited enhanced right-handed chirality after induction of plant salt stress. To determine whether this physiological phenotype was caused by salt signaling or sodium ion toxicity due to excessive accumulation, 9-day-old wild-type and mutant seedlings were transferred to 75 mM NaCl medium and treated for 12 hours. The sodium ion content accumulated in the roots was then measured using inductively coupled plasma mass spectrometry (ICP-MS). Using the sos1 mutant as a positive control, we found that the sodium ion content accumulated in the roots of the map4k1 / 4 / 5 triple mutant was similar to that of the wild-type Col-0, but significantly lower than that of the sos1 mutant. Figure 8 This indicates that the enhanced chiral movement phenotype of the map4k1 / 4 / 5 triple mutant under salt stress is caused by salt signaling.

[0084] IP-MS is a powerful technique for resolving target-protein interactions. Therefore, we constructed three transgenic materials: 35Spro:MAP4K1-Myc, 35Spro:MAP4K4-Myc, and 35Spro:MAP4K5-Myc. After immunoprecipitation of the MAP4K1, MAP4K4, and MAP4K5 complexes from 9-day-old transgenic seedlings, we performed mass spectrometry analysis. Through integration analysis with results from Ive DeSmet's laboratory (Pan et al., 2024), we identified a class of protein kinases belonging to the WITH NO LYSINE(K) KINASE(WNK) family in the intersection. Figure 9 (A). Therefore, we hypothesized that the WNK family members might be core interacting proteins of MAP4K. The WNK family is a subfamily of the MAPKKK family, comprising 11 members (Hong-Hermesdorf et al., 2006). Since the physiological phenotypes of map4k1 / 4 / 5 under salt stress are mainly observed in the roots, we first analyzed the expression patterns of WNK. We downloaded Arabidopsis WNK root expression data from ePlant (https: / / bar.utoronto.ca / eplant / ) and found that WNK1, 5, and 8 were highly expressed in the roots. Furthermore, we extracted RNA from 9-day-old roots treated with salt stress, and qRT-PCT results showed a significant increase in WNK9 expression after 6 hours of salt treatment. Finally, we selected WNK1, 5, 8, and 9 for further research.

[0085] Example 9: Interaction between WNK and MAP4K and MAP4K phosphorylation

[0086] Next, since both WNK and MAP4K possess kinase activity, we performed in vitro phosphorylation assays. Because the prokaryotic expression levels of MAP4K1 and MAP4K5 proteins are very low and mostly contained in inclusion bodies, we used MAP4K4 protein (NCBI accession number AT5G14720) as a representative of MAP4K. WNK1, 5, and 9 proteins are also difficult to express and purify. Therefore, in the in vitro phosphorylation assays, WNK8 (NCBI accession number...) was used. AT5G41990 Experiments were conducted using WNK8 as a representative. In in vitro phosphorylation experiments, we found that WNK8 has a strong phosphorylation ability for MAP4K4. Figure 9 (B). The above results indicate that WNK can interact with MAP4K and phosphorylate MAP4K4.

[0087] In in vitro experiments, the preparation method of MAP4K4 protein (NCBI accession number AT5G14720) includes the following steps.

[0088] 1. Expression vector construction: The coding sequences of MAP4K4 and WNK8 were amplified and cloned into the pMAL-C2X and pD2p vectors, respectively. MAP4K4 was fused with the N-terminal MBP tag, while WNK8 was fused with the C-terminal GFP tag.

[0089] 2. Expression and purification of recombinant proteins: The pMAL-MAP4K4 prokaryotic expression vector was transformed into E. coli BL21(DE3) and induced with 1 mM isopropyl β-D-thiogalactoside (IPTG) at 18°C ​​for 16 h. The protein was then enriched using AmyloseResin (NEB, E8021L) according to a standardized procedure. The expression and purification of pD2p-WNK8 protein were strictly performed according to the instructions of Kangma Biotechnology (catalog number: profac_ary0601000).

[0090] The amino acid sequence of the obtained MAP4K4 protein (NCBI accession number AT5G14720) is shown in SEQ ID NO: 1.

[0091] WNK8 (NCBI Registry Number) was prepared using the same method. AT5G41990 The protein has the amino acid sequence shown in SEQ ID NO: 2.

[0092] Example 10: The wnk1 / 5 / 8-1 / 9 quadruple mutant exhibits right-handed chiral movement under salt stress.

[0093] Since WNK can interact with and phosphorylate MAP4K, does the WNK protein kinase also participate in regulating salt stress-induced right-handed helical growth? To investigate this question, we obtained the wnk1 / 5 / 8-1 / 9 quadruple mutant through hybridization. Wild-type Col-0 and wnk1 / 5 / 8-1 / 9 quadruple mutants of uniform size, grown for 3-4 days, were transferred to 1 / 2 MS plates containing different concentrations of sodium chloride. Phenotypic results were observed after 5-7 days. Through sodium chloride concentration gradient experiments, we found that the wnk1 / 5 / 8-1 / 9 quadruple mutant exhibited near-horizontal taproot growth after treatment with 75 mM NaCl. Furthermore, when the sodium ion concentration reached 100 mM, the degree of helical taproot growth in the wnk1 / 5 / 8-1 / 9 quadruple mutant was similar to that of the map4k1 / 4 / 5 triple mutant under 75 mM NaCl treatment. Figure 10 This may be because wnk8-1 in the wnk1 / 5 / 8-1 / 9 quadruple mutant is a knockdown mutation, thus the phenotype is slightly weaker. However, in general, the wnk1 / 5 / 8-1 / 9 quadruple mutant and the map4k1 / 4 / 5 triple mutant may be located in the same signaling pathway regulating salt stress-induced right-handed motor movement.

[0094] Example 11: Mutations in the rice gene OsWNK4 can enhance the salt tolerance of rice seedlings.

[0095] Since the Arabidopsis thaliana wnk1 / 5 / 8-1 / 9 quadruple mutant exhibited significant changes in root growth direction under salt stress, we hypothesized that homologous genes of WNK protein kinases in rice may also have conserved functions, namely, enhancing the plant's salt tolerance by regulating root growth direction under salt stress. The rice genome contains nine WNK family members. To verify this hypothesis, we ordered relevant rice mutant materials from Hangzhou Baige Biotechnology Co., Ltd. and screened them.

[0096] Rice seeds were soaked at 37℃ for 2 days, then transferred to petri dishes lined with moistened filter paper and cultured at 30℃ for another 3 days. Germinating seedlings were then transferred to hydroponic culture boxes, with the hydroponic nutrient solution changed every 2 days. After 9 days of growth, salt stress treatment was applied: 120 mM NaCl was added to the hydroponic solution, and the treatment solution was changed every 2 days. The rice hydroponic nutrient solution was purchased from Beijing Coollab Technology Co., Ltd. (item number: NS1050) and prepared according to the instructions, with an additional 1 g / L sodium metasilicate nonahydrate added. Plant phenotypes were photographed after 8 days of treatment. Scale bar: 3 cm.

[0097] The results showed that the OsWNK4 mutation significantly enhanced the salt tolerance of rice seedlings: under 120 mM NaCl treatment, the survival rate of the Oswnk4 mutant was significantly higher than that of the wild-type ZH11. Figure 11 This study confirmed that mutations in OsWNK4 improve rice seedling tolerance to salt stress.

[0098] The above are merely preferred embodiments of the present invention, and it should be understood that these preferred embodiments should not be considered as limitations on the present invention. For those skilled in the art, various improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the protection scope of the present invention.

[0099] References

[0100] Ali O., Cheddadi I., Landrein B., et al. Revisiting the relationship between turgor pressure and plant cell growth. New Phytologist, 2023, 238(1): 62-69.

[0101] Assmann S. M., Jegla T. Guard cell sensory systems: recent insightson stomatal responses to light, abscisic acid, and CO2. Current opinion inplant biology, 2016, 33: 157-167.

[0102] Bassham D., Han S. W., Alonso J. M., et al. REGULATOR OF BULBBIOGENESIS1 (RBB1) Is Involved in Vacuole Bulb Formation in Arabidopsis. PlosOne, 2015, 10(4): e0125621.

[0103] Fujii H., Verslues P. E., Zhu J. K. Arabidopsis decuple mutantreveals the importance of SnRK2 kinases in osmotic stress responses in vivo.Proceedings of the National Academy of Sciences of the United States ofAmerica, 2011, 108 (4): 1717-22.

[0104] Hasegawa P. M., Bressan R. A., Zhu J.-K., et al. Plant cellular andmolecular responses to high salinity. Annual Review of Plant Biology, 2000,51 (1): 463-499.

[0105] Hong-Hermesdorf A., Brux A., Gruber A., et al. A WNK kinase binds andphosphorylates V-ATPase subunit C. FEBS Lett, 2006a, 580 (3): 932-9.

[0106] Lamers J., Zhang Y., Van Zelm E., et al. Abscisic acid signalinggates salt-specific responses of plant roots. bioRxiv, 2023: 2023.12.28.572987.

[0107] Lin Z., Li Y., Zhang Z., et al. A RAF-SnRK2 kinase cascade mediatesearly osmotic stress signaling in higher plants. Nature Communications, 2020,11 (1): 613.

[0108] Liu G., Zeng Y., Li B., et al. SOS2 phosphorylates FREE1 to regulatemulti-vesicular body trafficking and vacuolar dynamics under salt stress. ThePlant Cell, 2025: koaf012.

[0109] Nakamura M., Hashimoto T. Mechanistic Insights into Plant ChiralGrowth. Symmetry, 2020, 12 (12): 2056.

[0110] Pan L., Fonseca De Lima C. F., Vu L. D., et al. Heterodimerizationdomains in MAP4 KINASEs determine subcellular localization and activity inArabidopsis. Plant Physiology, 2024, 195 (3): 1807-1817.

[0111] Patel T. K., Williamson J. D. Mannitol in Plants, Fungi, and Plant–Fungal Interactions. Trends in plant science, 2016, 21 (6): 486-497.

[0112] Soma F., Takahashi F., Suzuki T., et al. Plant Raf-like kinasesregulate the mRNA population upstream of ABA-unresponsive SnRK2 kinases underdrought stress. Nature Communications, 2020, 11 (1): 1373.

[0113] Takahashi Y., Zhang J., Hsu P. K., et al. MAP3Kinase-dependent SnRK2-kinase activation is required for abscisic acid signal transduction and rapidosmotic stress response. Nature Communications, 2020, 11 (1): 12.

[0114] Thomashow M. F. Plant cold acclimation: freezing tolerance genes andregulatory mechanisms. Annual Review of Plant Biology, 1999, 50 (1): 571-599.

[0115] Umezawa T., Sugiyama N., Takahashi F., et al. Genetics andphosphoproteomics reveal a protein phosphorylation network in the abscisicacid signaling pathway in Arabidopsis thaliana. Science signaling, 2013, 6(270): rs8-rs8.

[0116] Vu L. D., Xu X., Zhu T., et al. The membrane-localized protein kinaseMAP4K4 / TOT3 regulates thermomorphogenesis. Nature Communications, 2021, 12(1): 2842.

[0117] Wang L., Yan X., Li Y., et al. PRP4KA phosphorylates SERRATE fordegradation via 20 S proteasome to fine-tune miRNA production in Arabidopsis.Science Advances, 2022b, 8 (12): eabm8435.

[0118] Wang P., Hsu C.-C., Du Y., et al. Mapping proteome-wide targets ofprotein kinases in plant stress responses. Proceedings of the NationalAcademy of Sciences of the United States of America, 2020, 117 (6): 3270-3280.

[0119] Xiao Y., Offringa R. PDK1 regulates auxin transport and Arabidopsisvascular development through AGC1 kinase PAX. Nature Plants, 2020, 6 (5):544-555.

[0120] Yu B., Zheng W., Xing L., et al. Root twisting drives halotropism viastress-induced microtubule reorientation. Developmental Cell, 2022a, 57 (20):2412-2425.

[0121] Zhao S., Jiang Y., Zhao Y., et al. CASEIN KINASE1-LIKE PROTEIN2Regulates Actin Filament Stability and Stomatal Closure via Phosphorylationof Actin Depolymerizing Factor. The Plant Cell, 2016, 28 (6): 1422-1439.

[0122] Zhao Y., Zhang Z., Gao J., et al. Arabidopsis Duodecuple Mutant ofPYL ABA Receptors Reveals PYL Repression of ABA-Independent SnRK2 Activity.Cell Reports, 2018, 23 (11): 3340-3351.

[0123] Zhou B., Yu H., Xue Y., et al. The spliceosome-associated proteinCWC15 promotes miRNA biogenesis in Arabidopsis. Nature Communications, 2024a,15 (1): 2399.

[0124] Zhou H., Shi H., Yang Y., et al. Insights into plant salt stresssignaling and tolerance. Journal of Genetics and Genomics, 2024b, 51 (1): 16-34.

[0125] Zhou P. M., Liang Y., Mei J., et al. The Arabidopsis AGC kinasesNDR2 / 4 / 5 interact with MOB1A / 1B and play important roles in pollendevelopment and germination. The Plant Journal, 2020, 105 (4): 1035-1052.

Claims

1. The use of WNK protein kinase, or MAP4K protein kinase that interacts with WNK protein kinase and is phosphorylated by WNK, in improving the salt tolerance of plant roots.

2. The use as described in claim 1, characterized in that, The plants mentioned are crop plants, model plants, monocotyledonous plants, dicotyledonous plants, plants with crassulacean acid metabolism (CAM) photosynthesis, plants with C3 photosynthesis, plants with C4 photosynthesis, annual plants, greenhouse plants, horticultural flowering plants, perennial plants, switchgrass plants, maize plants, biomass plants, or sugarcane plants.

3. The use as described in claim 1, characterized in that, When the plant is Arabidopsis thaliana, the WNK protein kinase is selected from the following group: WNK1 (2025 version NCBI accession number AT3G04910), WNK5 (2025 NCBI accession number AT3G51630), WNK8 (2025 NCBI accession number AT5G41990), and WNK9 (2025 NCBI accession number AT5G28080); the MAP4K protein kinase is a combination of MAP4K1 (2025 NCBI accession number AT1G53165), MAP4K4 (2025 NCBI accession number AT5G14720), and MAP4K5 (2025 NCBI accession number AT4G24100), i.e., MAP4K1 / 4 / 5; When the plant is rice, the WNK protein kinase is selected from the group consisting of: WNK1 (version LOC_Os07g38530, 2025 NCBI accession number LOC_Os05g01780), WNK3 (version LOC_Os07g08750, 2025 NCBI accession number LOC_Os02g45130), WNK5 (version LOC_Os07g08750, 2025 NCBI accession number LOC_Os02g45130), and WNK5 (version LOC_Os07g08750, 2025 NCBI accession number LOC_Os07g08750). The preferred versions are g39520, WNK6 (2025 NCBI login number LOC_Os11g06140), WNK7 (2025 NCBI login number LOC_Os11g02300), WNK8 (2025 NCBI login number LOC_Os12g02250), WNK9 (2025 NCBI login number LOC_Os12g06490), and OsWNK4 (2025 NCBI login number LOC_Os02g45130).

4. The use as described in claim 1 is a method for improving the salt tolerance of plant roots by targeting the WNK or MAP4K genes as described in claim 1, or a method for cultivating new varieties of salt-tolerant plants, characterized in that... Includes the following steps: It can downregulate, inactivate, weaken, or knock out the expression of WNK or MAP4K genes in the chromosomes of wild-type plants.

5. The use as described in claim 4, characterized in that, In one implementation, the downregulation, inactivation, weakening or knockout of the WNK or MAP4K gene expression causes a change in the direction of plant taproot growth toward a low-salt environment.

6. The use as described in claim 4, characterized in that, The following methods can be used to improve the salt tolerance of plant roots, i.e., resistance to salt stress: (1) Knock out the WNK or MAP4K gene described in the chromosome of wild-type plants; (2) Downregulate the expression levels of the genes WNK or MAP4K in the chromosomes of wild-type plants; (3) Replace the WNK or MAP4K gene in the chromosome of wild-type plants with a WNK or MAP4K mutant that has lost or downregulated coding function; and / or (4) Block, inhibit or interfere with the expression of the WNK or MAP4K gene in the chromosomes of wild-type plants.

7. The use as described in claim 6, characterized in that, Method (2) is selected from the following group: (2-1) Mutations in the promoter region and / or coding region of the WNK or MAP4K gene lead to downregulation of the expression level of the WNK or MAP4K gene; (2-2) Mutations in upstream regulators of the WNK or MAP4K gene lead to downregulation of the expression level of the WNK or MAP4K gene; or (2-3) Introduce the interacting proteins of WNK or MAP4K into wild-type plants to alter the function of the WNK or MAP4K genes.

8. The use as described in claim 7, characterized in that, The mutation in the coding region in the method (2-1) is a codeshift mutation, which causes the WNK or MAP4K to become inactive or lose its function.

9. The use as described in claim 6, characterized in that, The methods (1), (2), (3) and / or (4) are implemented through gene editing technology, antisense nucleic acid, and transcriptional regulation.

10. The use as described in claim 8, characterized in that, The gene editing technology is selected from the following group: homologous double crossover, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, and MuGENT.